Summary for ontology term: sewer

Number of annotations with term: 14

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.142857
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.142857
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTCCCAAGTCCCTCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGAAGGAAACTGGGAAGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.142857
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.142857
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGAGCGTAGGCGGTCGATTAAGTTAGATGTGAAACCCCCGGGCTTAACTTGGGGACTGCATCTAATACTGGTTGACTTAGAGTACAGGAGAGGGAAGCGGAATTCCTA0.142857
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTATTAAGTCTGGTGTAAAAGGCAGTGGCTCAACCATTGTATGCATTGGAAACTGGTAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGT0.142857
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTAATAAGTCTGATGTAAAAGGCAGTGGCTCAACCATTGTGTGCATTGGAAACTGTTAGACTTGAGTGCAGTAGAGGAGAGTGGAATTCCATGT0.142857
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__KocuriaTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGCCCGGGGCTTAACCCCGGGTGTGCAGTGGGTACGGGCAGACTTGAGTGCAGTAGGGGAGACTGGAATTCCTGG0.142857
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Leuconostocaceae;g__LeuconostocTACGTATGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGACGGTTTATTAAGTCTGATGTGAAAGCCCGGAGCTCAACTCCGGAATGGCATTGGAAACTGGTTAACTTGAGTGCAGTAGAGGTAAGTGGAACTCCATG0.142857
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGTCAGGCTAGAGTGTCGGAGAGGAAAGCGGAATTCCTAG0.142857

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTCAAGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTTTGACTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAATCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVbTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGCATGGTAAGTAAGATGTGAAAGCCCGAGGCTTAACCTCGAGGATTGCATTTTAAACTATCAAGCTAGAGTACAGGAGAGGAAAGCGGAATTCCTA0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGTGCGCAAGTCAGATGTGAAATCTCAGGGCTCAACCCTGAAACTGCATTTGAAACTGTGCATCTTGAGTGCCGGAGAGGTAATCGGAATTCCTTG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGATGCAAGTCTGAAGTGAAATACCCGGGCTCAACCTGGGAACTGCTTTGGAAACTGTGTTGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCAGTCTTGAGTGCAGTAGAGGTGGGCGGAATTCGTGG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTCAAACTAGAGTACAGGAGAGGAAAGCGGAATTCCTAG0.250000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTACGTATGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCTGGCAGGCCGGGAGTCAAATCCGGGGGCTCAACCCCCGCCCGCTCCCGGAACCTCCAGGCTTGAGTCTGGCAGGGGAGGGTGGAATACCCGGT0.250000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfobacterales;f__Desulfobulbaceae;g__DesulfobulbusTACGGAGGGTGCAAGCGTTGTTCGGAATCACTGGGCGTAAAGGGCGCGCAGGCGGCCTGATCAGTCAGATGTGAAAGCCCACGGCTTAACTGTGGAAGTGCATTTGAAACTGTCAGGCTTGAGTACCAGAGGGGAAAGTGGAATTCCCGG0.400000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCTGCTGTGAAATCCTGGGGCTTAACTCTGGGCGTGCAGTGGGTACGGGCAGGCTAGAGTGCGGTAGGGGTGATTGGAATTCCTGG0.380952
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGATTAATAAGTCAGTTGTAAAATGCACGGGCTCAACTCGTGTTTGTCGACTGATACTGTTAGTCTAGAGTATGTGAGAGGGAAGTGGAATTCCCGG0.380952
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGATTAAAAAGTCAGCCGTAAAATGCACGGGCTCAACCTGTGTTAGTCAGCTGATACTATTAGTCTAGAGTATGTGAGAGGGAAGTGGAATTCCCGG0.380952
d__BacteriaTACGTAGGATCCAAGCGTTGTCCGGATTTACTGGGTATAAAGGGTGCGTAGGCGGCTTTTTGCGTCAGAGGTGAAATCCACGGGCTTAACCCGTGGGGTGCCTTTGAAACGGGAAGGCTTGAGTATGACAGAGGCGGATGGAATTCCTGG0.380952
d__Bacteria;p__"Proteobacteria";c__BetaproteobacteriaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGATATGTAAGTTAGGAGTGAAATCCCCGGGCTCAACCTGGGAATGGCTTTTAAGACTGCGTATCTAGAGTTTGTCAGAGGGGGGTGGAATTCCAAG0.363636
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Xanthomonadales;f__Xanthomonadaceae;g__DokdonellaTACGAAGGGTGCAAGCGTTACTCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGTTTGTTAAGTCTGCTGTGAAAGCCCTGGGCTCAACCTGGGAACTGCAGTGGATACTGGCGAGCTAGAGTGTGTCAGAGGATGGTGGAATTCCCGG0.363636
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGAGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGCTTGTAGGTGGCTTGTCGCGTCTGCCGTGAAATTCCGCAGCTTAACTGTGGTAGTGCGGTGGGTACGGGCAGGCTTGAGTGTGGTAGGGGAGACTGGAATTCCTGG0.347826
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__ActinomycetaceaeTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCTGCTGTGAAAACGCGGGGCTTAACTCCGCGCGTGCAGTGGGTACGGGCAGGCTAGAGTGTGGTAGGGGTGACTGGAATTCCTGG0.347826
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCTGCCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTACAGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.347826

