Summary for ontology term: soil

Number of annotations with term: 1007

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp6;g__Gp6TACAGAGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGCCTTCTAAGTCGAACGTGAAATCCCCGGGCTCAACCCGGGAACTGCGTCCGATACTGGAAGGCTTGAATCCGGGAGAGGGATGCGGAATTCCAGG0.010945
d__BacteriaGACAGAGGGGGCAAGCGTTGCTCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGGATGGCAAGTCAGTCGTGAAATCTCTCGGCTCAACCGAGAAACGTCGGCTGATACTGCCGTTCTTGAGGGATGCAGAGGAGACTGGAATTCCCGG0.010945
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__MyxococcalesTACGAAGGGTGCAAACGTTGCTCGGAATTATTGGGCGTAAAGCGCACGTAGGCGGCTTTGCAAGTCGGATGTGAAATCCCTCGGCTTAACCAAGGAAGTGCATCCGAAACTGCAGAGCTTGAGTACTTAAGAGGATCGCGGAATTCCCGG0.009950
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp6;g__Gp6TACGGGGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCTCGTAGGCGGCCAACTAAGTCAGACGTGAAATCCCTCGGCTTAACCGGGGAACTGCGTCTGATACTGGATGGCTTGAGTTTGGGAGAGGGATGCGGAATTCCAGG0.009950
d__BacteriaTACGGAGGGTGCGAGCGTTGTCCGGAATCATTGGGCGTAAAGGGCGCGTAGGTGGCCCGGTCAGTTCGTGGTGAAAGCGCGGGGCTCAACCCTGCGTCGGCCATGAATACTGCCGCGGCTGGAGCACTGTAGAGGCAGGCGGAATTCCGG0.009950
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Solirubrobacterales;f__Solirubrobacteraceae;g__SolirubrobacterTACGTAGGGGGCTAGCGTTGTCCGGAATCATTGGGCGTAAAGCGCGTGTAGGCGGTCCGGTAAGTCCGCTGTGAAAGTCGGGGGCTCAACCCTCGGATGCCGGTGGATACTGTCGGGCTTGAGTACGGAAGAGGCGAGTGGAATTCCTGG0.009950
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCGTGTAGGCGGCCATACAGGTCAGCTGTGAAAACTCGAGGCTCAACCTCGAGACGTCGGTTGAAACCGTATGGCTAGAGTCCGGAAGAGGAGAGTGGAATTCCCGG0.009950
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__MyxococcalesGACAGAGGGTGCAAACGTTGTTCGGAATTACTGGGCGTAAAGCGCGTGTAGGCGGCTATGCAAGTCGGATGTGAAAGCCCTCGGCTCAACCGGGGAAGTGCACCCGAAACTGCAAAGCTAGAGTCTCGGAGAGGATCGTGGAATTCTCGG0.009950
d__Bacteria;p__"Actinobacteria";c__ActinobacteriaTACGTAGGGGGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGGCAAGTCGGGTGTGAAAACTCCGGGCTCAACTCGGAGACGCCACTCGATACTGCCATGACTCGAGTCCGGTAGGGGAGTGCGGAATTCCTG0.009950
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp6;g__Gp6TACGGGGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCTCGTAGGCGGCCAACTAAGTCGGACGTGAAATCCCTCGGCTTAACCGGGGAACTGCGTCCGATACTGGATGGCTTGAGTTCGGGAGAGGGATGCGGAATTCCAGG0.009950

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Methylobacteriaceae;g__MethylobacteriumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGCGTTTTAAGTCGGGGGTGAAAGCCTGTGGCTCAACCACAGAATGGCCTTCGATACTGGGACGCTTGAGTATGGTAGAGGTTGGTGGAACTGCGAG0.285714
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Caulobacterales;f__Caulobacteraceae;g__PhenylobacteriumTACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGACAGTTTAGTCAGAGGTGAAAGCCCAGGGCTCAACCTTGGAATTGCCTTTGATACTGGCTGTCTTGAGTTCGGGAGAGGTGAGTGGAATGCCGAG0.285714
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.257143
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__Sphingomonadaceae;g__NovosphingobiumTACGGAGGGAGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTACTCAAGTCAGAGGTGAAAGCCCGGGGCTCAACCCCGGAACTGCCTTTGAAACTAGGTGACTAGAATCTTGGAGAGGTCAGTGGAATTCCGAG0.257143
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Hyphomicrobiaceae;g__DevosiaTACGAAGGGGGCTAGCGTTGTTCGGATTTACTGGGCGTAAAGCGCACGTAGGCGGATCGTTAAGTCGGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTCGATACTGGCGATCTTGAGTCCGGAAGAGGTGAGTGGAACTCCTAG0.257143
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__Sphingomonadaceae;g__SphingopyxisTACGGAGGGAGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCAGAGGTGAAAGCCCAGTGCTCAACACTGGAACTGCCTTTGAAACTGGAAAACTTGAATCTTGGAGAGGTCAGTGGAATTCCGAG0.257143
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Rhizobiaceae;g__NeorhizobiumTACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATATTTAAGTCAGGGGTGAAATCCCAGAGCTCAACTCTGGAACTGCCTTTGATACTGGGTATCTTGAGTATGGAAGAGGTAAGTGGAATTGCGAG0.257143
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillaceae 1TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGAAAAGCGGAATTCCACG0.257143
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__Cytophagales;f__Cytophagaceae;g__DyadobacterTACGGAGGGTGCGAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGCTGTTTAAGTCAGTGGTGAAATACGGTTGCTCAACAATCGAGGTGCCATTGATACTGAATAGCTTGAAATAATTGGAGGCTGCCGGAATGGATGG0.257143
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Rhizobiaceae;g__RhizobiumTACGAAGGGGGCTAGCGTTGTTCGGATTTACTGGGCGTAAAGCGCACGTAGGCGGATCGATCAGTCAGGGGTGAAATCCCAGAGCTCAACTCTGGAACTGCCTTTGATACTGTCGATCTGGAGTATGGAAGAGGTGAGTGGAATTCCGAG0.257143

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__ArthrobacterTACGTAGGGCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCCGTGAAAGTCCGGGGCTCAACTCCGGATCTGCGGTGGGTACGGGCAGACTAGAGTGATGTAGGGGAGACTGGAATTCCTGG0.352250
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Bradyrhizobiaceae;g__BradyrhizobiumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGTCTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGAAGATCTTGAGTTCGGGAGAGGTGAGTGGAACTGCGAG0.320910
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp4;g__Gp4TACGGGGGGAGCAAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGCCACCGCAAGTCGACTGTGAAATCTCCGGGCTTAACCCGGAAAGGTCAGCCGATACTGCGGGGCTAGAGTGCAGAAGGGGCAACTGGAATTCTCG0.317933
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__RhizobialesTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGCTTTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGAGAAGCTTGAGTCCGGGAGAGGTGAGTGGAACTGCGAG0.312789
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp16;g__Gp16TACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCGCGCAGGCGGTCGTTCAAGTCGCGTGTGAAAGCCCCCGGCTCAACTGGGGAGGGTCACGCGATACTGATCGACTCGAAGGCAGGAGAGGGTAGTGGAATTCCCGG0.311573
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Hyphomicrobiaceae;g__DevosiaTACGAAGGGGGCTAGCGTTGTTCGGATTTACTGGGCGTAAAGCGCACGTAGGCGGATCGTTAAGTCGGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTCGATACTGGCGATCTTGAGTCCGGAAGAGGTGAGTGGAACTCCTAG0.308989
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Caulobacterales;f__Caulobacteraceae;g__PhenylobacteriumTACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGACAGTTTAGTCAGAGGTGAAAGCCCAGGGCTCAACCTTGGAATTGCCTTTGATACTGGCTGTCTTGAGTTCGGGAGAGGTGAGTGGAATGCCGAG0.303951
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Solirubrobacterales;f__Solirubrobacteraceae;g__SolirubrobacterTACGTAGGGGGCTAGCGTTGTCCGGAATCATTGGGCGTAAAGCGCGTGTAGGCGGTCCGGTAAGTCCGCTGTGAAAGTCGGGGGCTCAACCCTCGGATGCCGGTGGATACTGTCGGGCTTGAGTACGGAAGAGGCGAGTGGAATTCCTGG0.301476
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Mycobacteriaceae;g__MycobacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTTGTTCGTGAAAACTCACAGCTTAACTGTGGGCGTGCGGGCGATACGGGCAGACTGGAGTACTGCAGGGGAGACTGGAATTCCTGG0.300844
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__GeodermatophilaceaeTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTTGCGTCGGCTGTGAAATCCCGAGGCTCAACCTCGGGTCTGCAGTCGATACGAGCAAACTAGAGTGTTGCAGGGGAGACTGGAATTCCTGG0.298762

Annotations:

common ontology terms
term enrichment score
TermScore
soil0.967744
china0.334832
rhizosphere0.248433
agricultural field0.196532
depth (soil) 0-20cm0.165803
triticum aestivum0.157795
depth (soil) 0-10cm0.129290
zea mays0.128109
silt loam0.116386
cultivated environment0.111569
united states of america0.099770
ph 7-80.091507
topsoil0.088971
loess plateau0.088971
grand river watershed0.088688
rare charitable research reserve0.088688
shaanxi province0.083712
fertilized soil0.080076
cambridge0.078275
province of ontario0.075327
canada0.074673
bulk soil0.074109
kellogg biological station0.073597
mesic type hapludalf0.073597
kalamazoo loam0.073597
glycine max0.068092
farm0.065658
oryza sativa0.064968
germany0.064753
forest ecosystem0.063658
state of california0.061693
desert0.061510
robinia pseudoacacia0.061510
reforestation0.061510
luvisol0.061510
ph 60.061221
forested area0.060358
wheat0.060358
zhejiang province0.058024
pot expreiment0.057998
state of michigan0.056859
woodland area0.056764
united states0.056232
nicollet soil series0.056232
des moines0.056232
biochar0.055762
iowa0.054695
mangrove swamp0.052681
alabama0.052681
ultisol0.052681
haplic luvisol0.051551
auburn0.051329
jiangsu province0.049326
agricultural feature0.049224
yunwushan national natural grassland protection zone0.049103
ningxia province0.049103
calci-orthic aridisol0.049103
haplic calcisol0.049103
grazing exclusion0.049103
lettuce0.047304
mangrove0.046198
ph 6.90.046021
luancheng county0.046021
salic solonetz0.045498
da'an station0.045498
songnen plain0.045498
ph 7.60.042308
flood plain0.041865
sacramento0.041865
cosumnes river preserve0.041865
orchard0.041865
restored prairie0.041865
dekalb county0.041865
illinois0.041865
hunan province0.040240
dipsacus fullonum0.040038
solidago0.040038
apocynum0.040038
decomissioned agricultural field0.040038
meadow ecosystem0.040038
daucus carota0.039252
peat soil0.038697
clay loam0.038573
israel0.038312
quercus velutina0.038204
quercus alba0.038204
quercus rubra0.038204
acer saccharum0.038204
acer saccharum subsp. nigrum0.038204
fagus grandifolia0.038204
forest0.038204
mexico0.038130
ph 70.037843
state of illinois0.037194
ph 6-70.036934
permafrost0.036810
paddy field soil0.036697
ph 4-50.036574
thyrow0.036364
marine sediment0.035887
Fraction of dbbact annotations with this term covered by the query
TermScore
kandelia candel1.000000
futian national nature reserve1.000000
mudflat1.000000
depth (soil) 10-25cm1.000000
fertilized soil1.000000
ph 6-6.51.000000
qiao nature reserve1.000000
sonneratia apetala1.000000
LOWER IN qiao nature reserve1.000000
volcan sumaco1.000000
cinnamomum camphora1.000000
anxi county1.000000
low nutrient availability1.000000
LOWER IN high nutrient availability1.000000
LOWER IN downhill1.000000
uphill1.000000
LOWER IN low nutrient availability1.000000
LOWER IN uphill1.000000
high nutrient availability1.000000
downhill1.000000
jinxiang county1.000000
LOWER IN low npk fertilizer dose1.000000
high npk fertilizer dose1.000000
LOWER IN high npk fertilizer dose1.000000
low npk fertilizer dose1.000000
soil0.990099
depth (soil) 0-10cm0.923077
triticum aestivum0.909091
biochar0.875000
cultivated environment0.875000
bulk soil0.857143
oryza sativa0.857143
ph 60.833333
silt loam0.833333
manured soil0.833333
greenhouse soil0.750000
permafrost0.750000
mangrove0.750000
ph<50.750000
LOWER IN ph&gt;50.750000
LOWER IN ph&lt;50.750000
peat soil0.750000
maize field0.750000
rice0.750000
non-manured soil0.750000
npk fertilizer0.750000
ph 40.750000
irrigated0.750000
conventional tillage0.750000
LOWER IN conventional tillage0.750000
glycine max0.714286
zea mays0.700000
rhizosphere0.680851
ph 7.850.666667
depth (soil) 25-50cm0.666667
topsoil0.666667
depth (soil) 30-60cm0.666667
silty clay loam0.666667
ph 6.90.666667
haplic luvisol0.666667
LOWER IN plant litter0.666667
plant litter0.666667
depth 20cm0.666667
ph 90.666667
depth (soil) 10 cm0.666667
ph 7.50.666667
depth (soil) 0-15cm0.666667
depth (soil) 15-30cm0.666667
ph 7.70.666667
ph 6.70.666667
ph 7.90.666667
LOWER IN without biochar0.666667
without biochar0.666667
ph 5.90.666667
ph 4-60.666667
LOWER IN depth (soil) 10-25cm0.666667
LOWER IN depth (soil) 25-50cm0.666667
depth 20-40cm0.666667
depth 10-20cm0.666667
LOWER IN depth 20-40cm0.666667
clay loam0.666667
mollisol0.666667
sandy loam0.666667
sandy loam soil0.666667
