Summary for ontology term: sediment

Number of annotations with term: 184

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Alteromonadales;f__Alteromonadaceae;g__HalieaTACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTTGTTAAGTCAGCTGTGAAAGCCCCGGGCTCAACCTGGGAACTGCAGTTGATACTGGCCGACTAGAGTACGAGAGAGGGAGGTAGAATTCCATG0.039106
d__BacteriaTACGTAGGGGCCAAGCGTTATCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGGTAAGTCGGTCGTGAAAGTCCGAGGCTCAACCTCGGAATGCCGGTCGATACTGCCATGACTAGGGTTCGGTAGAGGAGAGTGGAATTCTCG0.027933
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__BacillariophytaGACGGAGGATGCAAGTGTTATCCGGAATCACTGGGCGTAAAGCGTCTGTAGGTGGTTTAATAAGTCAACTGTTAAATCTTGAGGCTCAACTTCAAAATCGCAGTCGAAACTATTAGACTAGAGTATAGTAGGGGTAAAGGGAATTTCCAG0.022346
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp23;g__Gp23TACGGAGGGGGCAAGCGTTATTCGGATTTACTGGGCGTAAAGCGCACGTAGGTGGCATGGTAAGTCAAAGGTGAAAGCCCTCGGCTCAACCGAGGAATTGCCTTTGAAACTGCTTTGCTTGAGTCCGGGAGGGGGGAGCGGAATTCCCAG0.022346
d__BacteriaAACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGCGTAAAGCGCGTGCAGGCGGCTTAGTAGGTTGGACGTGAAAGCTCCTGGCTCAACTGGGAGAGGCCGTTCAATACCGCTAGGCTCGAGGGCGGAAGAGGGGAGTGGAATTCCCGG0.022346
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfobacterales;f__DesulfobacteraceaeTACGGGGGGTGCAAGCGTTATTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCGGTCTCTAAAGTCAGATGTGAAAGCCCGGGGCTTAACCCCGGAAGTGCATTTGAAACTCAGGGACTTGAGTATGGGAGAGGGAAGTGGAATTCCTGG0.022346
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfobacterales;f__DesulfobacteraceaeTACGGAGGGTGCAAGCGTTATTCGGAATCACTGGGCGTAAAGAGCGCGTAGGCGGTTTCTAAAGTCAGATGTGAAAGCCCGGGGCTCAACCCCGGAAGTGCATTTGAAACTTAGGGACTTGAGTATGGGAGAGGGAAGTGGAATTCCTGG0.022346
d__Bacteria;p__"Chloroflexi";c__Anaerolineae;o__Anaerolineales;f__AnaerolineaceaeCACGTAGGAGGCAAGCGTTATCCGGATTTACTGGGCGTAAAGCGCGTGCAGGCGGTTTGGTAAGTTGGATGTGAAAGCTCCTGGCTTAACTGGGAGAGGTCGTTCAATACTGCCAAACTAGAGGACGGTAGAGGAAGGTAGAATTCCTGG0.022346
d__BacteriaTACGGAGGGTGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGTGTAGGCGGTTAGGCAAGTCAGGTGTGAAATCCCTTGGCTCAACCAAGGAAGTGCGCTTGAAACTGCTTAACTAGAGTACAGGAGGGGAAAGTGGAATTCCCAG0.022346
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__ChromatialesTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTTGTTAAGTCGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTCGATACTGGCAGGCTAGAGTATGGTAGAGGGAAGTGGAATTCCGGG0.022346

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACATAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGTCGTTTGTTACGTCGGATGTGAAAACCTGAGGCTCAACCTCAGGCCTGCATTCGATACGGGCAAACTAGAGTTTGGTAGGGGAGACTGGAATTCCTGG0.363636
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales"TACGGAGGGTGCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGCAGGCGGATTTATAAGTCAGTGGTGAAATCCTATCGCTTAACGATAGAACTGCCATTGATACTGTAAGTCTTGAATTCGGTCGGAGTGGGCGGAATGTGTAG0.363636
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaTACGAAGGGGGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGTCTTTTAAGTTAGGCGTGAAAGCCCCGGGCTCAACCCGGGAACTGCGCTTAAGACTGGAAGACTAGAAAACGGAAGAGGGTAGTGGAATTCCCAG0.363636
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__Cytophagales;f__CytophagaceaeTACGGAGGGTGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGCAGGTGGTTTATTAAGTCAGTGGTGAAAGACGGTCGCTCAACGATTGCAGTGCCATTGAAACTGGTAGACTTGAGTAAAGTAGAGGTGGGCGGAATTGATAG0.272727
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;f__SAR11;g__Candidatus PelagibacterTACGAAGGGACCTAGCGTAGTTCGGAATTACTGGGCTTAAAGAGTTCGTAGGTGGTTGAAAAAGTTGGTGGTGAAATCCCAGAGCTTAACTCTGGAACTGCCATCAAAACTTTTCAGCTAGAGTATGATAGAGGAAAGCAGAATTTCTAG0.272727
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAAGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAAGCCCTGGGCTCAACCTAGGAACTGCATCCAAAACTAACTCACTAGAGTACGATAGAGGGAGGTAGAATTCATAG0.272727
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__Rhodobacteraceae;g__LoktanellaTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATTGGAAAGTTGGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTCCAAAACTATCAGTCTAGAGTTCGAGAGAGGTGAGTGGAATTCCAAG0.272727
d__Bacteria;p__"Proteobacteria"TACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTATGTAGGCGGATCAAAAAGTTAGATGTGAAATCCCTGGGCTCAACCCAGGAACTGCATTTAAAACTAGTGATCTAGAATTTGGTAGGGGCCAGTAGAATTTCCAG0.272727
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__MicrobacteriaceaeTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAAATCCGAGGCTCAACCTCGGACCTGCAGTGGGTACGGGCAAACTAGAGTGCGGTAGGGGAGATTGGAATTCCTGG0.272727
d__Bacteria;p__"Proteobacteria"TACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTATGTAGGCGGATCAAAAAGTTAGATGTGAAATCCCTGGGCTCAACCCAGGAACTGCATTTAAAACTAGTGATCTAGAATTTGGTAGGGGTTAGTAGAATTTCCAG0.272727

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfobacterales;f__DesulfobacteraceaeTACGGAGGGTGCAAGCGTTATTCGGAATCACTGGGCGTAAAGAGCGCGTAGGCGGTTTCTAAAGTCAGATGTGAAAGCCCGGGGCTCAACCCCGGAAGTGCATTTGAAACTTAGGGACTTGAGTATGGGAGAGGGAAGTGGAATTCCTGG0.328889
d__Bacteria;p__"Proteobacteria";c__DeltaproteobacteriaTACGGAGGGTGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGAGCGTGTAGGCGGTTCGGTAAGTCAGATGTGAAAGCCCTGGGCTCAACCCAGGAAGTGCATTTGAAACTACCAGACTTGAGTACGGGAGAGGAGGGGGGAATTCCCGG0.323144
d__Bacteria;p__"Chloroflexi"CACGTAGGATCCGAGCGTTATCCGAATTTACTGGGCGTAAAGCGCGTGTAGGCGGCCGGGTAAGTTGGACGTGAAAGCTCCTGGCTCAACTAGGAGAGGTCGTTCAAAACTGCCTGGCTAGAGGGCGACAGAGGGAGGTGGAATTCCCGG0.313364
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTACGTAGGCGGAAAATTAAGTCAGTAGTGAAATCCTGCAGCTTAACTGTAGAACTGTTATTGATACTGGTTTTCTTGAATATAGTTGAGGTAGGCGGAATGTGTAA0.303030