Annotations:

common ontology terms
term enrichment score
TermScore
wastewater treatment plant0.620690
effluent0.600000
influent0.465116
biomat0.363636
microbial biomat0.363636
water treatment pond0.363636
benthic biomat0.363636
engineered wetland0.363636
spring0.250000
low income0.222222
late time points0.133333
early time points0.133333
LOWER IN sewage0.125000
sewage0.125000
LOWER IN influent0.117647
LOWER IN effluent0.111111
river0.105263
sewer0.105263
LOWER IN wastewater treatment plant0.105263
LOWER IN sewer0.105263
autumn0.100000
city0.085106
state of california0.067797
fresh water0.055556
south america0.043956
water0.032258
united states of america0.015894
china0.011396
homo sapiens0.007018
LOWER IN feces0.006098
feces0.006098
Fraction of dbbact annotations with this term covered by the query
TermScore
spring1.000000
effluent0.750000
influent0.666667
wastewater treatment plant0.600000
low income0.500000
biomat0.500000
microbial biomat0.500000
water treatment pond0.500000
benthic biomat0.500000
engineered wetland0.500000
LOWER IN sewage0.500000
sewage0.500000
LOWER IN influent0.333333
LOWER IN effluent0.250000
sewer0.200000
LOWER IN wastewater treatment plant0.200000
LOWER IN sewer0.200000
late time points0.125000
early time points0.125000
river0.083333
autumn0.076923
city0.050000
state of california0.038462
fresh water0.034483
south america0.023810
water0.018182
united states of america0.008097
china0.005814
homo sapiens0.003690
LOWER IN feces0.003185
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
wastewater treatment plant0.642857
effluent0.500000
united states of america0.428571
influent0.357143
china0.285714
city0.285714
south america0.285714
state of california0.285714
biomat0.285714
microbial biomat0.285714
water treatment pond0.285714
benthic biomat0.285714
engineered wetland0.285714
spring0.142857
river0.142857
water0.142857
fresh water0.142857
low income0.142857
late time points0.142857
early time points0.142857
autumn0.142857
sewer0.071429
LOWER IN feces0.071429
feces0.071429
homo sapiens0.071429
LOWER IN wastewater treatment plant0.071429
LOWER IN sewer0.071429
LOWER IN sewage0.071429
LOWER IN influent0.071429
sewage0.071429
LOWER IN effluent0.071429
Exp. ID User ID Description Date Region Flag Sequences
665amnondominant united states of america, state of california, influent, late time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 6
665amnondominant united states of america, state of california, influent, early time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 7
160amnonhigh freq. in wastewater treatment plant effluent in spring in china (dominant wastewater treatment plant, effluent, china, spring)2017-07-12v4No1 / 15
200amnonhighfreq. in river downstream of wastewater treatment plant (dominant united states of america, river, water, fresh water, wastewater treatment plant, effluent)2017-10-01v4No1 / 15
160amnonhigh freq. in wastewater treatment plant effluent in autumn in china (dominant wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 20
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in wastewater treatment plant sewer compared to feces in city south america low income )2017-01-21v4No1 / 148
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to wastewater treatment plant sewer in city south america low income )2017-01-21v4No1 / 187
665amnoncommon united states of america, state of california, influent, early time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 301
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
665amnoncommon united states of america, state of california, influent, late time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 526
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, china, spring)2017-07-12v4No1 / 573
200amnoncommon in river downstream of wastewater treatment plant (common united states of america, river, water, fresh water, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
53amnonhigher in wastewater plant effluent compared to influent and sewer in south america ( high in effluent compared to sewage influent in city wastewater treatment plant south america )2017-01-21v4No1 / 657

Problems / suggestions? Please email info AT dbbact DOT org