oil contaminated soil0.666667
LOWER IN unamended soil0.666667
unamended soil0.666667
loess plateau0.666667
fen0.666667
LOWER IN drought environment0.666667
drought environment0.666667
ph>70.666667
ph>60.666667
LOWER IN ph&lt;60.666667
ph<60.666667
LOWER IN ph&gt;60.666667
ph 80.666667
luancheng county0.666667
ph 7.60.666667
semi-arid0.666667
Fraction of annotations for the query sequences containing the term
TermScore
soil0.946375
china0.439921
united states of america0.176763
rhizosphere0.151936
agricultural field0.118173
depth (soil) 0-20cm0.105263
triticum aestivum0.086395
zea mays0.070506
depth (soil) 0-10cm0.069513
silt loam0.062562
cultivated environment0.059583
canada0.059583
ph 7-80.050645
grand river watershed0.048659
province of ontario0.048659
cambridge0.048659
rare charitable research reserve0.048659
topsoil0.047666
loess plateau0.047666
shaanxi province0.045680
germany0.043694
state of california0.042701
fertilized soil0.041708
farm0.039722
state of michigan0.039722
kellogg biological station0.039722
mesic type hapludalf0.039722
kalamazoo loam0.039722
bulk soil0.038729
glycine max0.035750
forest ecosystem0.033764
oryza sativa0.033764
desert0.032771
robinia pseudoacacia0.032771
reforestation0.032771
luvisol0.032771
ph 60.031778
zhejiang province0.031778
forested area0.031778
wheat0.031778
woodland area0.030785
pot expreiment0.030785
united states0.029791
nicollet soil series0.029791
des moines0.029791
iowa0.029791
biochar0.028798
mangrove swamp0.027805
auburn0.027805
alabama0.027805
ultisol0.027805
agricultural feature0.027805
haplic luvisol0.026812
jiangsu province0.026812
marine sediment0.025819
yunwushan national natural grassland protection zone0.025819
ningxia province0.025819
calci-orthic aridisol0.025819
haplic calcisol0.025819
grazing exclusion0.025819
lettuce0.024826
ph 6.90.023833
salic solonetz0.023833
da'an station0.023833
songnen plain0.023833
mangrove0.023833
luancheng county0.023833
flood plain0.021847
sacramento0.021847
cosumnes river preserve0.021847
orchard0.021847
restored prairie0.021847
dekalb county0.021847
illinois0.021847
state of illinois0.021847
ph 7.60.021847
mexico0.020854
israel0.020854
dipsacus fullonum0.020854
solidago0.020854
apocynum0.020854
daucus carota0.020854
decomissioned agricultural field0.020854
meadow ecosystem0.020854
hunan province0.020854
LOWER IN soil0.019861
ph 6-70.019861
clay loam0.019861
peat soil0.019861
ph 70.019861
quercus velutina0.019861
quercus alba0.019861
quercus rubra0.019861
acer saccharum0.019861
acer saccharum subsp. nigrum0.019861
fagus grandifolia0.019861
forest0.019861
ph 4-50.019861
research facility0.019861
permafrost0.018868
Exp. ID User ID Description Date Region Flag Sequences
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mudflat, guangdong province, shenzhen futian national nature reserve2019-12-16v4No1 / 1
813amnondominant forested area, temperate rainforest, united states of america, state of washington, olympic national park, soil2021-06-22v4No1 / 1
357amnonhigh freq. in temperate deciduous forests around the world (dominant soil, topsoil, depth (soil) 0-10cm, temperate woodland biome, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 1
357amnondominant soil, topsoil, depth (soil) 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 1
84amnondominant depth 5cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-07v4No1 / 1
100amnon high in ph ph>5, ph<6.5 compared to ph<5 ph>6.5 in soil urban biome park new york city central park 2017-04-03v4No1 / 1
100amnondominant soil, urban biome, park, new york city, central park2017-04-03v4No1 / 1
412amnondominant soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 1
155amnonhigh freq in soil loosely bound to wheat root (dominant triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 1
155amnonhigh freq in bulk soil in wheat field (dominant triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 1
600sheryoDominant in unammended soil after 82 days (dominant depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1
421amnondominant soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1
171amnonhigh freq. in soil with rice growth irrigation protocol (dominant soil, united states of america, state of california, depth 5cm)2017-07-25v4No1 / 1
175amnonhigh freq in heavy metal contaminated soils in china (dominant soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 1
917amnondominant ph 6-7, depth (soil) 0-20cm, futian national nature reserve, sonneratia apetala, china, marsh, mangrove, soil2022-07-08v3No1 / 1
917amnondominant qiao nature reserve, depth (soil) 0-20cm, sonneratia apetala, china, marsh, mangrove, ph 7-8, soil2022-07-08v3No1 / 1
444amnonhigh freq. in uncultivated soil plot (dominant yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 1
296amnonhigh freq. in wheat field soil (dominant soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 1
768sheryoDom inant in maize fields in Brittany, France (dominant zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1
583amnondominant soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 2
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 2
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 2
357amnondominant soil, topsoil, depth (soil) 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 2
357amnondominant soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 2
583amnondominant soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-28v3No1 / 2
583amnondominant soil, mountain, switzerland, ph 4-6, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 2
824sheryoDominant in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (dominant yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, 27-35 years of grazing exclusion, grazing exclusion, china, depth (soil) 0-10cm, soil)2021-08-08v4No1 / 2
76amnonhigh freq. in seleniferous soil (dominant united states of america, soil, rhizosphere, selenium, seleniferous, state of florida)2017-02-28v4No1 / 2
600sheryodecearses after 12 days of unammendment in soil ( high in day 1 compared to day 12 in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 )2020-03-27v4No1 / 2
837sheryoDominant in soil at 0-40 cm depth after 30 years reforestation with Black locust trees, shaanxi, China (dominant 30 years, depth 0-40cm, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 2
821sheryoDominant in soil of restored prairie at 0-10cm depth, Michigan USA (dominant ph 6.5, depth (soil) 0-10cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 2
155amnonhigh freq in soil tightly bound to wheat root (dominant triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 2
422amnondominant soil, paddy field soil, oryza sativa, heilongjiang province, cultivated environment, china2018-12-02v4No1 / 2
422amnondominant soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 2
171amnondominant soil, united states of america, state of california, rhizosphere, oryza sativa, rice2017-07-25v4No1 / 2
917amnondominant qiao nature reserve, depth (soil) 0-20cm, ph 6-6.5, kandelia candel, china, marsh, mangrove, soil2022-07-08v3No1 / 2
917amnondominant depth (soil) 0-20cm, futian national nature reserve, kandelia candel, china, marsh, mangrove, ph 7-8, soil2022-07-08v3No1 / 2
917amnondominant depth (soil) 0-20cm, ph 6-6.5, futian national nature reserve, china, mudflat, marsh, soil, saline marsh2022-07-08v3No1 / 2
271amnondominant depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2
616amnondominant in topsoil of PK/NP/NPK/NK fertilized sugarcane field (dominant depth (soil) 0-20cm, fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture)2020-04-27v3No1 / 2
786sheryoDominant in flood plain soil near cosumnes river, california, at 30-60cm depth (dominant depth (soil) 30-60cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 3
40amnonhigher in soil susceptible to tobacco bacterial wilt disease ( high in disease compared to control in soil field soil nicotiana tabacum rhizosphere china )2016-12-09v4No1 / 3
798amnondominant depth (soil) 10 cm, depth (soil) 0-20cm, ph 7-8, soil, orchard, apricot, prunus armeniaca, apennine mountains, italy2021-06-13v3No1 / 3
801sheryoDominant in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (dominant united states, ph 7.5, nicollet soil series, depth (soil) 0-15cm, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 3
801sheryoDominant at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (dominant subsurface drainage, ph 6.2, depth (soil) 0-15cm, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 3
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 3
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 3
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, ximendao national marine reserve, zhejiang province, spartina alterniflora2019-12-16v4No1 / 3
356amnonhigh freq. in deciduous broad leaved forest top soil in japan (dominant soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 3
357amnondominant soil, topsoil, depth (soil) 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 3
360amnondominant desert, soil, rhizosphere, agave, agave deserti, state of california2018-08-21v4No1 / 3
821sheryoDominant in soil of continuous corn field at 0-10cm depth, Michigan USA (dominant united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 3
821sheryoDominant in soil of miscanthus field at 0-10cm depth, Michigan USA (dominant depth (soil) 0-10cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 3
824sheryoDomionant in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (dominant depth (soil) 0-10cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 3
828sheryoDominant in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (dominant depth (soil) 0-10cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 3
76amnonhigh freq in non-seleniferous soil (dominant soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 3
837sheryoDominant in agricultural field at depths 0-40cm, shaanxi, China (dominant depth 0-40cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 3
837sheryoDominant in soil at 40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (dominant depth 40-100cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 3
837sheryoDominant in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (dominant depth 100-300cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 3
842sheryoDominant in soil depth of 0-15cm in a mature forest in Ontario, Canada (dominant depth 0-15cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 3
631sheryodominant in maize field unamended bulk soil (dominant bulk soil, unamended soil, ph 7.9, maize field, soil, kaiyang county, guizhou province, china)2020-06-02v3No1 / 3
631sheryodominant in maize field biochar amended bulk soil, after 6 years of biochar amended (dominant ph 8, china, guizhou province, kaiyang county, soil, maize field, bulk soil, biochar, after 6 years)2020-06-02v3No1 / 3
917amnondominant qiao nature reserve, depth (soil) 0-20cm, china, mudflat, marsh, ph 7-8, soil, saline marsh2022-07-08v3No1 / 3
444amnondominant rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 3
709sheryoHigher in potting mix soil mixed with Murashige and Skoog (MS) medium and inoculated with Verticillium dahliae ( high in inoculated with verticillium dahliae verticillium verticillium dahliae compared to not inoculated with verticillium dahliae in murashige and skoog (ms) medium substraat arabidopsis lentse potgrond soil potting mix kingdom of the netherlands )2028-05-16v4No1 / 3
