Summary for ontology term: sigmoid colon

Number of annotations with term: 10

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__ParvimonasTGGGGAATATTGCACAATGGGGGGAACCCTGATGCAGCGACGCCGCGTGAGCGAAGAAGGTTTTCGAATCGTAAAGCTCTGTCCTATGAGAAGATAATGACGGTATCATAGGAGGAAGCCCCGGCTAAATACGTGCCAGCAGCCGCGGTA0.100000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTGGGGAATATTGCGCAATGGGGGCAACCCTGACGCAGCCATGCCGCGTGAATGAAGAAGGCCTTCGGGTTGTAAAGTTCTTTCGGTATTGAGGAAGGTTGTTGTGTTAATAGCACGACAAATTGACGTTAAATACAGAAGAAGCACCGGC0.100000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGATTTCGGTTCGTAAAGCTCTGTTGTTAGGGAAGAATGATTGTGTAGTAACTATACACAGTAGAGACGGTACCTAACCAGAAAGCCACGGC0.100000
d__Bacteria;p__Candidatus Saccharibacteria;g__Saccharibacteria_genera_incertae_sedisTGAGGAATCTTCCACAATGGGCGAAAGCCTGATGGAGCAACGCCGCGTGCAGGATGAAGGCCTTCGGGTTGTAAACTGCTTTTATAAGTGAGGATTATGACAGTAACTTATGAATAAGGATCGGCTAACTACGTGCCAGCAGCCGCGGTC0.100000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__EzakiellaTGGGGAATATTGCACAATGGAGGGAACTCTGATGCAGCGACGCCGCGTGAGTGATGAAGGAATTCGTTTCGTAAAACTCTGTTCTATGGGAAGAAAAGGACTGTACCATAGGAGAAAGCTCCGGCTAAATACGTGCCAGCAGCCGCGGTA0.100000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTCGCTCATGGTCAAGCCGCAACGTTTGGTTGTGGTGAGGGTAGTGGGTAAAGAAGCGCCGGCTAACTAC0.100000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTGTTAGCAGGGAAGAAGAGAGATTGACGGTACCTGCAGAGAAAGCGCCGGCTAACTACGTGCCAGCAGCCG0.100000
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTAGGGAATATTGCTCAATGGGGGAAACCCTGAAGCAGCAACGCCGCGTGGAGGATGACACTTTTCGGAGCGTAAACTCCTTTTGTTAGGGAAGAACAATGACGGTACCTAACGAATAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGT0.100000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptoniphilaceae;g__PeptoniphilusTGGGGAATATTGCACAATGGAGGGAACTCTGATGCAGCGACGCCGCGTGAACGAAGAAGGCTTTCGAGTCGTAAAGTTCTTTTATATGGGAAGATAATGACGGTACCATAAGAAAAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.100000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAACGAAGAAGGTCTTCGGATTGTAAAGTTCTGTGATTCGGGACGAAAGGGTTTGTGGTGAATAATCATAGACATTGACGGTACCGAAAAAGCAAGCCACGG0.100000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTGGGGAATATTGGGCAATGGGGGCAACCCTGACCCAGCAACGCCGCGTGAAGGAAGAAGGCTTTCGGGTTGTAAACTTCTTTGACAAGGGACGAAATAAATGACGGTACCTTGAAAACAAGCCACGGCTAACTACGTGCCAGCAGCCGCG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTGGGGGATATTGCACAATGGAGGAAACTCTGATGCAGCAACGCCGCGTGAGGGAAGAAGGTTTTCGGATTGTAAACCTCTGTCCTTAGGGACGATAATGACGGTACCTAAGGAGGAAGCTCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGGGGATATTGCACAATGGGGGAAACCCTGATGCAGCAATGCCGCGTGAGGGAAGAAGGTCTTCGGATTGTAAACCTAAGTAGCCAGGGACGATAATGACGGTACCTGGAGAGTAAGCTCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGCGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGAAAAAAATGACGGTACCTGACTAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__ParaprevotellaTGAGGAATATTGGTCAATGGGCGGGAGCCTGAACCAGCCAAGTAGCGTGAAGGACGACGGCCCTACGGGTTGTAAACTTCTTTTATAAGGGAATAAAGTTCGCCACGTGTGGTGTTTTGTATGTACCTTATGAATAAGCATCGGCTAATT0.500000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__CoprobacillusTAGGGAATTTTCGGCAATGGGGGAAACCCTGACCGAGCAACGCCGCGTGAGGGAAGAAGTATTTCGGTATGTAAACCTCTGTTATAAAGGAAGAACGGTATGAATAGGAAATGATTCATAAGTGACGGTACTTTATGAGAAAGCCACGGC0.500000
d__BacteriaTGGGGGATATTGGTCAATGGGGGAAACCCTGAACCAGCAACGCCGCGTGAGGGAAGACGGCCTTCGGGTTGTAAACCTAAGTGATCAGGGACGAAGGAAGTGACGGTACCTGAAAAGCAAGCTCCGGCTAACTACGTGCCAGCAGCCGCG0.500000
d__BacteriaTGGGGAATATTGGGCAATGGGGGCAACCCTGACCCAGCAACGCCGCGTGAGGGAAGAAGGTTTTCGGATTGTAAACCTCTGTCCTTGGGGACGAAGAAGTGACGGTACCCAAGGAGGAAGCTCCGGCTAACTACGTGCCAGCAGCCGCGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGGGGATATTGGTCAATGGGGGAAACCCTGAACCAGCAATGCCGCGTGAGGGAAGAAGGTCTTCGGATTGTAAACCTAAGTAGTCAGGGACGAAAGAAATGACGGTACCTGAAGAGTAAGCTCCGGCTAACTACGTGCCAGCAGCCGCG0.500000
d__BacteriaTGAGGGATATTGGGCAATGGGGGAAACCCTGACCCAGCGACGCCGCGTGAGGGAAGACGGTCTTCGGATTGTAAACCTCTGTCTTTGGGGACGAAAAAGGACGGTACCCAAGGAGGAAGCTCCGGCTAACTACGTGCCAGCAGCCGCGGT0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__AlteromonadalesTGGGGAATATTGCACAATGGGGGAAACCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGCGAGGAGGAAAGGGTGTAAGTTAATACCTTACATCTGTGACGTTACTCGCAGAAGAAGCACCGGC0.200000
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGTGAGGAAGAAGGCCTGCGGGTTAATAGCCGGCAGGAAGGACATCACTCACAGAAGAAGCACCGGC0.181818
d__BacteriaCACGATTAACCCAAGTCAATAGAAGCCGGCGTACAGAGTGTTTTAGATCACCCCCTCCCCAATAAAGCTAAAACTCACCTGAGTTGTAAAAAACTCCAGTTGACACAAAATAGACTACGAAAGTGGCTTTAACATATCTGAACACACAAT0.166667
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__Neisseriaceae;g__EikenellaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGCGCAGACGGTTATTTAAGCAGGATGTGAAATCCCCGGGCTTAACCTGGGAGCTGCGTTCTGAACTGGATAGCTAGAGTGTGTCAGAGGGGGGTAGAATTCCACG0.166667
GTTTTAATTTTTGTAGAGAAGGAGTCTTGCTATGTTGCCCAGGCTGGTCTCACACTCCTGGGCTCAAGCAATCTGCCTGCCTTGGCCTCATAAAGTGCTAGGATTACAGGCGTAAGCCACCATGCCAAGCCACCTTCTTTTGATTTTTAC0.166667
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGGGGGGG0.166667
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTTCTTAAGTCCATCTTAAAAGCGTGGGGCTCAACCCCATGAGGGGATGGAAACTGGGAAGCTGGAGTATCGGAGAGGAAAGGGGAATTCCTAGT0.166667
d__BacteriaGTTTTAATTTTTGTAGAGAAGGAGTCTTGCTCTGTTGCCCAGGCTGGTCTCAAACTCCTGGGCTCAAGCAATCTGCCTGCCTTGGCCTCATAAAGTGCTAGGATTACAGGCGTAAGCCACCATGCCAAGCCACCTTCTTTTGATTTTTAC0.166667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGG0.166667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAG0.166667

