Summary for ontology term: snow

Number of annotations with term: 10

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__RhodospirillalesTACGAAGGGGGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGCGAACCAAGTCAGATGTGAAAGTCCTGGGCTTAACCTGGGGACTGCATTTGATACTGGTTTGCTTGAATTCGGGAGAGGATAGCGGAATTCCCAG0.100000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Burkholderiaceae;g__BurkholderiaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTGTTAAGACAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATTTGTGACTGGCAAGCTAGAGTATGGCAGAGGGGGGTAGAATTCCACG0.100000
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__Cytophagales;f__Cytophagaceae;g__CytophagaTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTTGATAAGTCAGTGGTGAAAGCCGATCGCTTAACGATCGAACTGCCATTGATACTGCCAGGCTTGAGTATAGTTGAGGTAGGCGGAATTGACAG0.100000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Rhizobiaceae;g__RhizobiumTACGAAGGGGGCTAGCGTTGTTCGGATTTACTGGGCGTAAAGCGCACGTAGGCGGATCGATCAGTCAGGGGTGAAATCCCAGAGCTCAACTCTGGAACTGCCTTTGATACTGTCGATCTGGAGTATGGAAGAGGTGAGTGGAATTCCGAG0.100000
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__MyxococcalesGACAGAGGGTGCAAACGTTGTTCGGAATTACTGGGCGTAAAGCGTGTGTAGGCGGCCATGCAAGTCGGATGTGAAAGCCCTGGGCTCAACCCAGGAAGTGCACTCGAAACTGCGTGGCTTGAGTACTGGAGAGGTTGGTGGAATTCTCGG0.100000
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGTGTAGGCGGCTCGGTAAGTCCGCTCTGAAAGCCCGAGGCTCAACCTCGGGAGGCGGGTGGATACTGTCGAGCTCGAGTCCGGAAGAGGAGTGTGGAATTCCTGG0.100000
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGAAGTTACTGGGCGTAAAGAGCGCGTAGGCGGACCCTTAAGTGAGGGGTGAAAGGTTCGGGCTCAACCCGGAGAGTGCCTTTCATACTGGGGGTCTTGAGTGCGGGAGAGGCAAGTGGAATGGTCGG0.100000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Oxalobacteraceae;g__JanthinobacteriumTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGTCTGATGTGAAATCCCCGGGCTCAACCTGGGAATTGCATTGGAGACTGCAAGGCTAGAATCTGGCAGAGGGGGGTAGAATTCCACG0.100000
d__Bacteria;p__"Planctomycetes";c__Planctomycetia;o__Planctomycetales;f__PlanctomycetaceaeTACGAACTGTGCAAACGTTATTCGGAATCACTGGGCTTACAGGGTGCGTAGGCGGCTTGTTAAGTAGGGTGTGAAAGCCCCCGGCTCAACCGGGGAATGGCGCCCTAAACTGGCGAGCTAGAGTGAGATAGGGGTGTGTGGAACTTCCGG0.100000
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__CytophagalesTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTCAATTAAGTCAGTGGTGAAATACGGCAGCTCAACTGTCGAGGTGCCATTGATACTGGTTGACTTGAGTACTGATGAGGTAGGCGGAATGGACGG0.100000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptococcaceae 1;g__DesulfosporosinusTACGTAGGGGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGTAGGCGGATAGTTAAGTCCGGTGTGAAAGATCAGGGCTCAACCCTGAGAGTGCATCGGAAACTGGTTATCTTGAGGACAGGAGAGGAAAGTGGAATTCCACG0.500000
d__BacteriaGACAGAGGGGGCAAGCGTTGCTCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGGATGGCAAGTCGGTCGTGAAATCCCTCGGCTCAACCGAGGAGCGTCGGCCGATACTGCCGTTCTTGAGGGATGCAGAGGAGACTGGAATTCCCGG0.500000
d__BacteriaTACGGGGGGTGCGAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCGCGTAGGTGGTTTGATAAGGGTGTGGTGAAAGTCCGGGGCTCAACCCCGGATCTGCCGTGCCGACTGTCAAACTCGAGGGCTGTAGAGGCAGGCGGAATTCCGGG0.500000
d__Bacteria;p__"Proteobacteria";c__DeltaproteobacteriaGACAGAGGGTGCGAACGTTGCTCGGAATTACTGGGCGTAAAGCGTGTGTAGGCGGCCACGCAAGTCGGATGTGAAAGCCCTGGGCTCAACCCAGGAAGTGCACCCGATACTGCGACGGCTTGAGTACCGGAGAGGTTGGTGGAATTCTCG0.500000