d__Bacteria;p__"Proteobacteria"TACGGAGGGTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGAGCGTGTAGGCGGGTTGGTAAGTCAGATGTGAAAGCCCCGGGCTCAACCCGGGAAGTGCATTTGAAACTGCCTTTCTTGAGTATGGGAGAGGAGAGTGGAATTCCCAG0.291080
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGTTTACTAAGTCAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTGATACTGGTAGGCTAGAGTATGATAGAGGGGGGTAGAATTCCTGG0.290749
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfobacterales;f__DesulfobacteraceaeTACGGGGGGTGCGAGCGTTATTCGGAATTACTGGGCGTAAAGAGCGCGTAGGCGGTCTTTTAAGTCAGGTGTGAAAGCCCGGGGCTCAACCCCGGAAGTGCACTTGAAACTAAGAGACTTGAGTATGGGAGAGGGAAGTGGAATTCCTGG0.288136
d__BacteriaTACGGAGGGCGCGAGCGTTATTCGGAATCATTGGGCGTAAAGCGCGTGTAGGCGGCTGGGCAAGTCGGATGTGAAAGCCCGGGGCTCAACCCCGGAATTGCATTCGAAACTGCTCAGCTAGAGTCTCGGAGAGGAGGGCGGAATTCCCGG0.285714
d__Bacteria;p__"Proteobacteria"TACAGAGGGTGCAAACGTTGCTCGGATTTACTGGGCGTAAAGCGCGTGTAGGCGGACTCGCAAGTCGGTTGTGAAATCCCTGGGCTCAACCTAGGAACTGCATCCGAAACTGCTTGTCTTGAGTAATGGAGAGGGTGGCGGAATTCCCGG0.274510
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfuromonadales;f__DesulfuromonadaceaeTACGGAGGGTGCAAACGTTGTTCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTCTGTCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGAAGTGCATTGGAAACTGGCAGACTTGAGTACGGGAGAGGAAAGTGGAATTTCGAG0.267857

Annotations:

common ontology terms
term enrichment score
TermScore
sediment0.730203
marine sediment0.706282
ocean0.322549
lake sediment0.246609
oil seep0.225734
pacific ocean0.208333
mangrove swamp0.180556
spartina alterniflora0.132075
mangrove0.103448
north east pacific ocean0.103286
depth (water) 500-1000m0.098876
kandelia candel0.098039
sediment surface0.093264
china0.090967
east china sea0.089109
water0.085761
depth (water) 4000m0.081633
depth (water) 1000-2000m0.080000
quesnel lake0.080000
state of oregon0.076923
estuary0.074074
province of british columbia0.074074
hainan autonomous prefecture0.074074
taihu national park0.073298
depth (water) 2000-3000m0.070707
zhejiang province0.070423
lake0.070175
sea water0.068506
depth (water) 2000-5000m0.068293
new york city0.066667
LOWER IN sediment0.063253
guangdong province0.062500
river0.061947
hydrothermal vent0.061224
volcanic crater0.061224
volcanic rock0.061224
marine hydrothermal vent0.061224
greece0.061224
brackish water0.061224
caspian sea0.061224
carbonate0.061224
lithified carbonate blocks0.061224
hydrate ridge0.061224
xiannv lake0.061224
sediment depth 0-10cm0.061224
mine tailing0.061224
alkaline mine tailing0.061224
futian national nature reserve0.061224
mudflat0.061224
saline marsh0.059406
heavy metal0.059406
reservoir0.059406
guangxi zhuang autonomous region0.059406
depth (water) 20-100cm0.058333
atlantic ocean0.057143
state of new york0.057143
peatland0.056075
mediterranean sea0.054545
fresh water0.053333
soil0.052278
state of minnesota0.051724
sediment depth 0-5cm0.051546
freshwater biome0.050251
upper mississippi river0.050251
LOWER IN marine sediment0.049751
depth (water) 150-500m0.049020
mississippi river0.049020
depth 5cm0.047847
rhizosphere0.044444
sweden0.043796
depth (soil) 0-20cm0.042484
united states of america0.042461
sediment depth 8-10cm0.042105
sediment depth 12-35cm0.041667
continental shelf0.041667
depth 400-800m0.041667
bodega bay0.041667
nan'ao island0.041667
yellowstone national park0.041667
canada0.041667
manganika lake0.041667
hypereutrophic lake0.041667
sulfidic bottom water0.041667
danzhou xinyinggang nature reserve0.041667
leizhou nature reserve0.041667
ximendao national marine reserve0.041667
dongzhaigang national nature reserve0.041667
shenzhen futian national nature reserve0.041667
LOWER IN other regions0.041667
zostera marina0.040816
marine eelgrass0.040816
geothermal field0.040816
san diego0.040816
depth (water) 200m0.040000
high temperature environment0.040000
LOWER IN water0.039565
antarctica0.039216
biofilm0.037736
spring0.032086
active vent0.031579
Fraction of dbbact annotations with this term covered by the query
TermScore
lake sediment1.333333
sediment surface1.000000
LOWER IN sediment surface1.000000
taihu national park1.000000
spring1.000000
LOWER IN spring1.000000
marine sediment0.941176
sediment0.812500
oil seep0.666667
depth (water) 4000m0.666667
sediment depth 8-10cm0.666667
hydrothermal vent0.500000
volcanic crater0.500000
volcanic rock0.500000
marine hydrothermal vent0.500000
greece0.500000
active vent0.500000
inactive vent0.500000
LOWER IN active vent0.500000
LOWER IN inactive vent0.500000
klamath knoll0.500000
astorya canyon sw wall0.500000
juan de fuca nehalem0.500000
hecceta sw0.500000
depth (water) 1000-2000m0.500000
coquille sw0.500000
barkley canyon0.500000
LOWER IN sediment depth 0-5cm0.500000
LOWER IN depth 8-10cm0.500000
polymetallic nodule0.500000
LOWER IN polymetallic nodule0.500000
brackish water0.500000
caspian sea0.500000
depth (water) 150-600m0.500000
sediment depth 0-12cm0.500000
sediment depth 12-35cm0.500000
sediment depth 24-35cm0.500000
LOWER IN sediment depth 12-24cm0.500000
sediment depth 12-24cm0.500000
LOWER IN sediment depth 24-35cm0.500000
continental shelf0.500000
depth 400-800m0.500000
bodega bay0.500000
spartina alterniflora0.500000
hunts point0.500000
LOWER IN soundview0.500000
LOWER IN oyster reef0.500000
soundview0.500000
oyster reef0.500000
LOWER IN hunts point0.500000
LOWER IN uranium0.500000
LOWER IN high uranium0.500000
kakadu national park0.500000
uranium0.500000
high uranium0.500000
high urnaium0.500000