Annotations:

common ontology terms
term enrichment score
TermScore
sigmoid colon0.818182
terminal ileum0.545455
children0.444444
sigmoid colon brushing0.375000
milan0.363636
colon0.363636
biopsy0.352941
colonic mucosa0.315789
crohn's disease0.181818
LOWER IN crohn's disease0.181818
LOWER IN sigmoid colon brushing0.166667
LOWER IN colonic mucosa0.153846
rectum0.148148
LOWER IN sigmoid colon0.142857
italy0.088889
germany0.058824
caecum0.051948
homo sapiens0.021898
adult0.011396
LOWER IN control0.010256
control0.010256
united states of america0.008016
feces0.006173
LOWER IN feces0.006173
Fraction of dbbact annotations with this term covered by the query
TermScore
crohn's disease1.000000
LOWER IN crohn's disease1.000000
sigmoid colon0.750000
terminal ileum0.500000
LOWER IN sigmoid colon brushing0.500000
sigmoid colon brushing0.500000
children0.500000
LOWER IN colonic mucosa0.333333
milan0.333333
colonic mucosa0.333333
colon0.333333
biopsy0.250000
LOWER IN sigmoid colon0.250000
rectum0.090909
italy0.050000
germany0.034483
caecum0.027778
homo sapiens0.011070
adult0.005780
LOWER IN control0.005405
control0.005405
united states of america0.004049
feces0.003185
LOWER IN feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens1.000000
sigmoid colon0.900000
terminal ileum0.600000
biopsy0.600000
adult0.400000
italy0.400000
milan0.400000
united states of america0.400000
rectum0.400000
caecum0.400000
colon0.400000
children0.400000
colonic mucosa0.300000
sigmoid colon brushing0.300000
germany0.200000
feces0.100000
LOWER IN colonic mucosa0.100000
LOWER IN sigmoid colon0.100000
LOWER IN sigmoid colon brushing0.100000
LOWER IN feces0.100000
crohn's disease0.100000
LOWER IN control0.100000
control0.100000
LOWER IN crohn's disease0.100000
Exp. ID User ID Description Date Region Flag Sequences
19amnonhigh freq in biopsies of children (IBD study) (dominant homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 16
851amnondominant homo sapiens, colonic mucosa, sigmoid colon, adult, italy, milan, sigmoid colon brushing2021-12-16v3No1 / 22
714amnondominant homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 25
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 34
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
851amnoncommon homo sapiens, colonic mucosa, sigmoid colon, adult, italy, milan, sigmoid colon brushing2021-12-16v3No1 / 71
851amnon high in feces compared to colonic mucosa sigmoid colon sigmoid colon brushing in homo sapiens adult italy milan 2021-12-16v3No1 / 132
851amnon high in colonic mucosa sigmoid colon sigmoid colon brushing compared to feces in homo sapiens adult italy milan 2021-12-16v3No1 / 174
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459

Problems / suggestions? Please email info AT dbbact DOT org