296amnondominant depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 3
600sheryoDominant in biochar ammended soil after 82 days (dominant depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 3
296amnondominant depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 3
265amnondominant canada, province of quebec, soil2017-12-11v4No1 / 3
760sheryoDominant in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (dominant manure fertilization, manured soil, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 3
760sheryoDominant in rhizosphere soil of rice plants with NPK fertilization in a long term fertilization experiment (dominant npk fertilization, npk fertilizer, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 3
821sheryoDominant in soil of continuous corn field at 25-50cm depth, Michigan USA (dominant depth (soil) 25-50cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 4
791sheryoDominant at 0cm depth in low saline low sodicity soil in China (dominant depth (soil) 0-20cm, ph 8.5, depth 0cm, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 4
801sheryoDominant at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (dominant ph 6, depth (soil) 15-30cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 4
801sheryoDominant at depth 60-90cm in corn and soybean agriculture fields, Iowa USA (dominant depth (soil) 60-90cm, ph 7.9, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-16v4No1 / 4
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 4
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 4
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 4
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 4
357amnonhigh freq. in moist tropical forest topsoil around the world (dominant soil, topsoil, depth (soil) 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 4
360amnondominant desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 4
360amnondominant desert, soil, state of california2018-08-21v4No1 / 4
360amnondominant desert, soil, mexico, guanajuato2018-08-21v4No1 / 4
821sheryoDominant in soil of miscanthus field at 10-25cm depth, Michigan USA (dominant depth (soil) 10-25cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 4
821sheryoDominant in soil of miscanthus field at 25-50cm depth, Michigan USA (dominant depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, miscanthus, state of michigan, soil, united states of america)2021-08-02v4No1 / 4
821sheryoDominant in soil of switchgrass field at 0-10cm depth, Michigan USA (dominant depth (soil) 0-10cm, panicum virgatum, restored prairie, kellogg biological station, mesic type hapludalf, kalamazoo loam, depth 50-100m, state of michigan, soil, united states of america)2021-08-02v4No1 / 4
821sheryoDominant in soil of switchgrass field at 10-25cm depth, Michigan USA (dominant depth (soil) 10-25cm, panicum virgatum, restored prairie, kellogg biological station, mesic type hapludalf, kalamazoo loam, depth 50-100m, state of michigan, soil, united states of america)2021-08-02v4No1 / 4
824sheryoDominant in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (dominant depth 10-20cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 4
821sheryoDominant in soil of restored prairie at 25-50cm depth, Michigan USA (dominant depth (soil) 25-50cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 4
837sheryoDominant in soil at 40-100cm depth after 30 years reforestation with Black locust trees, shaanxi, China (dominant depth 40-100cm, 30 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 4
837sheryoDominant in soil at 100-300cm depth after 30 years reforestation with Black locust trees, shaanxi, China (dominant depth 100-300cm, 30 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 4
84amnondominant depth 20cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-07v4No1 / 4
631sheryoDominant in maize field biochar amended rhizosphere soil (dominant ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 4
415amnondominant rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 4
415amnondominant rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 4
600sheryoDominant in stover ammended soil after 82 days (dominant depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 4
420amnonhigh freq. in soil of vegetable open field (dominant soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, npk fertilizer, cultivated environment, china)2018-12-02v4No1 / 4
420amnonhigh freq. in soil of vegetables in organic plastic tunnel (dominant soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, greenhouse soil, china, cultivated environment)2018-12-02v4No1 / 4
462amnondominant depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, soil, silt loam, cultivated environment2019-01-13v4No1 / 4
608sheryoDominant in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (dominant triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil, urea enriched soil)2020-04-20v4No1 / 4
296amnondominant depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 4
821sheryoDominant in soil of continuous corn field at 10-25cm depth, Michigan USA (dominant depth (soil) 10-25cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 4
760sheryoDominant in rhizosphere soil of rice plants without fertilization in a long term fertilization experiment (dominant ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, no fertilization, oryza sativa, rhizosphere)2021-04-06v4No1 / 4
1008amnon high in soil compared to rhizosphere in china farm fertilized soil allium sativum garlic jinxiang county ph 7-8 2023-01-26v4No1 / 4
786sheryoDominant in flood plain soil near cosumnes river, california, at 0-30cm depth (dominant depth (soil) 0-30 cm, depth (soil) 0-20cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 5
786sheryoDominant in flood plain soil near cosumnes river, california, at 60-100cm depth (dominant depth (soil) 60-100cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 5
791sheryoDominant at 20cm depth in low saline low sodicity soil in China (dominant ph 9, depth 20cm, ph 8.5, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 5
791sheryoDominant at 80cm depth in low saline low sodicity soil in China (dominant depth (soil) 80cm, ph 9, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 5
801sheryoDominant at depth 0-15cm in corn agriculture fields, Iowa USA (dominant kanawha, ph 7.1, nicollet soil series, depth (soil) 0-15cm, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 5
801sheryoDominant at depth 30-60cm in corn and soybean agriculture fields, Iowa USA (dominant ph 6.7, depth (soil) 30-60cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-16v4No1 / 5
624sheryodominant in ryegrass rhizosphere soil amended with biochar after 30-40 days (dominant china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v4No1 / 5
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 5
357amnondominant soil, topsoil, depth (soil) 0-10cm, montane forest, forest ecosystem, woodland area2018-08-19v4No1 / 5
823sheryoDominant at 0-15cm depth in foot slope ultisol soil in auburn, alabama (dominant foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 5
824sheryoDominant in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (dominant depth 10-20cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 5
821sheryoDominant in soil of restored prairie at 10-25cm depth, Michigan USA (dominant depth (soil) 10-25cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 5
828sheryoDominant in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (dominant depth 10-20cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 5
837sheryoDominant in soil after 10 years reforestation with Black locust trees at 0-40cm depth, shaanxi, China (dominant depth 0-40cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 5
837sheryoDominant in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (dominant depth 0-40cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 5
842sheryoDominant in soil depth of 0-15cm in an old growth forest in Ontario, Canada (dominant depth 0-15cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 5
842sheryoDominant in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant depth 0-15cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 5
842sheryoDominant in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant depth 0-15cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 5
628sheryodominant in rhizosphere of barley roots after 180 days in treatments amended with biochar (dominant biochar, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 5
628sheryodominant in rhizosphere of barley roots after 180 days in treatments unamended with biochar (dominant china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 5
628sheryodominant in bulk soil with barley plants after 180 days in treatments amended with biochar (dominant biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 5
414amnondominant soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 5
420amnonhigh freq. in soil of vegetable in plastic tunnel (dominant soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, npk fertilizer, greenhouse soil, cultivated environment, china)2018-12-02v4No1 / 5
608sheryoDominant in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (dominant triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil)2020-04-20v4No1 / 5
296amnondominant depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 5
512amnondominant fen, peatland, peat soil, soil, hani peatland, baekdudaegan, ph 5-6, china2019-03-22v4No1 / 5
765sheryoDominant in wheat field in the loess plateau in china (dominant triticum aestivum, ph 7.7, loess plateau, silt loam, chromic cambisol, shanxi province, china, soil)2021-04-12v3No1 / 5
1008amnondominant rhizosphere, china, farm, fertilized soil, allium sativum, garlic, jinxiang county, ph 7-82023-01-26v4No1 / 5
788amnondominant soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 6
548amnonhigh freq in phosphorus impoverished soil (dominant soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 6
791sheryoDominant at 40cm depth in low saline low sodicity soil in China (dominant depth (soil) 40cm, ph 9, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 6
347amnondominant kingdom of norway, svalbard archipelago, permafrost, soil, depth 100-150cm2018-07-15v4No1 / 6
347amnondominant kingdom of norway, svalbard archipelago, permafrost, soil, depth 150-200cm2018-07-15v4No1 / 6
801sheryoDominant at depth 15-30cm in corn agriculture fields, Iowa USA (dominant kanawha, depth (soil) 15-30cm, nicollet soil series, ph 7.7, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 6
801sheryoDominant at depth 60-90cm in corn agriculture fields, Iowa USA (dominant depth (soil) 60-90cm, ph 8.3, kanawha, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 6
821sheryoDominant in soil of continuous corn field at 50-100cm depth, Michigan USA (dominant depth 50-100m, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 6
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 6
813amnondominant intact branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 6