sand0.500000
epipsammic0.500000
LOWER IN epilithic0.500000
epilithic0.500000
LOWER IN sand0.500000
LOWER IN epipsammic0.500000
shrimp farm0.500000
sediment depth 0-5cm0.500000
active methane seep0.500000
LOWER IN low activity methane seep0.500000
carbonate0.500000
lithified carbonate blocks0.500000
hydrate ridge0.500000
low activity methane seep0.500000
LOWER IN active methane seep0.500000
freshwater sediment metagenome0.500000
tilapia0.500000
LOWER IN mussel0.500000
LOWER IN unionidae0.500000
mussel0.500000
unionidae0.500000
shore0.500000
xiannv lake0.500000
sediment depth 0-10cm0.500000
nan'ao island0.500000
zone 10.500000
LOWER IN zone 2,30.500000
mine tailing0.500000
alkaline mine tailing0.500000
zone 2,30.500000
LOWER IN zone 10.500000
clayoquot slope0.500000
thermophilic sediment0.500000
yellowstone national park0.500000
quesnel lake0.500000
LOWER IN contaminated sediment0.500000
depth (water) 2000-3000m0.500000
cascadia basin0.500000
contaminated sediment0.500000
mcquade lake0.500000
manganika lake0.500000
hypereutrophic lake0.500000
sulfidic bottom water0.500000
endeavour0.500000
Fraction of annotations for the query sequences containing the term
TermScore
sediment0.663043
marine sediment0.565217
china0.347826
ocean0.255435
pacific ocean0.217391
soil0.190217
united states of america0.168478
mangrove swamp0.141304
depth (soil) 0-20cm0.141304
oil seep0.135870
lake sediment0.135870
north east pacific ocean0.119565
spartina alterniflora0.076087
water0.070652
mangrove0.065217
depth (water) 500-1000m0.059783
depth (sediment) 0-20cm0.059783
kandelia candel0.054348
zhejiang province0.054348
sea water0.048913
sediment surface0.048913
east china sea0.048913
depth (water) 1000-2000m0.043478
depth (water) 4000m0.043478
rhizosphere0.043478
atlantic ocean0.043478
estuary0.043478
state of new york0.043478
new york city0.043478
state of oregon0.043478
lake0.043478
fresh water0.043478
canada0.043478
province of british columbia0.043478
quesnel lake0.043478
hainan autonomous prefecture0.043478
guangdong province0.043478
LOWER IN sediment0.038043
river0.038043
taihu national park0.038043
depth (water) 20-100cm0.038043
taihu lake0.038043
depth (water) 2000-3000m0.038043
depth (water) 2000-5000m0.038043
hydrothermal vent0.032609
volcanic crater0.032609
volcanic rock0.032609
marine hydrothermal vent0.032609
mediterranean sea0.032609
greece0.032609
brackish water0.032609
caspian sea0.032609
saline marsh0.032609
carbonate0.032609
lithified carbonate blocks0.032609
hydrate ridge0.032609
peatland0.032609
sweden0.032609
stordalen mire0.032609
heavy metal0.032609
reservoir0.032609
xiannv lake0.032609
sediment depth 0-10cm0.032609
mine tailing0.032609
guangxi zhuang autonomous region0.032609
alkaline mine tailing0.032609
state of minnesota0.032609
futian national nature reserve0.032609
mudflat0.032609
depth (water) 150-500m0.027174
LOWER IN marine sediment0.027174
sediment depth 0-5cm0.027174
freshwater biome0.027174
mississippi river0.027174
depth 5cm0.027174
upper mississippi river0.027174
LOWER IN water0.027174
sediment depth 8-10cm0.021739
depth (water) 200m0.021739
sediment depth 12-35cm0.021739
continental shelf0.021739
antarctica0.021739
depth 400-800m0.021739
zostera marina0.021739
state of california0.021739
bodega bay0.021739
marine eelgrass0.021739
LOWER IN control0.021739
biofilm0.021739
nan'ao island0.021739
geothermal field0.021739
yellowstone national park0.021739
high temperature environment0.021739
manganika lake0.021739
hypereutrophic lake0.021739
sulfidic bottom water0.021739
danzhou xinyinggang nature reserve0.021739
leizhou nature reserve0.021739
ximendao national marine reserve0.021739
dongzhaigang national nature reserve0.021739
Exp. ID User ID Description Date Region Flag Sequences
571amnondominant mangrove swamp, soil, marine sediment, guangdong province, mudflat, china, shenzhen futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1
166amnonhigh freq. in river sediment (5cm) with mussels (dominant united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river, mussel, unionidae)2017-07-18v4No1 / 2
198amnon high in water compared to sediment in united states of america geothermal field yellowstone national park high temperature environment 2017-09-14v4No1 / 2
571amnondominant mangrove swamp, soil, marine sediment, spartina alterniflora, zhejiang province, china, futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 2
571amnondominant mangrove swamp, soil, marine sediment, guangdong province, mangrove, china, kandelia candel, shenzhen futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 2
800amnondominant 7-18 days following heavy metal contamination (dominant lake, sediment, fresh water, heavy metal, reservoir, china, xiannv lake, sediment depth 0-10cm, spring)2021-06-15v4No1 / 3
571amnondominant mangrove swamp, soil, marine sediment, mangrove, china, hainan autonomous prefecture, rhizophora stylosa, danzhou xinyinggang nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 3
571amnondominant mangrove swamp, soil, marine sediment, guangdong province, mangrove, china, kandelia candel, leizhou nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 3
571amnondominant mangrove swamp, soil, marine sediment, spartina alterniflora, zhejiang province, china, ximendao national marine reserve, depth (soil) 0-20cm2019-12-16v4No1 / 3
223amnon high in other regions compared to sanmen bay in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 3
