Summary for ontology term: sixth decade human stage

Number of annotations with term: 6

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTTCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTTTGGTAAGCGTGTTGTGAAATGTCGGGGCTCAACCTGGGCATTGCAGCGCGAACTGTCAGACTTGAGTGCGCAGGAAGTAGGCGGAATTCGTCG0.400000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGACTGTTAAGTCAGTGGTCAAAACGGGAGGCTCAACCTTCTGTCGCCATTGAAACTGGCAGACTTGAGTGAGCGAGAAGTATGCGGAATGCGTGGT0.400000
d__Bacteria;p__"Proteobacteria"TACGAAGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGAGTGTAGGCGGTTTAGTAAGATAGTGGTGAAATCCCAGAGCTTAACTTTGGAATTGCCATTATAACTATTAGACTAGAATTATAGAGAGGATAGTGGAATACCCAG0.400000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__BurkholderialesTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTAAGTAAGACAGATGTGAAATCCCTGAGCTTAACTTAGGAATTGCATTTGTGACTGCTTGACTGGAGTGTGTCAGAGGGAGGTGGAATTCCAAG0.400000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegamonasTACGTAGGCGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGCGGGAAACTAAGCAGATCTTAAAAGTGCGGGGCTCAACCCCGTGATGGGGTCCGAACTGGTTTTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCCAGT0.400000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ButyricimonasTACGGGGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGCGCGTAGGCGGGACGCCAAGTCAGCGGTAAAAGACTGCAGCTAAACTGTAGCACGCCGTTGAAACTGGCGCCCTAGAGAGAAGTCGAGGGAGGCGGAACAAGTGAA0.363636
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGCGATTAAGTCAGCGGTAAAATAGTGTGGCTCAACCATACTGTGCCGTTGATACTGGTTGCCTTGAGTGCACACAAGGAAGATGGAATTCGTGGT0.363636
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGACCATCAAGTCAGCGGTCAAAAGTCGGGGCTCAACCCCGTGAAGCCGTTGAAACTGGTGGTCTTGAGTGAGCGAGAAGCAGGCGGAATGCGTGGT0.363636
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Sutterellaceae;g__SutterellaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTCTGTAAGATAGATGTGAAATCCCCGGGCTTAACCTTGGAATTGCATTTATGACTGCAGGACTCGAGTTTGTCAGAGGGGGGTGGAATTCCAAG0.363636
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVbTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGCATGGTAAGCCAGATGTGAAAGCCCGGAGCTTAACTCCGAGGATTGCATTTGGAACTATCAAGCTAGAGTACAGGAGAGGAAAGCGGAATTCCTA0.363636

Annotations:

common ontology terms
term enrichment score
TermScore
sixth decade human stage0.666667
nanning city prefecture0.666667
nephrolithiasis0.500000
LOWER IN nephrolithiasis0.250000
china0.010753
adult0.010695
control0.010417
LOWER IN control0.010204
homo sapiens0.006897
feces0.005780
Fraction of dbbact annotations with this term covered by the query
TermScore
sixth decade human stage0.500000
nanning city prefecture0.500000
LOWER IN nephrolithiasis0.500000
nephrolithiasis0.500000
china0.005405
adult0.005376
control0.005263
LOWER IN control0.005263
homo sapiens0.003460
feces0.002899
Fraction of annotations for the query sequences containing the term
TermScore
sixth decade human stage1.000000
homo sapiens1.000000
feces1.000000
adult1.000000
nanning city prefecture1.000000
china1.000000
control0.500000
nephrolithiasis0.500000
LOWER IN nephrolithiasis0.166667
LOWER IN control0.166667
Number of experiments associating the term to the sequence
TermScore
sixth decade human stage1.000000
homo sapiens1.000000
feces1.000000
adult1.000000
nanning city prefecture1.000000
control1.000000
LOWER IN nephrolithiasis1.000000
china1.000000
LOWER IN control1.000000
nephrolithiasis1.000000

Problems / suggestions? Please email info AT dbbact DOT org