813amnondominant severed branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 6
360amnondominant desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 6
821sheryoDominant in soil of switchgrass field at 50-100cm depth, Michigan USA (dominant depth 50-100m, panicum virgatum, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 6
837sheryoDominant in agricultural field at depths 100-300cm, shaanxi, China (dominant depth 100-300cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 6
842sheryoDominant in soil depth of 0-15cm in a zea mays agricultural field in Ontario, Canada (dominant depth 0-15cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 6
842sheryoDominant in soil depth of 15-30cm in a zea mays agricultural field in Ontario, Canada (dominant depth 15-30cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 6
842sheryoDominant in soil depth of 0-15cm in a mature forest in Ontario, Canada (dominant forest, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus velutina, quercus alba, quercus rubra, mature forest, forested area, brunisol, soil, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 6
842sheryoDominant in soil depth of 15-30cm in a mature forest in Ontario, Canada (dominant depth 15-30cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 6
842sheryoDominant in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant depth 0-15cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 6
854sheryoDominant in soil depth of 25-50cm of colluvial soil, Czech rebuplic (dominant calcic chernozem, colluvial soil, depth 25-50cm, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 6
854sheryoDominant in soil depth of 75-100cm of colluvial soil, Czech rebuplic (dominant depth 75-100cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 6
628sheryodominant in bulk soil with barley plants after 180 days in treatments unamended with biochar (dominant bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 6
631sheryodominant in maize field unamended rhizosphere soil (dominant unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 6
883amnondominant oilfield, yellow river delta, china, shengli oilfield, oil contaminated soil, soil2022-03-20v4No1 / 6
414amnondominant soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 6
415amnondominant rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 6
415amnondominant rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 6
146amnondominant united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 6
420amnonhigh freq. in soil of vegetables in organic field (dominant soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, china, cultivated environment)2018-12-02v4No1 / 6
156amnondominant soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 6
444amnondominant rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 6
237amnonhigh freq. in burrow soil of seabird (dominant bird, oceanodroma leucorhoa, seabird, canada, bon portage island, burrow, soil)2017-11-07v4No1 / 6
296amnondominant depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 6
480amnon high in ph 5-6 compared to ph 6-7 ph in soil pasture farm new zealand 2019-02-05v4No1 / 6
480amnondominant soil, pasture, farm, new zealand2019-02-05v4No1 / 6
263amnonhigh freq. in desert soil irrigated daily in lab (dominant soil, israel, sandy loam soil, negev desert, ph 7-8, irrigated, research facility)2017-12-11v4No1 / 6
266amnonhigh freq. in soil from JAM garden (dominant soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 6
754sheryoDominant in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (dominant bacillus amyloliquefaciens sqr9, zhejiang province, cucumber, fusarium oxysporum, bio-organic fertilizer, soil, china)2021-03-15v3No1 / 6
282amnondominant soil, mangrove swamp, mangrove, united states of america, state of florida, avicennia germinans, rhizophora mangle2018-01-25v4No1 / 6
616amnondominant in topsoil of non-fertilized sugarcane field (dominant depth (soil) 0-20cm, ph 6.7, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 6
571amnondominant depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, spartina alterniflora, hainan autonomous prefecture, danzhou xinyinggang nature reserve2019-12-16v4No1 / 7
821sheryoDominant in soil of switchgrass field at 25-50cm depth, Michigan USA (dominant depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-03v4No1 / 7
821sheryoDominant in soil of switchgrass field at 25-50cm depth, Michigan USA (dominant panicum virgatum, depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 7
823sheryoDominant at 15-30cm depth in foot slope ultisol soil in auburn, alabama (dominant depth (soil) 15-30cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 7
824sheryoDominant in soil after 27-35 years of grazing exclusion at 20-40cm depth, Ningxia china (dominant depth 20-40cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 7
829sheryoDominant in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (dominant depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 7
829sheryoDominant in soil depth of 12-44m in Alfisol soil, Dekalb, Illinois, united states of america (dominant depth 12-44cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 7
842sheryoDominant in soil depth of 30-45cm in a mature forest in Ontario, Canada (dominant depth 30-45cm, mature forest, brunisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 7
842sheryoDominant in soil depth of 30-45cm in a mature forest in Ontario, Canada (dominant depth 30-45cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 7
842sheryoDominant in soil depth of 30-45cm in an old growth forest in Ontario, Canada (dominant depth 30-45cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 7
842sheryoDominant in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant depth 15-30cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 7
842sheryoDominant in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant depth 30-45cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 7
415amnondominant rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 7
145amnondominant soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 7
667amnondominant depth (soil) 0-20cm, jiangxi province, lushan mountain, china, forested area, ph 4.5, elevation 200-300m, topsoil, soil2020-09-25v4No1 / 7
755sheryodominant in domesticated soybean (Glycine max) rhizosphere (dominant glycine max, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
755sheryodominant in wild soybean (Glycine soja) rhizosphere (dominant glycine soja, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
755sheryodominant in domesticated soybean (Glycine max) rhizosphere (dominant glycine max, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
755sheryodominant in wild soybean (Glycine soja) rhizosphere (dominant glycine soja, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 7
755sheryodominant in wild rice (Oryza rufipogon) rhizosphere (dominant oryza rufipogon, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 7
764sheryoDominant in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (dominant maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 7
767sheryoDominant in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (dominant deep plough, conventional tillage, pig manure, compost soil, paenibacillus, paenibacillus polymyxa, compost biofilter, bio-organic fertilizer, nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-18v4No1 / 7
527amnondominant soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, lorentzenpiggen2019-07-14v4No1 / 8
531amnondominant rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 8
792amnondominant depth (soil) 20-60cm, sand, ph 9, minqin county, depth (soil) 50cm, soil, desert, china2021-06-07v4No1 / 8
801sheryoDominant in soybean and corn agriculture fields at depth 60-90cm, Iowa USA (dominant ph 7.7, depth (soil) 60-90cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 8
357amnondominant soil, topsoil, depth (soil) 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 8
821sheryoDominant in soil of miscanthus field at 50-100cm depth, Michigan USA (dominant kellogg biological station, mesic type hapludalf, kalamazoo loam, miscanthus, depth 50-100m, state of michigan, soil, united states of america)2021-08-02v4No1 / 8
824sheryoDominant in soil after 0-9 years of grazing exclusion at 20-40cm depth, Ningxia china (dominant depth 20-40cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 8
829sheryoDominanmt in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (dominant depth 108-140cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 8
837sheryoDominant in agricultural field at depths 40-100cm, shaanxi, China (dominant depth 40-100cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 8
837sheryoDominant in soil after 10 years reforestation with Black locust trees at 100-300cm depth, shaanxi, China (dominant depth 100-300cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 8
610sheryoDominant in agricultural field soil (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, triticum aestivum)2020-04-21v3No1 / 8
842sheryoDominant in soil depth of 15-30cm in an old growth forest in Ontario, Canada (dominant depth 15-30cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 8
842sheryoDominant in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant depth 15-30cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 8
854sheryoDominant in soil depth of 125-175cm of colluvial soil, Czech rebuplic (dominant depth 125-175cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 8
855sheryoDopminant in soil depth of 10cm in fertilized soil in china (dominant luancheng county, china, agricultural field, depth (water) 10cm, fertilized soil, soil)2021-12-27v3No1 / 8
415amnondominant rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 8
415amnondominant rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 8
426amnondominant soil, tundra, permafrost, russia, nenets autonomous okrug2018-12-08v4No1 / 8
667amnondominant depth (soil) 0-20cm, elevation 800-900m, ph 4.5, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 8
667amnondominant depth (soil) 0-20cm, ph 4, elevation 1300-1400m, coniferous forest biome, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 8
462amnondominant depth (soil) 20-60cm, united states of america, state of tennessee, soil, depth 30-75cm, silt clay loam, cultivated environment2019-01-13v4No1 / 8
84amnondominant soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 5cm, wetland area2017-03-06v4No1 / 8
474amnondominant farm, soil, soybean, glycine max, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 8
964amnondominant volcan sumaco, ecuador, depth (soil) 10-25cm, soil, ph 4-5, stratovolcano2022-12-21v3No1 / 8
480amnondominant soil, pasture, farm, ireland2019-02-05v4No1 / 8
259amnonhigh freq. in soil and rhizpsphere of peanut plants (dominant soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 8
266amnonhigh freq. in soil from MIL garden (dominant soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 8
266amnonhigh freq. in soil from PAR garden (dominant soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 8
266amnonhigh freq. in soil from SIL garden (dominant soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 8