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, barkley canyon, depth (water) 500-1000m2019-01-16v4No1 / 4
486amnondominant ocean, sediment, pacific ocean, state of oregon, carbonate, lithified carbonate blocks, hydrate ridge, low activity methane seep, depth (water) 500-1000m2019-02-19v4No1 / 4
507amnondominant lake sediment, sediment, canada, province of british columbia, quesnel lake, sediment depth 8-10cm2019-03-17v4No1 / 4
571amnondominant mangrove swamp, soil, marine sediment, spartina alterniflora, guangdong province, china, leizhou nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 4
204amnondominant drinking water reservoir, sediment, water, china2017-10-02v4No1 / 4
571amnondominant mangrove swamp, soil, marine sediment, zhejiang province, mudflat, china, futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 4
571amnondominant mangrove swamp, soil, marine sediment, zhejiang province, mangrove, china, kandelia candel, futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 4
571amnondominant mangrove swamp, soil, marine sediment, mangrove, china, hainan autonomous prefecture, kandelia candel, dongzhaigang national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 4
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, hecceta sw, depth (water) 1000-2000m2019-01-16v4No1 / 5
141amnondominant sediment, brackish water, marine sediment, caspian sea, depth (water) 150-600m, sediment depth 0-12cm2017-04-18v4No1 / 5
236amnondominant ocean, sediment, marine sediment, zostera marina, state of california, bodega bay, marine eelgrass2017-11-07v4No1 / 5
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, clayoquot slope, depth (water) 1000-2000m2019-01-16v4No1 / 5
507amnondominant lake sediment, sediment, canada, province of british columbia, quesnel lake, sediment depth 0-5cm2019-03-17v4No1 / 5
571amnondominant mangrove swamp, soil, marine sediment, mudflat, china, hainan autonomous prefecture, dongzhaigang national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 5
235amnonhigh freq. in sediment near eelgrass in northern hemisphere (dominant ocean, sediment, marine sediment)2017-11-07v4No1 / 6
900amnondominant peatland, lake sediment, sweden, depth (water) 5m, depth (sediment) 0-20cm, stordalen mire2022-04-25v4No1 / 6
257amnonhigh freq. in tilapia pond sediment (dominant pond, fishpond, sediment, freshwater sediment metagenome, tilapia, china)2017-11-26v4No1 / 6
571amnondominant mangrove swamp, soil, marine sediment, zhejiang province, mangrove, china, kandelia candel, ximendao national marine reserve, depth (soil) 0-20cm2019-12-16v4No1 / 6
642amnondominant sediment, marine sediment, pacific ocean, san diego2020-08-28v4No1 / 6
478amnondominant farm, sediment, shrimp farm, china2019-02-19v4No1 / 7
545amnondominant ocean, sediment, marine sediment, atlantic ocean, depth (water) 1000m, sediment depth 0-5cm2019-08-04v4No1 / 7
93amnonhigh freq. in marine sediment near the shore in hawaii (dominant shore, marine sediment, hawaii)2017-03-12v4No1 / 7
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 2000-3000m, endeavour, depth (water) 2000-5000m2019-01-16v4No1 / 7
571amnondominant mangrove swamp, soil, marine sediment, spartina alterniflora, china, hainan autonomous prefecture, danzhou xinyinggang nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 7
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 150-500m, astorya canyon sw wall2019-01-16v4No1 / 8
376amnondominant united states of america, saline marsh, sediment, rhizosphere, spartina alterniflora, atlantic ocean2018-09-11v4No1 / 8
722amnondominant united states of america, estuary, sediment, marine sediment, state of new york, new york city, sediment surface, hunts point2021-01-02v4No1 / 8
722amnondominant united states of america, estuary, sediment, marine sediment, state of new york, new york city, sediment surface, soundview, oyster reef2021-01-02v4No1 / 8
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 2000-3000m, cascadia basin, depth (water) 2000-5000m2019-01-16v4No1 / 8
223amnondominant ocean, sediment, marine sediment, east china sea, china2017-10-26v4No1 / 8
486amnondominant ocean, sediment, oil seep, pacific ocean, state of oregon, carbonate, lithified carbonate blocks, hydrate ridge, active methane seep, depth (water) 500-1000m2019-02-19v4No1 / 9
900amnondominant peatland, lake sediment, sweden, depth (water) 1m, depth (sediment) 0-20cm, stordalen mire2022-04-25v4No1 / 9
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, coquille sw, depth (water) 500-1000m2019-01-16v4No1 / 10
142amnonhigh freq. in cruise 1 (western antarctica) (dominant continental shelf, sediment, marine sediment, antarctica, depth 400-800m)2017-04-19v4No1 / 10
142amnonhigh freq. in cruise 2 (western antarctica) (dominant continental shelf, sediment, marine sediment, antarctica, depth 400-800m)2017-04-19v4No1 / 10
418amnondominant ocean, coral reef, sediment2018-12-02v4No1 / 10
141amnondominant sediment, brackish water, marine sediment, caspian sea, depth (water) 200m, sediment depth 12-35cm2017-04-18v4No1 / 11
362amnondominant hydrothermal vent, volcanic crater, water, volcanic rock, marine sediment, sea water, marine hydrothermal vent, mediterranean sea, greece, inactive vent2018-08-29v4No1 / 12
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 150m, juan de fuca nehalem2019-01-16v4No1 / 12
