Summary for ontology term: snow field

Number of annotations with term: 12

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
TTCCAGCTCCAATAGCGTATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCGGGTGGGTTGCAATGGTCCGGTTCGCTGTGTACTGTTGCGGCCTTCCTTTCTGCCGGGGACGGGCTCTTGGGCTTCATTGTCTGGGATCC0.526316
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCATGGTAAGTCAGAAGTGAAAACCCGGGGCTCAACCCCGTGGATTGCTTTTGAAACTATCAAGCTAGAGTGCAGGAGAGGTAAGTGGAATTCCTA0.421053
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__ChitinophagaceaeTACGGAGGGTGCAAGCGTTATCCGGATTTACTGGGTTTAAAGGGTGCGTAGGTGGGTAGGAAAGTCAGTGGTGAAATCTTCAAGCTTAACTTGGAAACTGCCATTGATACTTTTTATCTTGAATATCCCGGAGGTAAGCGGAATATGTCA0.400000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__AcetobacteraceaeTACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGCTTACTAAGTTAGGTGTGAAATTCCTGGGCTTAACCTGGGGACTGCCCTTAATACAGGTAGGCTAGAGTGAGGAAGAGGGTTGTGGAATTCCCAG0.400000
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__Cytophagales;f__Cytophagaceae;g__HymenobacterTACGGAGGGTGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTTTTTAAGTCCGGGGTGAAAGCCCGTTGCTCAACAACGGAACTGCCCCGGAAACTGGAGAGCTTGAGTACAGACGAGGGCGGCGGAATGGACGG0.400000
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__ChloroplastGACGGGGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGTTTATTAAGTCTAGTGTTAAAGATCAGGGCTTAACCCTGAGTCGGCAGTAGAAACTGATGAGCTTGAGTACGGTAGGGGCAGAGGGAATTCCCGG0.400000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTCATTAAGTCAGTGGTGAAAGGTACCCGCTTAACGGGGACACTGCCATTGATACTGATGAGCTGGAGTACAGATGAAGTGGGCGGAATGTGTCA0.363636
TTCCAGCTCCAATAGCGTATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCGGGTGGGTTGCAATGGTCCGGTTCGCTGTGTACTGTTGCGGCCTTCCTTTCTGCCGGGGACGGGCTCTTGGGCTTCACTGTCTGGGATCC0.352941
d__BacteriaTTCCAGCTCCAATAGCGTATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCGGGTGGGTTGTAGTGGTCCGGTTCGCTGTGTACTGCTACGGCCTTCCTTTCTGCCGGGGACGGGCTCTTGGGCTTCATTGTCTGGGATCC0.352941
d__BacteriaTTCCAGCTCCAATAGCGTATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCGGGTGGGTGACCGCGGTCCGCCTCTGGTGTGCACTGCGGGCGCCTATCTTTCTGCCGGGGACGGGCTCCTGGGCTTCACTGTCTGGGACT0.352941

Annotations:

common ontology terms
term enrichment score
TermScore
snow field0.857143
mountain0.400000
stratovolcano0.400000
depth 6-7m0.333333
depth 1-2m0.285714
glacier0.250000
snow algae0.250000
depth 1-5 cm0.250000
state of oregon0.222222
antarctic peninsula0.222222
snow0.200000
antarctica0.181818
LOWER IN depth 6-7m0.142857
LOWER IN depth 1-2m0.133333
japan0.111111
sediment0.052632
united states of america0.008000
Fraction of dbbact annotations with this term covered by the query
TermScore
snow field0.750000
depth 6-7m0.500000
LOWER IN depth 6-7m0.500000
stratovolcano0.500000
snow algae0.500000
depth 1-5 cm0.500000
mountain0.333333
depth 1-2m0.333333
LOWER IN depth 1-2m0.333333
antarctic peninsula0.333333
snow0.250000
glacier0.200000
antarctica0.200000
state of oregon0.166667
japan0.062500
sediment0.031250
united states of america0.004049
Fraction of annotations for the query sequences containing the term
TermScore
snow field1.000000
mountain0.500000
japan0.500000
united states of america0.333333
glacier0.333333
stratovolcano0.333333
state of oregon0.333333
depth 6-7m0.250000
depth 1-2m0.250000
snow0.166667
sediment0.166667
antarctica0.166667
antarctic peninsula0.166667
snow algae0.166667
depth 1-5 cm0.166667
LOWER IN depth 1-2m0.083333
LOWER IN depth 6-7m0.083333

Problems / suggestions? Please email info AT dbbact DOT org