615amnondominant in control soil with no sugarcane (dominant campinas, brazil, greenhouse, soil)2020-04-27v4No1 / 8
279amnondominant grassland, soil, alpine soil, tibetan plateau, china2018-01-24v4No1 / 8
761sheryoDominant in bulk sandy soil maize field in Germany (dominant ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 8
512amnondominant fen, peatland, peat soil, soil, ph 5.5-6.5, tibetan plateau, riganqiao peatland, china2019-03-22v4No1 / 8
762sheryoDominant in bulk soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (dominant ph 6.6, manured soil, manure fertilization, organic fertilization, bio-dynamic fertilizer, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 8
764sheryoDominant in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (dominant ph 7.6, crop rotation, cultivator tillage, conservation tillage, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 8
764sheryoDominant in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (dominant rapeseed pre-crop, brassica napus, maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 8
783sheryodominant in desert soil in mongolia under water addition treatment (dominant 100% above ambient precipitation, water addition, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 9
786sheryoDominant in flood plain soil near cosumnes river, california, at 166-200cm depth (dominant flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 9
40amnonhigher in soil protective from tobacco bacterial wilt disease ( high in control compared to disease in soil field soil nicotiana tabacum rhizosphere china )2016-12-09v4No1 / 9
801sheryoDominant in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (dominant ph 7.4, depth (soil) 15-30cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 9
801sheryoDominant in soybean and corn agriculture fields at depth 30-60cm, Iowa USA (dominant depth (soil) 30-60cm, ph 7.4, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 9
801sheryoDominant at depth 30-60cm in corn agriculture fields, Iowa USA (dominant ph 8.1, depth (soil) 30-60cm, kanawha, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 9
624sheryodominant in ryegrass rhizosphere soil after 30-40 days (dominant days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 9
820naCommon in top soil, 0-20cm depth, wheat rhizosphere haplic luvisol in germany (dominant depth (soil) 0-20cm, triticum aestivum, ph 6.5, silt loam, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 9
360amnondominant desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 9
823sheryoDominant at 0-10cm depth in ultisol soil in auburn, alabama (dominant depth (soil) 0-10cm, auburn, alabama, upland soil, agricultural field, ultisol, soil)2021-08-07v3No1 / 9
828sheryoDominant in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (dominant depth (soil) 20-30cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 9
837sheryoDominant in soil after 10 years reforestation with Black locust trees at 40-100cm depth, shaanxi, China (dominant depth 40-100cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 9
842sheryoDominant in soil depth of 15-30cm in a mature forest in Ontario, Canada (dominant depth 15-30cm, forest, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus velutina, quercus alba, quercus rubra, mature forest, forested area, brunisol, soil, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 9
842sheryoDominant in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant depth 30-45cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 9
609sheryoDominant in soil without tobacco plants amended with difenoconazole fungicide and biochar (dominant biochar, without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 9
129amnondominant ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 9
129amnondominant ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 9
415amnondominant rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 9
421amnonhigh freq. in paddy field soil incubated without copper (dominant soil, research facility, zhejiang province, paddy field soil, china)2018-12-02v4No1 / 9
821sheryoDominant in soil of restored prairie at 50-100cm depth, Michigan USA (dominant depth 50-100m, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 9
609sheryoDominant in soil without tobacco plants with difenoconazole fungicide amended with biochar (dominant soil, depth 0-20cm, limestone, tobacco field, china, ph 7-8, fungicide, difenoconazole, biochar)2020-04-21v4No1 / 9
610sheryoDominant in agricultural field soil amended with low biochar (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum, low biochar)2020-04-21v3No1 / 9
752sheryoDominant in soil planted with Panax notoginseng amended with 2% biochar (dominant biochar, panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 9
764sheryoDominant in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (dominant crop rotation, triticum aestivum, ph 7.6, mouldboard plough, conventional tillage, loess chernozem, bernburg, germany, soil)2021-04-12v3No1 / 9
769sheryodominant in no tillage wheat field in northern israel (dominant bulk soil, triticum aestivum, no tillage, northen israel, israel, vertisol, soil)2021-04-18v4No1 / 9
786sheryoDominant in flood plain soil near cosumnes river, california, at 400-700cm depth (dominant depth (soil) 400-700cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 10
820naDominant in lower subsoil, 75-105cm depth, wheat rhizosphere haplic luvisol in germany (dominant depth (soil) 75-105cm, silty clay loam, ph 6.9, triticum aestivum, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 10
791sheryoDominant in highly saline sodic soil at 0cm depth in China (dominant depth (soil) 0-20cm, ph 10.5, high salinity, high sodicity, depth 0cm, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 10
347amnondominant kingdom of norway, svalbard archipelago, permafrost, soil, depth (soil) 20-30cm2018-07-15v4No1 / 10
359amnondominant soil, topsoil, depth (soil) 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 10
823sheryoDominant at 30-50cm depth in foot slope ultisol soil in auburn, alabama (dominant depth 30-50cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 10
824sheryoDominant in soil after 27-35 years of grazing exclusion at 40-60cm depth, Ningxia china (dominant 27-35 years of grazing exclusion, depth 40-60cm, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 10
828sheryoDominant in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (dominant depth 30-4cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 10
828sheryoDominant in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (dominant depth 40-50cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 10
829sheryoDominant in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (dominant depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 10
829sheryoDominant in soil depth of 116-140cm in Mollisol soil, Dekalb, Illinois, united states of america (dominant depth 116-140cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 10
662amnondominant loam soil, loam, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-22v3No1 / 10
610sheryoDominant in agricultural field soil amended with high biochar (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 10
610sheryoDominant in agricultural field soil amended with straw (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum, straw)2020-04-21v3No1 / 10
298amnondominant soil, desert, united states of america, state of utah, depth 1cm, soil crust2018-02-20v4No1 / 10
746sheryoDominant in saline soil in dafeng, china (dominant ph 7.6, jiangsu province, dafeng city, china, solonchak, saline soil)2021-03-03v4No1 / 10
989amnondominant soil, china, farm, ph 4-5, anxi county, cinnamomum camphora, depth (soil) 0-20cm2022-12-26v3No1 / 10
762sheryoDominant in bulk soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (dominant npk fertilization, mineral fertilization, ph 5.6, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 10
769sheryoDominant in conventional tillage wheat field in northern israel (dominant conventional tillage, bulk soil, soil, vertisol, israel, northen israel, triticum aestivum)2021-04-18v4No1 / 10
783sheryodominant in desert soil in mongolia without water addition treatment (dominant no water addition, ambient precipitation, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 11
316amnondominant united states of america, soil, topsoil, state of ohio, depth (soil) 0-10cm, ph 5, forest ecosystem2018-04-10v4No1 / 11
347amnondominant depth (soil) 0-20cm, kingdom of norway, svalbard archipelago, permafrost, soil, permafrost active layer2018-07-15v4No1 / 11
823sheryoDominant at 10-25cm depth in ultisol soil in auburn, alabama (dominant depth (soil) 10-25cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 11
824sheryoDominant in soil after 0-9 years of grazing exclusion at 40-60cm depth, Ningxia china (dominant 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, depth 40-60cm, china, soil)2021-08-08v4No1 / 11
829sheryoDominant in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (dominant depth 27-56cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 11
829sheryoDominant in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (dominant depth 44-108cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 11
854sheryoDominant in soil depth of 200-250cm of colluvial soil, Czech rebuplic (dominant depth 200-250cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 11
412amnondominant soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 11
662amnondominant clay soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 11
171amnonhigh in draught soil compared to soil with rice growth irrigation protocol ( high in drought environment compared to control flooded soil in soil united states of america state of california depth 5cm )2017-07-25v4No1 / 11
444amnon high in spring compared to winter in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture cultivated environment china 2019-01-07v4No1 / 11
444amnon high in winter compared to spring in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture cultivated environment china 2019-01-07v4No1 / 11
266amnonhigh freq. in soil from MAH garden (dominant soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 11
279amnondominant grassland, steppe, mongolia, soil, china2018-01-24v4No1 / 11
755sheryodominant in domesticated rice (Oryza stavia) rhizosphere (dominant oryza sativa, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 11
767sheryoDominant in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (dominant dazomet, soil fumigation, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 11
767sheryoDominant in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (dominant pig manure, compost soil, paenibacillus, paenibacillus polymyxa, compost biofilter, bio-organic fertilizer, nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 11
527amnondominant soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, grunehogna2019-07-14v4No1 / 12
527amnondominant soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, robertskollen2019-07-14v4No1 / 12
527amnondominant soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, brugdedalen2019-07-14v4No1 / 12