139amnondominant marine sediment, polymetallic nodule, pacific ocean, depth (water) 4000m2017-04-18v4No1 / 12
504amnondominant sediment, marine sediment, nan'ao island, china2019-03-14v4No1 / 12
472amnondominant ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 150-500m, klamath knoll2019-01-16v4No1 / 13
138amnondominant marine sediment, pacific ocean, depth (water) 4000m2017-04-18v4No1 / 13
198amnon high in sediment compared to water in united states of america geothermal field yellowstone national park high temperature environment 2017-09-14v4No1 / 13
508amnondominant united states of america, lake sediment, sediment, state of minnesota, manganika lake, hypereutrophic lake, sulfidic bottom water2019-03-17v4No1 / 13
402amnondominant mine tailing, sediment, soil, guangxi zhuang autonomous region, alkaline mine tailing, zone 2,3, china2018-11-18v4No1 / 14
402amnondominant mine tailing, sediment, soil, guangxi zhuang autonomous region, alkaline mine tailing, zone 1, china2018-11-18v4No1 / 15
800amnondominant 100-250 days following heavy metal contamination (dominant lake, sediment, fresh water, summer, autumn, heavy metal, reservoir, china, xiannv lake, sediment depth 0-10cm)2021-06-15v4No1 / 16
362amnondominant hydrothermal vent, volcanic crater, water, volcanic rock, marine sediment, sea water, marine hydrothermal vent, mediterranean sea, greece, active vent2018-08-29v4No1 / 18
772amnondominant in sediment from southern colombian caribbean sea (dominant sediment, marine sediment, colombia, depth (water) 2000-3000m, caribbean sea, depth (water) 1000-2000m, depth (water) 2000-5000m)2021-04-22v3No1 / 18
223amnon high in other regions compared to hangzhou bay in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 21
224amnondominant united states of america, glacier, snow field, stratovolcano, sediment, state of oregon2017-10-26v4No1 / 21
198amnondominant united states of america, geothermal field, sediment, thermophilic sediment, yellowstone national park, high temperature environment2017-09-13v4No1 / 23
154amnonstrongly correlated with high uranium concentration ( high in uranium high urnaium compared to control in sediment soil australia kakadu national park )2017-06-29v4No1 / 28
362amnon high in active vent compared to inactive vent in hydrothermal vent volcanic crater water volcanic rock marine sediment sea water marine hydrothermal vent mediterranean sea greece 2018-08-29v4No1 / 37
141amnonpositively correlated with sample depth ( high in sediment depth 24-35cm compared to sediment depth 12-24cm in sediment brackish water marine sediment caspian sea depth (water) 200m sediment depth 12-35cm )2017-04-18v4No1 / 56
252amnonlower on sand biofilm compared to rock biofilm in river ( high in rock epilithic compared to sand epipsammic in river sediment biofilm kingdom of spain biofilm )2017-11-22v4No1 / 56
642amnon high in water saline water sea water compared to sediment marine sediment in pacific ocean san diego 2020-08-28v4No1 / 56
223amnon high in zhoushan island compared to other regions in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 67
402amnoncommon mine tailing, sediment, soil, guangxi zhuang autonomous region, alkaline mine tailing, zone 1, china2018-11-18v4No1 / 87
224amnoncommon united states of america, glacier, snow field, stratovolcano, sediment, state of oregon2017-10-26v4No1 / 87
223amnon high in hangzhou bay compared to other regions in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 90
508amnon high in lake water fresh water lake water compared to lake sediment sediment in united states of america state of minnesota manganika lake hypereutrophic lake sulfidic bottom water 2019-03-17v4No1 / 91
772amnoncommon in sediment from southern colombian caribbean sea (common sediment, marine sediment, colombia, depth (water) 2000-3000m, caribbean sea, depth (water) 1000-2000m, depth (water) 2000-5000m)2021-04-22v3No1 / 94
223amnon high in sanmen bay compared to other regions in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 110
198amnoncommon united states of america, geothermal field, sediment, thermophilic sediment, yellowstone national park, high temperature environment2017-09-13v4No1 / 113
362amnon high in inactive vent compared to active vent in hydrothermal vent volcanic crater water volcanic rock marine sediment sea water marine hydrothermal vent mediterranean sea greece 2018-08-29v4No1 / 129
362amnoncommon hydrothermal vent, volcanic crater, water, volcanic rock, marine sediment, sea water, marine hydrothermal vent, mediterranean sea, greece, active vent2018-08-29v4No1 / 150
900amnon high in depth (water) 1m compared to depth (water) 5m in peatland lake sediment sweden depth (sediment) 0-20cm stordalen mire 2022-04-25v4No1 / 152
402amnoncommon mine tailing, sediment, soil, guangxi zhuang autonomous region, alkaline mine tailing, zone 2,3, china2018-11-18v4No1 / 159
376amnoncommon united states of america, saline marsh, sediment, rhizosphere, spartina alterniflora, atlantic ocean2018-09-11v4No1 / 161
376amnonappear when transferred from high salinity to low salinity (other united states of america, saline marsh, sediment, rhizosphere, spartina alterniflora, atlantic ocean)2018-09-11v4No1 / 161
486amnoncommon ocean, sediment, oil seep, pacific ocean, state of oregon, carbonate, lithified carbonate blocks, hydrate ridge, active methane seep, depth (water) 500-1000m2019-02-19v4No1 / 163