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp2;g__Gp2GACGTAGGGGGCCAGCGTTGTTCGGAATTACTGGGTGTAAAGGGTTCGTAGGCGGTGCGGCAAGTTGGGAGTGAAATCTCTGGGCTTAACCCAGAGGCTGCTTCCAAAACTGCTGTGCTTGAGTGTGGGAGAGGCGCGTGGAATTGCAGG0.500000
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp3;g__Gp3TACGTAGGCAGCAAGCGTTGTTCGGAGTTACTGGGCGTAAAGAGTGTGTAGGCGGTTCTCTAAGTTCCGTGTGAAATCTCCCGGCTCAACTGGGAGGGTGCGCGGAAAACTGGAGGGCTTGAGTATGGGAGAGGAAAGCGGAATTCCTGG0.500000
d__BacteriaTACGTAGGTGGCAAGCGTTACTCGGAATCACTAGGCGTAAAGCGCAGGTAGGAGGTTTAGTAAGTCTGTTGTGAAAGCTCCCGGCTTAACTGGGAGAGGTCAACGGAAACTGCTAGGCTAGAGTGCGGTAGAGGAAGATGGAATTCCCGG0.500000
d__Bacteria;p__"Proteobacteria"GACAGAGGGTGCAAACGTTGTTCGGAATTACTGGGCGTAAAGCGTGTGTAGGCTGCTACGCAAGTCGGATGTGAAATCCCCGGGCTCAACCCGGGAAGTGCACCCGAAACTGCGTGGCTTGAGTACCGGAGAGGTTGGTGGAATTCTCGG0.500000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Pseudomonadaceae;g__PseudomonasTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTCGTTAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGGCGAGCTAGAGTATGGTAGAGGGTGGTGGAATTTCCTG0.500000
d__BacteriaGACAGAGGTGGCAAGCGTTGTTCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTTAGGTAAGACCTGCGGGAAATCCCTGGGCTTAACCCAGGAAGGTCGCAGGTGACTGCCTAGCTAGAGGGCGGGAGAGGAGCGCGGAATTCCCGG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTCATTAAGTCAGTGGTGAAAGGTACCCGCTTAACGGGGACACTGCCATTGATACTGATGAGCTGGAGTACAGATGAAGTGGGCGGAATGTGTCA0.631579
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__Cytophagales;f__Cytophagaceae;g__HymenobacterTACGGAGGGTGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTTTTTAAGTCTGGGGTGAAAGCCCGTTGCTCAACAACGGAACTGCCCTGGAAACTGGAGAGCTTGAGTACAGACGAGGGTGGCGGAATGGACGG0.588235
d__BacteriaGACGGAGAGCGCGGGCGTTATTCGTTTTGATTGGGTGTAAAGGGTACGTAGGTAGTTTTTGATAATTTTTAACTAAAAACGCAGAGTGTTCCTATGCGCTAGTTTTTTTAAAGATCAAACTAGTACTGATTAGAGGTTGGGGCAATTTCC0.533333
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__ChitinophagaceaeTACGGAGGGTGCAAGCGTTATCCGGATTTACTGGGTTTAAAGGGTGCGTAGGTGGGCAGGTAAGTCAGTGGTGAAATCTTCAAGCTTAACTTGGAAACTGCCATTGATACTATTTGTCTTGAATATCCCGGAGGTAAGCGGAATATGTCA0.500000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__OxalobacteraceaeTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTTTAAGACAGGTGTGAAATCCCCGGGCTTAACCTGGGAATGGCATTTGTGACTGGAAGGCTAGAGTGTGTCAGAGGGGGGTAGAATTCCACG0.500000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTCTATAAGTCAGTGGTGAAAGGTACCCGCTTAACGGGGACACTGCCATTGATACTGTGGAGCTGGAGTACAGATGAAGTGGGCGGAATGTGTCA0.470588
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__ChitinophagaceaeTACGGAGGGTGCAAGCGTTATCCGGATTTACTGGGTTTAAAGGGTGCGTAGGTGGGCAGGAAAGTCAGTGGTGAAATCTTCAAGCTTAACTTGGAAACTGCCATTGATACTATTTGTCTTGAATATCCCGGAGGTAAGCGGAATATGTCA0.470588
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__AcetobacteraceaeTACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGCTTACTAAGTTAGGTGTGAAATTCCTGGGCTTAACCTGGGGACTGCCCTTAATACAGGTAGGCTAGAGTGAGGAAGAGGGTTGTGGAATTCCCAG0.470588
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__ChitinophagaceaeTACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGAGCGTAGGCGGGCATGTAAGTCAGTGGTGAAATCTTGGGGCTCAACCCCGAAACTGCCATTGATACTATGTGCCTTGGATCCTGTTGAGGTTTGCGGAATATGTCA0.470588
d__BacteriaCACGGAGAGCACGGGCGTTATTCGTTTTGATTGGGTGTAAAGGGTACGTAGGCTGCTGTTGTTAATTTTTAACCGAAATCGCGGAGTGTTCCTATGCGCTGGTTTTTTAGAAGATATAGCTGGTGTTAAAGATAGGTTGGGGCAATTTCC0.428571

