Summary for ontology term: shandong province

Number of annotations with term: 26

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGAGGCTTAAGCGTGACGTGAAATGTAGCCGCTCAACGGCTGAGTTGCGTCGCGAACTGGGTTTCTTGAGTGAGTGCGACGTCAGCGGAATTCGTGG0.333333
d__BacteriaTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCGCGAAGGCTGCGATTCAAGTCAACTGTCAAATTCCGGGGCTTAACCCCGGCCTGCAGTTGAAACTGAATTGCTCGAGGCGCAGAGAGGCAGACAGAATTCCTGGT0.315789
d__BacteriaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGAGGGTCAAGTCAGCCGTAAAATCGTCCTGCTCAACAGGATCCCGCGGTTGAAACTGGTCCCCTTGGGTGCACAAGAGGCACGCGGAACTCGTGGT0.315789
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGACAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCAAAGCAAGTCAGAAGTGAAAGCCCGCGGCTCAACTGCGGGACTGCTTTTGAAACTGTTTAGCTAGAGTACTGGAGGGGCAAGCGGAATTCCTGG0.307692
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCTGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGAAGCTTAAGCGTGCTGTGAAATGTACCGGCTCAACCGGTGACGTGCAGCGTGAACTGGGTTTCTTGAGTGTGCTGAAGGAAGGCGGAATTCGTGG0.303030
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGAACGGCAAGTCAGATGTGAAAGCCCGGGGCTCAACCCCGTGACTGCATTTGAAACTGTCGATCTAGAGTGCAGGAGAGGAAAGCGGAATTCCTAG0.303030
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGATCAGCAAGTCAGATGTGAAATCCATGGGCTTAACTCATGAACTGCATTTGAAACTGTTGGTCTTGAGTGCTGGAGAGGTAGACGGAATTCCTAG0.285714
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGAAGATTAAGCGTGACGTGAAATGTCCCGGCTCAACCGTGGAACTGCGTCGCGAACTGGTTTTCTTGAGTGAGTACGACGTCAGCGGAATTTGTGG0.285714
d__Bacteria;p__"Bacteroidetes"TACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGCTTTTAAGTCTGCGGTAAAATGGCCGTGCTCAACGCGGTCCTGCCGTGGAAACTGGGAGTCTTGAATGTGCACAAGGAAGGTGGAATTCGTGGT0.285714
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCTGATTATTAAGCGTGACGTGAAATGTAGCCGCTCAACGGCTGAACTGCGTCGCGAACTGGTAGTCTTGAGTGAGTTCGATGTTGGCGGAATTCGTGG0.285714

Annotations:

common ontology terms
Exp. ID User ID Description Date Region Flag Sequences
883amnondominant oilfield, yellow river delta, china, shengli oilfield, oil contaminated soil, soil2022-03-20v4No1 / 6
687amnondominant shandong province, bos taurus, chinese bohai black beef cattle, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 8
687amnondominant chinese luxi yellow beef cattle, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 9
775amnon high in control compared to lichen planus in jinan city prefecture adult saliva china homo sapiens 2021-04-24v4No1 / 9
687amnon high in chinese bohai black beef cattle compared to chinese luxi yellow beef cattle in bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 10
751sheryoDominant in tomato soil infected with Fusarium oxysporum (dominant china, shandong province, luojiazhuang, fusarium oxysporum, solanum lycopersicum, soil)2021-03-11v3No1 / 13
687amnondominant holstein dairy cow, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 14
687amnondominant chinese laoshan milk goat, capra hircus, goat, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 15
775amnondominant jinan city prefecture, adult, saliva, china, homo sapiens2021-04-24v4No1 / 17
687amnon high in chinese luxi yellow beef cattle compared to chinese bohai black beef cattle in bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 34
687amnon high in high milk yield compared to low milk yield in holstein dairy cow bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 40
883amnon high in depth (soil) 0-20cm compared to depth (soil) 60-100cm in oilfield yellow river delta china shengli oilfield oil contaminated soil soil 2022-03-20v4No1 / 50
775amnon high in lichen planus compared to control in jinan city prefecture adult saliva china homo sapiens 2021-04-24v4No1 / 56
775amnoncommon jinan city prefecture, adult, saliva, china, homo sapiens2021-04-24v4No1 / 133
883amnoncommon oil contaminated soil, oilfield, yellow river delta, china, shengli oilfield, soil2022-03-20v4No1 / 187
751sheryoCommon in tomato soil infected with Fusarium oxysporum (common china, shandong province, luojiazhuang, fusarium oxysporum, solanum lycopersicum, soil)2021-03-11v3No1 / 305
687amnon high in chinese laoshan milk goat goat capra hircus compared to chinese bohai black beef cattle chinese luxi yellow beef cattle bos taurus in shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 318
687amnon high in low milk yield compared to high milk yield in holstein dairy cow bos taurus shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 375
883amnon high in oilfield oil contaminated soil compared to non-contaminated soil in yellow river delta shengli oilfield china soil 2022-03-20v4No1 / 404
687amnoncommon chinese laoshan milk goat, capra hircus, goat, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 429
687amnoncommon holstein dairy cow, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 593
883amnon high in depth (soil) 60-100cm compared to depth (soil) 0-20cm in oilfield yellow river delta china shengli oilfield oil contaminated soil soil 2022-03-20v4No1 / 627
687amnon high in chinese bohai black beef cattle chinese luxi yellow beef cattle bos taurus compared to chinese laoshan milk goat goat capra hircus in shandong province research facility china rumen liquid rumen 2028-03-09v4No1 / 1022
687amnoncommon chinese luxi yellow beef cattle, bos taurus, shandong province, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 1039
687amnoncommon shandong province, bos taurus, chinese bohai black beef cattle, research facility, china, rumen liquid, rumen2028-03-09v4No1 / 1147
883amnon high in non-contaminated soil compared to oil contaminated soil oilfield in yellow river delta china shengli oilfield soil 2022-03-20v4No1 / 1381

Problems / suggestions? Please email info AT dbbact DOT org