141amnonnegatively correlated with sample depth ( high in sediment depth 12-24cm compared to sediment depth 24-35cm in sediment brackish water marine sediment caspian sea depth (water) 200m sediment depth 12-35cm )2017-04-18v4No1 / 187
402amnon high in zone 1 compared to zone 2,3 in mine tailing sediment soil guangxi zhuang autonomous region alkaline mine tailing china 2018-11-18v4No1 / 189
508amnon high in lake water fresh water lake water compared to lake sediment sediment in united states of america state of minnesota mcquade lake 2019-03-17v4No1 / 214
418amnoncommon ocean, coral reef, sediment2018-12-02v4No1 / 216
235amnoncommon in sediment near eelgrass in northern hemisphere (common ocean, sediment, marine sediment)2017-11-07v4No1 / 258
223amnon high in other regions compared to yushan islands in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 302
402amnon high in zone 2,3 compared to zone 1 in mine tailing sediment soil guangxi zhuang autonomous region alkaline mine tailing china 2018-11-18v4No1 / 322
486amnoncommon ocean, sediment, pacific ocean, state of oregon, carbonate, lithified carbonate blocks, hydrate ridge, low activity methane seep, depth (water) 500-1000m2019-02-19v4No1 / 371
252amnonhigh on sand biofilm compared to rock biofilm in river ( high in sand epipsammic compared to rock epilithic in river sediment biofilm kingdom of spain biofilm )2017-11-22v4No1 / 374
900amnon high in depth (water) 5m compared to depth (water) 1m in peatland lake sediment sweden depth (sediment) 0-20cm stordalen mire 2022-04-25v4No1 / 385
504amnon high in sediment marine sediment compared to water sea water in nan'ao island china 2019-03-14v4No1 / 395
722amnon high in surface water sea water compared to sediment marine sediment sediment surface in united states of america estuary state of new york new york city 2021-01-02v4No1 / 399
642amnoncommon sediment, marine sediment, pacific ocean, san diego2020-08-28v4No1 / 404
800amnoncommon 100-250 days following heavy metal contamination (common lake, sediment, fresh water, summer, autumn, heavy metal, reservoir, china, xiannv lake, sediment depth 0-10cm)2021-06-15v4No1 / 412
166amnonhigher in river sediment under mussles compared to control ( high in mussel unionidae compared to control in united states of america river sediment freshwater biome mississippi river depth 5cm upper mississippi river )2017-07-18v4No1 / 422
508amnon high in lake sediment sediment compared to lake water fresh water lake water in united states of america state of minnesota manganika lake hypereutrophic lake sulfidic bottom water 2019-03-17v4No1 / 422
545amnoncommon ocean, sediment, marine sediment, atlantic ocean, depth (water) 1000m, sediment depth 0-5cm2019-08-04v4No1 / 436
504amnoncommon sediment, marine sediment, nan'ao island, china2019-03-14v4No1 / 437
508amnon high in lake sediment sediment compared to lake water fresh water lake water in united states of america state of minnesota mcquade lake 2019-03-17v4No1 / 446
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
142amnoncommon in cruise 2 (western antarctica) (common continental shelf, sediment, marine sediment, antarctica, depth 400-800m)2017-04-19v4No1 / 468
722amnon high in soundview oyster reef compared to hunts point in united states of america estuary sediment marine sediment state of new york new york city sediment surface 2021-01-02v4No1 / 469
362amnoncommon hydrothermal vent, volcanic crater, water, volcanic rock, marine sediment, sea water, marine hydrothermal vent, mediterranean sea, greece, inactive vent2018-08-29v4No1 / 480
376amnondisappear when transferred from high salinity to low salinity (other united states of america, saline marsh, sediment, rhizosphere, spartina alterniflora, atlantic ocean)2018-09-11v4No1 / 494
139amnonpositively correlated with sediment depth (in ocean floor depth 4000m) ( high in sediment depth 8-10cm compared to sediment depth 0-5cm in marine sediment pacific ocean depth (water) 4000m )2017-04-18v4No1 / 522
376amnonlower in salt marsh with low salinity (11) compared to higher salinity (25-30) ( high in high salinity compared to low salinity in united states of america saline marsh sediment rhizosphere spartina alterniflora atlantic ocean )2018-09-11v4No1 / 533
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 150m, juan de fuca nehalem2019-01-16v4No1 / 535
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, coquille sw, depth (water) 500-1000m2019-01-16v4No1 / 554
139amnonnegatively correlated with sediment depth (in ocean floor depth 4000m) ( high in depth 0-5cm compared to depth 8-10cm in marine sediment pacific ocean depth (water) 4000m )2017-04-18v4No1 / 565
507amnoncommon lake sediment, sediment, canada, province of british columbia, quesnel lake, sediment depth 0-5cm2019-03-17v4No1 / 604
223amnon high in yushan islands compared to other regions in ocean sediment marine sediment east china sea china 2017-10-26v4No1 / 619
800amnonhigher at 100-250 days compared to 7-28 days following heavy metal contamination ( high in summer autumn compared to spring in lake sediment fresh water heavy metal reservoir china xiannv lake sediment depth 0-10cm )2021-06-15v4No1 / 644
486amnon high in oil seep active methane seep compared to low activity methane seep in ocean sediment pacific ocean state of oregon carbonate lithified carbonate blocks hydrate ridge depth (water) 500-1000m 2019-02-19v4No1 / 649