786sheryoDominant in flood plain soil near cosumnes river, california, at 133-166cm depth (dominant depth (soil) 133-166cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 12
360amnondominant desert, soil, rhizosphere, agave, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 12
842sheryoDominant in soil depth of 30-45cm in a zea mays agricultural field in Ontario, Canada (dominant depth 30-45cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 12
855sheryoDominant in soil depth of 75cm in fertilized soil in china (dominant depth 75cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 12
609sheryoDominant in soil without tobacco plants amended with difenoconazole fungicide (dominant without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 12
667amnondominant depth (soil) 0-20cm, ph 4.5, elevation 500-600m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 12
709sheryoDominant in potting mix soil from the Netherlands, substraat arabidopsis, Lentse Potgrond (dominant substraat arabidopsis, lentse potgrond, soil, potting mix, kingdom of the netherlands)2028-05-16v4No1 / 12
609sheryoDominant in soil without tobacco plants with difenoconazole fungicide amended and without biochar (dominant difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 12
750sheryoDominant in soil of wheat field in China (dominant fluvo-aquic soil, ph 7.6, hebei province, luancheng county, china, triticum aestivum, soil)2021-03-11v3No1 / 12
767sheryoDominant in soil planted with Chrysanthemum, infested with fusarium in Nanjing China (dominant soil, fusarium, fusarium oxysporum f. sp. chrysanthemi, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 12
854sheryoDominant in soil depth of 275-325cm of colluvial soil, Czech rebuplic (dominant depth 275-325cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 13
421amnonhigh freq. in paddy field soil incubated with copper (dominant soil, research facility, zhejiang province, paddy field soil, copper, china)2018-12-02v4No1 / 13
667amnondominant depth (soil) 0-20cm, coniferous forest biome, ph 4-4.5, elevation 1000-1100m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 13
609sheryoDominant in soil with tobacco plants amended with difenoconazole fungicide (dominant tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 13
609sheryoDominant in soil with tobacco plants amended with difenoconazole fungicide and biochar (dominant biochar, tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 13
480amnon high in ph ph 6-7 compared to ph 5-6 in soil pasture farm new zealand 2019-02-05v4No1 / 13
751sheryoDominant in tomato soil infected with Fusarium oxysporum (dominant china, shandong province, luojiazhuang, fusarium oxysporum, solanum lycopersicum, soil)2021-03-11v3No1 / 13
752sheryoDominant in soil planted with Panax notoginseng (dominant panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 13
527amnondominant soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, vassdalen2019-07-14v4No1 / 14
786sheryoDominant in flood plain soil near cosumnes river, california, at 100-133cm depth (dominant depth (soil) 100-133cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 14
402amnondominant sediment, soil, mine tailing, alkaline mine tailing, guangxi zhuang autonomous region, zone 2,3, china2018-11-18v4No1 / 14
820nadominant in upper subsoil, 45-75cm depth, wheat rhizosphere haplic luvisol in germany (dominant silty clay loam, ph 6.9, depth (soil) 45-75cm, triticum aestivum, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 14
602sheryocommon rhizosphere, soil, israel, solanum lycopersicum, biochar2020-04-03v4No1 / 14
129amnon high in rhizosphere compared to soil in ph 6-6.5 mexico myrtillocactus geometrizans opuntia robusta cactus semi-arid 2017-04-15v4No1 / 14
250amnonhigh freq. in bamboo forest soil (dominant soil, ph 4, bamboo, phyllostachys pubescens, depth (soil) 0-10cm, woodland area, china)2017-11-22v4No1 / 14
662amnondominant loamy sand soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-22v3No1 / 14
746sheryoDominant in saline soil fertilized with biological fertilizer, planted with tomatos, in dafeng, china (dominant saline soil, solonchak, china, dafeng city, jiangsu province, ph 7.5, solanum lycopersicum, biological fertilization, chicken manure, trichoderma guizhouense njau 4742)2021-03-03v4No1 / 14
506amnondominant soil, boreal wetland, seasonal frozen marsh, depth (soil) 0-10cm, peat soil, northeast china, china, wetland area2019-03-16v4No1 / 14
767sheryoDominant in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (dominant paenibacillus polymyxa, paenibacillus, compost, compost biofilter, pig manure, bio-organic fertilizer, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 14
527amnondominant soil, antarctica, east antarctica, nunatak, valterkulten, depth (soil) 2cm2019-07-14v4No1 / 15
402amnondominant sediment, soil, mine tailing, alkaline mine tailing, guangxi zhuang autonomous region, zone 1, china2018-11-18v4No1 / 15
373amnondominant soil, rhizosphere, oryza sativa, rice, hunan province, rice field, china2018-09-08v4No1 / 15
135amnondominant soil, tundra, alaska, permafrost, depth (soil) 15cm2017-04-17v4No1 / 15
84amnondominant soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 20cm, wetland area2017-03-06v4No1 / 15
762sheryoDominant in bulk soil of a pot experiment with lettuce planted in npk fertilized albic luvisol from Germany (dominant mineral fertilization, npk fertilization, germany, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 15
762sheryoDominant in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (dominant manured soil, manure fertilization, germany, organic fertilization, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 15
893amnondominant silty clay loam, raphanus sativus, greenhouse, radish, commonwealth of virginia, rhizosphere, fertilized soil, research facility, united states of america2022-04-11v4No1 / 16
762sheryoDominant in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (dominant bio-dynamic fertilizer, manured soil, manure fertilization, organic fertilization, thyrow, switzerland, haplic luvisol, pot expreiment, lettuce, soil, rhizosphere)2021-04-08v3No1 / 16
823sheryoDominant at 50-90cm depth in foot slope ultisol soil in auburn, alabama (dominant depth 50-90cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 17
829sheryoDominant in soil depth of 56-116cm in Mollisol soil, Dekalb, Illinois, united states of america (dominant depth 56-116cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 17
762sheryoDominant in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (dominant thyrow, switzerland, haplic luvisol, mineral fertilization, pot expreiment, lettuce, soil, rhizosphere, npk fertilization)2021-04-08v3No1 / 17
823sheryoDopminant at 25-50cm depth in ultisol soil in auburn, alabama (dominant depth (soil) 25-50cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 18
823sheryoDominant at 90-100cm depth in foot slope ultisol soil in auburn, alabama (dominant depth 90-100cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 18
84amnonincreases in drought in late time points ( high in drought environment timepoint compared to control in depth 5cm soil temperate grassland biome fen peat soil flooded grassland biome united kingdom )2017-03-07v4No1 / 18
147amnondominant peatland, soil, siberia, ph 4.5, lichen, moss2017-04-20v4No1 / 18
746sheryoDominant in saline soil fertilized with chemical fertilizer, planted with tomatos, in dafeng, china (dominant chemical fertilization n,p,k, solanum lycopersicum, ph 7.5, jiangsu province, dafeng city, china, solonchak, saline soil)2021-03-03v4No1 / 18
527amnondominant soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, mimelia2019-07-14v4No1 / 19
855sheryoDominant in soil depth of 350cm in fertilized soil in china (dominant depth 350cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 19
855sheryoDominant in soil depth of 800cm in fertilized soil in china (dominant depth 800cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 19
855sheryoDominant in soil depth of 1000cm in fertilized soil in china (dominant depth 1000cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 19
791sheryoDominant in highly saline sodic soil at 20cm depth in China (dominant ph 10.5, depth 20cm, high salinity, high sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 20
823sheryoDominant at 50-70cm depth in ultisol soil in auburn, alabama (dominant depth 50-70cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 20
855sheryoDominant in soil depth of 175cm in fertilized soil in china (dominant depth 175cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 20
147amnondominant pinus sibirica, tundra, soil, pine forest, ph 4, siberia, forest ecosystem2017-04-20v4No1 / 20
480amnon high in new zealand compared to ireland in soil pasture farm ph 6-7 2019-02-05v4No1 / 20
791sheryoDominant in highly saline sodic soil at 40cm depth in China (dominant depth (soil) 40cm, ph 10.5, high salinity, high sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 21
791sheryoDominant in highly saline sodic soil at8 80cm depth in China (dominant depth (soil) 80cm, ph 10, high salinity, high sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 21
893amnondominant sandy loam, raphanus sativus, greenhouse, radish, commonwealth of virginia, rhizosphere, fertilized soil, research facility, united states of america2022-04-11v4No1 / 21
762sheryoDominant in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized albic luvisol Germany (dominant pot expreiment, lettuce, soil, rhizosphere, germany, thyrow, albic luvisol, mineral fertilization, npk fertilization)2021-04-08v3No1 / 21
762sheryoDominant in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized albic luvisol Germany (dominant organic fertilization, manure fertilization, manured soil, pot expreiment, lettuce, soil, rhizosphere, germany, thyrow, albic luvisol, mineral fertilization, npk fertilization)2021-04-08v3No1 / 21
610sheryoHigher in agricultural field soil unamended with straw ( high in soil unamended with straw compared to soil amended with straw in triticum aestivum ph 7 wheat kingdom of denmark agricultural field soil )2020-04-21v3No1 / 22
823sheryoDominant at 70-100cm depth in ultisol soil in auburn, alabama (dominant depth 70-100cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 23
375amnoncommon in oil contaminated desert soil (dominant soil, kuwait, desert, oil contaminated soil)2018-09-09v4No1 / 25
101amnon high in rhizosphere compared to soil in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 26
154amnonstrongly correlated with high uranium concentration ( high in uranium high urnaium compared to control in soil australia kakadu national park sediment )2017-06-29v4No1 / 28
1008amnon high in rhizosphere compared to soil in ph 7-8 jinxiang county garlic allium sativum fertilized soil farm china 2023-01-26v4No1 / 29
624sheryolower in ryegrass rhizosphere soil amended with biochar after 30-40 days ( high in without biochar compared to biochar in china jiangsu province soil 10 cm depth ph 7-8 ryegrass rhizosphere days 30-40 )2020-05-11v4No1 / 30
600sheryodecearses after 12 days of biochar ammendment in soil ( high in day 1 compared to day 12 in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 biochar )2020-03-27v4No1 / 30
