Summary for ontology term: sixth decade human stage

Number of annotations with term: 6

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTTCAGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTTTGGTAAGCGTGTTGTGAAATGTCGGGGCTCAACCTGGGCATTGCAGCGCGAACTGTCAGACTTGAGTGCGCAGGAAGTAGGCGGAATTCGTCG0.400000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGACTGTTAAGTCAGTGGTCAAAACGGGAGGCTCAACCTTCTGTCGCCATTGAAACTGGCAGACTTGAGTGAGCGAGAAGTATGCGGAATGCGTGGT0.400000
d__Bacteria;p__"Proteobacteria"TACGAAGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGAGTGTAGGCGGTTTAGTAAGATAGTGGTGAAATCCCAGAGCTTAACTTTGGAATTGCCATTATAACTATTAGACTAGAATTATAGAGAGGATAGTGGAATACCCAG0.400000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__BurkholderialesTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTAAGTAAGACAGATGTGAAATCCCTGAGCTTAACTTAGGAATTGCATTTGTGACTGCTTGACTGGAGTGTGTCAGAGGGAGGTGGAATTCCAAG0.400000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegamonasTACGTAGGCGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGCGGGAAACTAAGCAGATCTTAAAAGTGCGGGGCTCAACCCCGTGATGGGGTCCGAACTGGTTTTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCCAGT0.400000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Rikenellaceae";g__AlistipesTACGGAGGATTCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATGTTAGGGCTCAACCCTGAAACTGCCTCTAATACTGTTGGACTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG0.375000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ButyricimonasTACGGGGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGCGCGTAGGCGGGACGCCAAGTCAGCGGTAAAAGACTGCAGCTAAACTGTAGCACGCCGTTGAAACTGGCGCCCTAGAGAGAAGTCGAGGGAGGCGGAACAAGTGAA0.363636
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGCGATTAAGTCAGCGGTAAAATAGTGTGGCTCAACCATACTGTGCCGTTGATACTGGTTGCCTTGAGTGCACACAAGGAAGATGGAATTCGTGGT0.363636
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGACCATCAAGTCAGCGGTCAAAAGTCGGGGCTCAACCCCGTGAAGCCGTTGAAACTGGTGGTCTTGAGTGAGCGAGAAGCAGGCGGAATGCGTGGT0.363636
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Sutterellaceae;g__SutterellaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTCTGTAAGATAGATGTGAAATCCCCGGGCTTAACCTTGGAATTGCATTTATGACTGCAGGACTCGAGTTTGTCAGAGGGGGGTGGAATTCCAAG0.363636

Annotations:

common ontology terms
term enrichment score
TermScore
nanning city prefecture0.666667
sixth decade human stage0.666667
nephrolithiasis0.500000
LOWER IN nephrolithiasis0.250000
china0.011561
adult0.011494
control0.010695
LOWER IN control0.010471
homo sapiens0.007353
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN nephrolithiasis0.500000
nanning city prefecture0.500000
sixth decade human stage0.500000
nephrolithiasis0.500000
china0.005814
adult0.005780
control0.005405
LOWER IN control0.005405
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
adult1.000000
nanning city prefecture1.000000
china1.000000
sixth decade human stage1.000000
control0.500000
nephrolithiasis0.500000
LOWER IN nephrolithiasis0.166667
LOWER IN control0.166667

Problems / suggestions? Please email info AT dbbact DOT org