507amnoncommon lake sediment, sediment, canada, province of british columbia, quesnel lake, sediment depth 8-10cm2019-03-17v4No1 / 651
166amnonlower in river sediment under mussles compared to control ( high in control compared to mussel unionidae in united states of america river sediment freshwater biome mississippi river depth 5cm upper mississippi river )2017-07-18v4No1 / 671
236amnon high in root compared to sediment marine sediment in ocean zostera marina state of california bodega bay marine eelgrass 2017-11-07v4No1 / 674
508amnoncommon united states of america, lake sediment, sediment, state of minnesota, manganika lake, hypereutrophic lake, sulfidic bottom water2019-03-17v4No1 / 693
722amnon high in hunts point compared to soundview oyster reef in united states of america estuary sediment marine sediment state of new york new york city sediment surface 2021-01-02v4No1 / 696
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, clayoquot slope, depth (water) 1000-2000m2019-01-16v4No1 / 725
142amnoncommon in cruise 1 (western antarctica) (common continental shelf, sediment, marine sediment, antarctica, depth 400-800m)2017-04-19v4No1 / 756
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 150-500m, astorya canyon sw wall2019-01-16v4No1 / 758
507amnon high in sediment depth 8-10cm compared to sediment depth 0-5cm in lake sediment sediment canada province of british columbia quesnel lake 2019-03-17v4No1 / 765
900amnoncommon peatland, lake sediment, sweden, depth (water) 1m, depth (sediment) 0-20cm, stordalen mire2022-04-25v4No1 / 772
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 150-500m, klamath knoll2019-01-16v4No1 / 789
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 2000-3000m, cascadia basin, depth (water) 2000-5000m2019-01-16v4No1 / 878
900amnoncommon peatland, lake sediment, sweden, depth (water) 5m, depth (sediment) 0-20cm, stordalen mire2022-04-25v4No1 / 884
722amnoncommon united states of america, estuary, sediment, marine sediment, state of new york, new york city, sediment surface, soundview, oyster reef2021-01-02v4No1 / 922
901amnon high in depth (sediment) 0-20cm compared to sediment surface depth (sediment) 0cm in lake sediment china taihu national park depth (water) 20-100cm taihu lake 2022-04-25v4No1 / 939
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, barkley canyon, depth (water) 500-1000m2019-01-16v4No1 / 990
722amnoncommon united states of america, estuary, sediment, marine sediment, state of new york, new york city, sediment surface, hunts point2021-01-02v4No1 / 1001
376amnonhigher in salt marsh with low salinity (11) compared to higher salinity (25-30) ( high in low salinity compared to high salinity in united states of america saline marsh sediment rhizosphere spartina alterniflora atlantic ocean )2018-09-11v4No1 / 1038
154amnon high in uranium high uranium compared to control in sediment soil australia kakadu national park 2017-06-29v4No1 / 1080
478amnoncommon farm, sediment, shrimp farm, china2019-02-19v4No1 / 1085
93amnoncommon in marine sediment near the shore in hawaii (common shore, marine sediment, hawaii)2017-03-12v4No1 / 1151
507amnon high in sediment depth 0-5cm compared to sediment depth 8-10cm in lake sediment sediment canada province of british columbia quesnel lake 2019-03-17v4No1 / 1157
571amnoncommon mangrove swamp, soil, marine sediment, spartina alterniflora, china, hainan autonomous prefecture, danzhou xinyinggang nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1169
257amnoncommon in tilapia pond sediment (common pond, fishpond, sediment, freshwater sediment metagenome, tilapia, china)2017-11-26v4No1 / 1179
139amnoncommon marine sediment, polymetallic nodule, pacific ocean, depth (water) 4000m2017-04-18v4No1 / 1196
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, depth (water) 2000-3000m, endeavour, depth (water) 2000-5000m2019-01-16v4No1 / 1205
571amnoncommon mangrove swamp, soil, marine sediment, mangrove, china, hainan autonomous prefecture, rhizophora stylosa, danzhou xinyinggang nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1210
204amnoncommon drinking water reservoir, sediment, water, china2017-10-02v4No1 / 1220
901amnon high in bulk sediment compared to rhizosphere in lake sediment china taihu national park depth (water) 20-100cm depth (sediment) 0-20cm taihu lake 2022-04-25v4No1 / 1228
901amnoncommon lake sediment, china, taihu national park, depth (water) 20-100cm, depth (sediment) 0-20cm, taihu lake2022-04-25v4No1 / 1246
800amnoncommon 7-18 days following heavy metal contamination (common lake, sediment, fresh water, heavy metal, reservoir, china, xiannv lake, sediment depth 0-10cm, spring)2021-06-15v4No1 / 1248
472amnoncommon ocean, sediment, oil seep, marine sediment, north east pacific ocean, pacific ocean, hecceta sw, depth (water) 1000-2000m2019-01-16v4No1 / 1275
223amnoncommon ocean, sediment, marine sediment, east china sea, china2017-10-26v4No1 / 1311
571amnoncommon mangrove swamp, soil, marine sediment, mangrove, china, hainan autonomous prefecture, kandelia candel, dongzhaigang national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1351
901amnoncommon in macrophyte plant rhizosphere (common lake sediment, rhizosphere, china, taihu national park, depth (water) 20-100cm, depth (sediment) 0-20cm, taihu lake)2022-04-25v4No1 / 1378
571amnoncommon mangrove swamp, soil, marine sediment, mudflat, china, hainan autonomous prefecture, dongzhaigang national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1422