764sheryoHigh in rapeseed pre-crop compared to maize pre-crop in leoss soil in wheat field grown under conservation tillage and crop rotation in germany ( high in brassica napus rapeseed pre-crop compared to maize pre-crop zea mays in ph 7.6 crop rotation cultivator tillage conservation tillage triticum aestivum soil germany bernburg )2021-04-12v3No1 / 30
155amnonhigher in bulk soil compared to loose bound root soil ( high in bulk soil compared to rhizosphere in triticum aestivum wheat soil china )2017-07-02v4No1 / 31
764sheryoHigh in maize pre-crop compared to rapeseed pre-crop in leoss soil in wheat field grown under conservation tillage and crop rotation in germany ( high in maize pre-crop zea mays compared to rapeseed pre-crop brassica napus in ph 7.6 crop rotation cultivator tillage conservation tillage triticum aestivum soil germany bernburg )2021-04-12v3No1 / 31
527amnoncommon soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, mimelia2019-07-14v4No1 / 33
610sheryoHigher in agricultural field soil amended with straw ( high in soil amended with straw compared to soil unamended with straw in triticum aestivum ph 7 wheat kingdom of denmark agricultural field soil )2020-04-21v3No1 / 34
709sheryoHigher in potting mix soil mixed with Murashige and Skoog (MS) medium and not inoculated with Verticillium dahliae ( high in not inoculated with verticillium dahliae compared to inoculated with verticillium dahliae in murashige and skoog (ms) medium substraat arabidopsis lentse potgrond soil potting mix kingdom of the netherlands )2028-05-16v4No1 / 34
84amnondisappears in drought in late time points ( high in control compared to drought environment timepoint in depth 5cm soil temperate grassland biome fen peat soil flooded grassland biome united kingdom )2017-03-07v4No1 / 37
842sheryoHigher in soil depth of 30-45cm compared to soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 30-45cm compared to depth 15-30cm in dipsacus fullonum solidago apocynum daucus carota brunisol decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 38
156amnonhigher in soil and rhizosphere supplemented with struvite ( high in struvite compared to control in soil rhizosphere brassica brassica oleracea china )2017-07-27v4No1 / 38
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in npk fertilized albic luvisol compared to organic fertilized from Germany ( high in mineral fertilization npk fertilization compared to manured soil manure fertilization organic fertilization in germany soil bulk soil thyrow albic luvisol ph 6.4 lettuce pot expreiment )2021-04-07v3No1 / 38
823sheryoHigher in 70-100cm depth compared to 50-70cm depth in ultisol soil in auburn, alabama ( high in depth 70-100cm compared to depth 50-70cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-08v3No1 / 39
762sheryoHigh in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized compared to organic fertilized haplic luvisol Switzerland ( high in mineral fertilization npk fertilization compared to organic fertilization manure fertilization manured soil bio-dynamic fertilizer in thyrow switzerland haplic luvisol pot expreiment lettuce soil rhizosphere )2021-04-08v3No1 / 40
837sheryoHigher in agricultural field at depths 40-100cm compared to 0-40cm, shaanxi, China ( high in depth 40-100cm compared to depth 0-40cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 42
171amnonlow in draught soil compared to soil with rice growth irrigation protocol ( high in control flooded soil compared to drought environment in soil united states of america state of california depth 5cm )2017-07-25v4No1 / 46
373amnon high in rhizosphere compared to soil in oryza sativa rice hunan province rice field china 2018-09-08v4No1 / 48
883amnon high in depth (soil) 0-20cm compared to depth (soil) 60-100cm in oilfield yellow river delta china shengli oilfield oil contaminated soil soil 2022-03-20v4No1 / 50
854sheryoHigher at soil depth of 275-325cm compared to soil depth of 200-250cm of colluvial soil, Czech rebuplic ( high in depth 275-325cm compared to depth 200-250cm in calcic chernozem colluvial soil ph 8 south moravian region czech republic soil )2021-12-23v3No1 / 52
764sheryoHigh in convetional tillage compared to conservation tillage leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany ( high in mouldboard plough conventional tillage compared to cultivator tillage conservation tillage in rapeseed pre-crop brassica napus ph 7.6 crop rotation triticum aestivum soil germany bernburg )2021-04-12v3No1 / 52
764sheryoHigh in conservation tillage compared to conventional tillage in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany ( high in cultivator tillage conservation tillage compared to mouldboard plough conventional tillage in maize pre-crop ph 7.6 crop rotation triticum aestivum soil germany bernburg )2021-04-12v3No1 / 56
624sheryoHigher in ryegrass rhizosphere soil amended with biochar after 30-40 days ( high in biochar compared to without biochar in china jiangsu province soil 10 cm depth ph 7-8 ryegrass rhizosphere days 30-40 )2020-05-11v4No1 / 59
600sheryoincearses after 12 days of unammendment in soil ( high in day 12 compared to day 1 in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 )2020-03-27v4No1 / 60
250amnoncommon in bamboo forest soil (common soil, bamboo, phyllostachys pubescens, ph 4, depth (soil) 0-10cm, woodland area, china)2017-11-22v4No1 / 60
155amnonlower in bulk soil compared to loose bound root soil ( high in rhizosphere compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 63
769sheryoHigh in no tillage compared to conventional tillage in wheat field in northern israel ( high in no tillage compared to conventional tillage in bulk soil soil vertisol israel northen israel triticum aestivum )2021-04-18v4No1 / 65
373amnonlower in soil of mature plants compared to seedlings ( high in early timepoints seedling compared to late timepoints in soil rhizosphere oryza sativa rice hunan province rice field china )2018-09-08v4No1 / 66
764sheryoHigh in conservation tillage compared to conventional tillage leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany ( high in conservation tillage cultivator tillage compared to conventional tillage mouldboard plough in bernburg germany soil triticum aestivum crop rotation ph 7.6 brassica napus rapeseed pre-crop )2021-04-12v3No1 / 68
989amnon high in rhizosphere compared to soil in depth (soil) 0-20cm cinnamomum camphora anxi county ph 4-5 farm china 2022-12-26v3No1 / 69
854sheryoHigher at soil depth of 25-100cm compared to soil depth of 125-175cm of colluvial soil, Czech rebuplic ( high in depth 25-100cm compared to depth 125-175cm in calcic chernozem colluvial soil ph 8 south moravian region czech republic soil )2021-12-23v3No1 / 70
764sheryoHigh in conventional tillage compared to conservation tillage in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany ( high in conventional tillage mouldboard plough compared to conservation tillage cultivator tillage in maize pre-crop ph 7.6 crop rotation triticum aestivum soil germany bernburg )2021-04-12v3No1 / 72
171amnonlower in rice rhizosphere soil compared to bulk soil (no rice) ( high in soil compared to rhizosphere in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 73
786sheryoHigher at 400-700cm depth compared to 166-200cm depth in flood plain soil near cosumnes river, california ( high in depth 400-700cm compared to depth 166-200cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 77
786sheryoHigher at 60-100cm depth compared to 30-60cm depth in flood plain soil near cosumnes river, california ( high in depth 60-100cm compared to depth 30-60cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-14v3No1 / 77
854sheryoHigher at soil depth of 200-250cm compared to soil depth of 125-175cm of colluvial soil, Czech rebuplic ( high in depth 200-250cm compared to depth 125-175cm in calcic chernozem colluvial soil ph 8 south moravian region czech republic soil )2021-12-23v3No1 / 77
512amnon high in depth (soil) 10 cm depth (soil) 0-20cm compared to depth (soil) 60cm in fen peatland peat soil soil china 2019-03-22v4No1 / 77
356amnonlower in non-snow covered period ( high in snow snow covered soil winter compared to non snow covered soil summer in soil depth (soil) 0-10cm hokkaido topsoil ph 5.4 forest ecosystem japan )2018-08-15v4No1 / 78
609sheryohigher in soil without tobacco plants and with difenoconazole fungicide ( high in absence of tobacco plants compared to presence of tobacco plants in difenoconazole fungicide ph 7-8 china tobacco field limestone depth 0-20cm soil )2020-04-21v4No1 / 78
837sheryoHigher in agricultural field at depths 100-300cm compared to 0-40cm, shaanxi, China ( high in depth 100-300cm compared to depth 0-40cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 81
373amnonhigher in soil of mature plants compared to seedlings ( high in late timepoints compared to seedling early timepoints in soil rhizosphere oryza sativa rice hunan province rice field china )2018-09-08v4No1 / 81
426amnoncommon soil, tundra, permafrost, russia, nenets autonomous okrug2018-12-08v4No1 / 81
820naHigher in 45-5cm depth compared to 75-105cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 45-75cm compared to depth (soil) 75-105cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v1No1 / 83
298amnonhigher in wetted soil 18hrs compared to dried soil ( high in irrigated compared to dry in soil desert united states of america state of utah depth 1cm soil crust )2018-02-20v4No1 / 83
600sheryoIncearses after 12 days of biochar ammendment in soil ( high in day 12 compared to day 1 in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 biochar )2020-03-27v4No1 / 86
402amnoncommon sediment, soil, mine tailing, alkaline mine tailing, guangxi zhuang autonomous region, zone 1, china2018-11-18v4No1 / 87
893amnonlower in soil fertilized with composted manure compared to soil fertilized with manure ( high in animal manure compared to composted animal manure in raphanus sativus greenhouse radish commonwealth of virginia rhizosphere fertilized soil research facility united states of america )2022-04-11v4No1 / 88
854sheryoHigher at soil depth of 200-250cm compared to soil depth of 275-325cm of colluvial soil, Czech rebuplic ( high in depth 200-250cm compared to depth 275-325cm in calcic chernozem colluvial soil ph 8 south moravian region czech republic soil )2021-12-23v3No1 / 90
527amnoncommon soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, robertskollen2019-07-14v4No1 / 91
855sheryoHigher in soil depth of 75cm compared to soil depth of 350cm in fertilized soil in china ( high in depth 175cm compared to depth 350cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 91
764sheryoHigh in rapeseed pre-crop compared to maize pre-crop leoss soil in wheat field grown under conventional tillage and crop rotation in germany ( high in brassica napus rapeseed pre-crop compared to maize pre-crop zea mays in soil germany bernburg loess chernozem conventional tillage mouldboard plough ph 7.6 triticum aestivum crop rotation )2021-04-12v3No1 / 91
769sheryoHigh in conventional tillage compared to no tillage in wheat field in northern israel ( high in conventional tillage compared to no tillage in bulk soil soil vertisol israel northen israel triticum aestivum )2021-04-18v4No1 / 91