Annotations:

common ontology terms
term enrichment score
TermScore
snow0.818182
depth 0-5cm0.428571
lapland0.375000
ph 5.40.285714
stratovolcano0.285714
hokkaido0.250000
snow field0.222222
glacier0.200000
finland0.193548
state of oregon0.181818
kingdom of norway0.176471
snow covered soil0.166667
LOWER IN non snow covered soil0.166667
LOWER IN lapland0.166667
non snow covered soil0.166667
LOWER IN snow covered soil0.166667
state of colorado0.162162
LOWER IN snow0.142857
topsoil0.142857
forest ecosystem0.142857
LOWER IN finland0.117647
LOWER IN kingdom of norway0.111111
depth (soil) 0-10cm0.111111
sweden0.109091
LOWER IN state of colorado0.105263
japan0.095238
LOWER IN sweden0.080000
winter0.074074
LOWER IN winter0.074074
LOWER IN summer0.060606
summer0.060606
soil0.019231
united states of america0.015936
LOWER IN united states of america0.007782
Fraction of dbbact annotations with this term covered by the query
TermScore
snow0.750000
snow covered soil0.500000
LOWER IN non snow covered soil0.500000
ph 5.40.500000
stratovolcano0.500000
lapland0.500000
LOWER IN lapland0.500000
non snow covered soil0.500000
LOWER IN snow covered soil0.500000
hokkaido0.333333
depth 0-5cm0.333333
snow field0.250000
LOWER IN snow0.250000
glacier0.200000
state of oregon0.166667
finland0.142857
LOWER IN finland0.142857
kingdom of norway0.125000
LOWER IN kingdom of norway0.125000
topsoil0.111111
forest ecosystem0.111111
state of colorado0.111111
LOWER IN state of colorado0.111111
depth (soil) 0-10cm0.076923
sweden0.066667
LOWER IN sweden0.066667
japan0.062500
winter0.058824
LOWER IN winter0.058824
LOWER IN summer0.043478
summer0.043478
soil0.010101
united states of america0.008097
LOWER IN united states of america0.004049
Fraction of annotations for the query sequences containing the term
TermScore
snow0.900000
depth 0-5cm0.600000
united states of america0.500000
state of colorado0.300000
kingdom of norway0.300000
sweden0.300000
finland0.300000
lapland0.300000
soil0.200000
topsoil0.200000
hokkaido0.200000
depth (soil) 0-10cm0.200000
ph 5.40.200000
forest ecosystem0.200000
japan0.200000
glacier0.200000
snow field0.200000
stratovolcano0.200000
state of oregon0.200000
winter0.100000
snow covered soil0.100000
LOWER IN summer0.100000
LOWER IN non snow covered soil0.100000
LOWER IN united states of america0.100000
LOWER IN state of colorado0.100000
LOWER IN kingdom of norway0.100000
LOWER IN sweden0.100000
LOWER IN finland0.100000
LOWER IN lapland0.100000
summer0.100000
non snow covered soil0.100000
LOWER IN winter0.100000
LOWER IN snow0.100000
LOWER IN snow covered soil0.100000

Problems / suggestions? Please email info AT dbbact DOT org