571amnoncommon mangrove swamp, soil, marine sediment, zhejiang province, mangrove, china, kandelia candel, futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1435
571amnoncommon mangrove swamp, soil, marine sediment, spartina alterniflora, guangdong province, china, leizhou nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1437
139amnon high in polymetallic nodule compared to marine sediment in pacific ocean depth (water) 4000m 2017-04-18v4No1 / 1483
571amnoncommon mangrove swamp, soil, marine sediment, guangdong province, mangrove, china, kandelia candel, leizhou nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1523
141amnoncommon sediment, brackish water, marine sediment, caspian sea, depth (water) 150-600m, sediment depth 0-12cm2017-04-18v4No1 / 1549
901amnoncommon lake sediment, sediment surface, china, taihu national park, depth (water) 20-100cm, taihu lake, depth (sediment) 0cm2022-04-25v4No1 / 1550
571amnoncommon mangrove swamp, soil, marine sediment, zhejiang province, mudflat, china, futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1587
571amnoncommon mangrove swamp, soil, marine sediment, guangdong province, mangrove, china, kandelia candel, shenzhen futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1593
571amnoncommon mangrove swamp, soil, marine sediment, zhejiang province, mangrove, china, kandelia candel, ximendao national marine reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1636
571amnoncommon mangrove swamp, soil, marine sediment, guangdong province, mudflat, china, shenzhen futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1649
141amnoncommon sediment, brackish water, marine sediment, caspian sea, depth (water) 200m, sediment depth 12-35cm2017-04-18v4No1 / 1659
154amnon high in control compared to uranium high uranium in sediment soil australia kakadu national park 2017-06-29v4No1 / 1663
571amnoncommon mangrove swamp, soil, marine sediment, spartina alterniflora, zhejiang province, china, ximendao national marine reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1668
507amnonhigher in mine tailing contaminated sediment compared to uncontaminated control ( high in contaminated sediment compared to control in lake sediment sediment canada province of british columbia quesnel lake )2019-03-17v4No1 / 1681
722amnon high in sediment marine sediment sediment surface compared to surface water sea water in united states of america estuary state of new york new york city 2021-01-02v4No1 / 1736
571amnoncommon mangrove swamp, soil, marine sediment, spartina alterniflora, zhejiang province, china, futian national nature reserve, depth (soil) 0-20cm2019-12-16v4No1 / 1747
138amnoncommon marine sediment, pacific ocean, depth (water) 4000m2017-04-18v4No1 / 1753
486amnon high in low activity methane seep compared to oil seep active methane seep in ocean sediment pacific ocean state of oregon carbonate lithified carbonate blocks hydrate ridge depth (water) 500-1000m 2019-02-19v4No1 / 1791
901amnon high in sediment surface depth (sediment) 0cm compared to depth (sediment) 0-20cm in lake sediment china taihu national park depth (water) 20-100cm taihu lake 2022-04-25v4No1 / 1819
507amnonlower in mine tailing contaminated sediment compared to uncontaminated control ( high in control compared to contaminated sediment in lake sediment sediment canada province of british columbia quesnel lake )2019-03-17v4No1 / 1825
901amnon high in rhizosphere compared to bulk sediment in lake sediment china taihu national park depth (water) 20-100cm depth (sediment) 0-20cm taihu lake 2022-04-25v4No1 / 1892
472amnon high in depth (water) 150-500m depth (water) 500-1000m compared to depth (water) 1000-2000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 1899
236amnoncommon ocean, sediment, marine sediment, zostera marina, state of california, bodega bay, marine eelgrass2017-11-07v4No1 / 1904
472amnon high in depth (water) 2000-3000m depth (water) 2000-5000m compared to depth (water) 1000-2000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 1923
800amnonlower at 100-250 days compared to 7-28 days following heavy metal contamination ( high in spring compared to summer autumn in lake sediment fresh water heavy metal reservoir china xiannv lake sediment depth 0-10cm )2021-06-15v4No1 / 1962
166amnoncommon in river sediment (5cm) with mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river, mussel, unionidae)2017-07-18v4No1 / 2254
472amnon high in depth (water) 1000-2000m compared to depth (water) 2000-3000m depth (water) 2000-5000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 2593
139amnon high in marine sediment compared to polymetallic nodule in pacific ocean depth (water) 4000m 2017-04-18v4No1 / 2686
236amnon high in sediment marine sediment compared to root in ocean zostera marina state of california bodega bay marine eelgrass 2017-11-07v4No1 / 2745
166amnoncommon in river sediment (5cm) without mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
472amnon high in depth (water) 1000-2000m compared to depth (water) 500-1000m in ocean sediment oil seep marine sediment north east pacific ocean pacific ocean 2019-01-16v4No1 / 3000
642amnon high in sediment marine sediment compared to water saline water sea water in pacific ocean san diego 2020-08-28v4No1 / 3217

Problems / suggestions? Please email info AT dbbact DOT org