480amnon high in ireland compared to new zealand in soil pasture farm ph 6-7 2019-02-05v4No1 / 94
837sheryoHigher in agricultural field at depths0-40cm compared to 40-100cm, shaanxi, China ( high in depth 0-40cm compared to depth 40-100cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 95
854sheryoHigher at soil depth of 125-175cm compared to soil depth of 200-250cm of colluvial soil, Czech rebuplic ( high in depth 125-175cm compared to depth 200-250cm in calcic chernozem colluvial soil ph 8 south moravian region czech republic soil )2021-12-23v3No1 / 96
989amnon high in low nutrient availability uphill compared to high nutrient availability downhill in depth (soil) 0-20cm cinnamomum camphora anxi county ph 4-5 farm china soil 2022-12-26v3No1 / 96
360amnon high in spring compared to summer in desert mexico state of california soil rhizosphere 2018-08-21v4No1 / 97
360amnoncommon desert, soil, rhizosphere, agave, mexico, guanajuato, agave tequiliana, cultivated environment2018-08-21v4No1 / 98
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 15-30cm compared to depth 30-45cm in dipsacus fullonum solidago apocynum daucus carota brunisol decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 98
855sheryoHigher in soil depth of 1000cm compared to soil depth of 800cm in fertilized soil in china ( high in depth (water) 1000m compared to depth 800cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 103
414amnon high in non-manured soil compared to manured soil in agricultural feature soil zea mays glycine max triticum aestivum heilongjiang province black soil mollisol china 2018-11-26v4No1 / 104
527amnoncommon soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, vassdalen2019-07-14v4No1 / 106
631sheryoHigher in maize field biochar amended rhizosphere soil compared to unamended rhizosphere soil ( high in biochar compared to unamended soil in rhizosphere china guizhou province kaiyang county soil maize field after 6 years )2020-06-02v3No1 / 108
271amnon high in root structure root compared to soil rhizosphere in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 110
855sheryoHigher in soil depth of 800cm compared to soil depth of 350cm in fertilized soil in china ( high in depth 800cm compared to depth 350cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 111
373amnon high in soil compared to rhizosphere in oryza sativa rice hunan province rice field china 2018-09-08v4No1 / 111
356amnonhigher in non-snow covered period ( high in non snow covered soil summer compared to snow snow covered soil winter in soil depth (soil) 0-10cm hokkaido topsoil ph 5.4 forest ecosystem japan )2018-08-15v4No1 / 113
792amnon high in rhizosphere nitraria tangutorum haloxylon ammodendron compared to soil in depth (soil) 20-60cm sand ph 9 minqin county depth (soil) 50cm desert china 2021-06-07v4No1 / 118
414amnon high in manured soil compared to non-manured soil in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 118
893amnonhigher in soil fertilized with composted manure compared to soil fertilized with manure ( high in composted animal manure compared to animal manure in raphanus sativus greenhouse radish commonwealth of virginia rhizosphere fertilized soil research facility united states of america )2022-04-11v4No1 / 122
1008amnon high in high npk fertilizer dose compared to low npk fertilizer dose in rhizosphere ph 7-8 jinxiang county garlic allium sativum fertilized soil farm china 2023-01-26v4No1 / 123
786sheryoHigher at 30-60cm depth compared to 60-100cm depth in flood plain soil near cosumnes river, california ( high in depth 30-60cm compared to depth 60-100cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-14v3No1 / 124
426amnon high in sand compared to mature soil in soil tundra permafrost russia nenets autonomous okrug 2018-12-08v4No1 / 125
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 150-200cm2018-07-15v4No1 / 126
100amnon high in ph 6-7 ph compared to ph<6 ph>7 in soil urban biome park new york city central park 2017-04-03v4No1 / 126
823sheryoHigher in 50-70cm depth compared to 70-100cm depth in ultisol soil in auburn, alabama ( high in depth 50-70cm compared to depth 70-100cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-08v3No1 / 127
855sheryoCommon in soil depth of 1000cm in fertilized soil in china (common depth 1000cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 127
263amnonhigher in soils irrigated with artificial wastewater compared to other methods ( high in artificial wastewater irrigation compared to tap water irrigation fertilized water irrigation treated wastewater irrigation in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 127
855sheryoHigher in soil depth of 800cm compared to soil depth of 1000cm in fertilized soil in china ( high in depth 800cm compared to depth 1000cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 128
783sheryohigher in desert soil in mongolia under no water addition treatment compared to soil with water addition ( high in no water addition ambient precipitation compared to water addition 100% above ambient precipitation in ph 7.85 luvic gypsisols cambic arenosols china mongolia dengkou county ulan buh desert bajada sandy desert soil )2021-05-11v4No1 / 130
462amnon high in soil compared to rhizosphere in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 131
609sheryohigher in soil with tobacco plants and with difenoconazole fungicide ( high in presence of tobacco plants compared to absence of tobacco plants in difenoconazole fungicide ph 7-8 china tobacco field limestone depth 0-20cm soil )2020-04-21v4No1 / 131
263amnonlower in soils irrigated with artificial wastewater compared to other methods ( high in tapwater irrigation fertilized water irrigation treated wastewater irrigation compared to artificial wastewater irrigation in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 134
823sheryoHigher in 50-70cm depth compared to 25-50cm depth in ultisol soil in auburn, alabama ( high in depth 50-70cm compared to depth (soil) 25-50cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 135
1008amnon high in low npk fertilizer dose compared to high npk fertilizer dose in china farm fertilized soil allium sativum garlic jinxiang county ph 7-8 rhizosphere 2023-01-26v4No1 / 135
762sheryoHigh in rhizosphere compared bulk soil to of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in rhizosphere compared to bulk soil in thyrow switzerland haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 139
628sheryoHigher in bulk soil with barley plants after 180 days in treatments amended with biochar ( high in biochar compared to unamended with biochar in bulk soil china zhejiang province quzhou county soil depth (soil) 15cm ph 4-5 hordeum vulgare days 180 mature barley plants )2020-05-18v4No1 / 140
893amnoncommon silty clay loam, raphanus sativus, greenhouse, radish, commonwealth of virginia, rhizosphere, fertilized soil, research facility, united states of america2022-04-11v4No1 / 140
171amnonhigher in rice rhizosphere soil compared to bulk soil (no rice) ( high in rhizosphere compared to soil in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 140
421amnonhigher in paddy field soil incubated with copper compared to controls ( high in copper compared to control in soil research facility zhejiang province paddy field soil china )2018-12-02v4No1 / 141
855sheryoCommon in soil depth of 800cm in fertilized soil in china (common depth 800cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 142
893amnoncommon sandy loam, raphanus sativus, greenhouse, radish, commonwealth of virginia, rhizosphere, fertilized soil, research facility, united states of america2022-04-11v4No1 / 142
788amnon high in plant litter compared to soil in mesocosm state of georgia united states of america 2021-05-31v4No1 / 143
662amnon high in irrigated compared to dry in neve yaar depth (soil) 0-10cm soil agricultural field israel 2020-09-21v3No1 / 146
837sheryoHigher at 100-300cm depth compared 40-100cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 100-300cm compared to depth 40-100cm in robinia pseudoacacia 10 years reforestation silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 154
512amnon high in depth (soil) 60cm compared to depth (soil) 10 cm depth (soil) 0-20cm in fen peatland peat soil soil china 2019-03-22v4No1 / 155
402amnoncommon sediment, soil, mine tailing, alkaline mine tailing, guangxi zhuang autonomous region, zone 2,3, china2018-11-18v4No1 / 159
820naHigher in 75-105cm depth compared to 45-75cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 75-105cm compared to depth (soil) 45-75cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v1No1 / 159
823sheryoHigher in 25-50cm depth compared to 50-70cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 25-50cm compared to depth 50-70cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 161
600sheryolower in biochar ammendment soil ( high in unamended compared to biochar in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 166
357amnoncommon in moist tropical forest topsoil around the world (common soil, topsoil, depth (soil) 0-10cm, moist tropical forest, woodland area, forest ecosystem)2018-08-18v4No1 / 171
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth 100-150cm2018-07-15v4No1 / 173
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 0-15cm in an old growth forest in Ontario, Canada ( high in depth 15-30cm compared to depth 0-15cm in old growth forest luvisol grand river watershed rare charitable research reserve quercus velutina quercus alba quercus rubra acer saccharum acer saccharum subsp. nigrum fagus grandifolia cambridge forest forested area province of ontario canada soil )2021-11-14v3No1 / 173
855sheryoCommon in soil depth of 175cm in fertilized soil in china (common depth 175cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 173
764sheryoHigh in maize pre-crop compared to rapeseed pre-crop leoss soil in wheat field grown under conventional tillage and crop rotation in germany ( high in maize pre-crop zea mays compared to brassica napus rapeseed pre-crop in soil germany bernburg loess chernozem conventional tillage mouldboard plough ph 7.6 triticum aestivum crop rotation )2021-04-12v3No1 / 173
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol compared to npk fertilized from Germany ( high in manure fertilization manured soil organic fertilization compared to mineral fertilization npk fertilization in germany soil bulk soil thyrow albic luvisol ph 6.4 lettuce pot expreiment )2021-04-07v3No1 / 176
842sheryoCommon in soil depth of 15-30cm in a mature forest in Ontario, Canada (common depth 15-30cm, forest, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus velutina, quercus alba, quercus rubra, mature forest, forested area, brunisol, soil, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 182
842sheryoHigher in soil depth of 30-45cm compared to soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 30-45cm compared to depth 15-30cm in luvisol dipsacus fullonum solidago apocynum daucus carota decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 185
883amnoncommon oil contaminated soil, oilfield, yellow river delta, china, shengli oilfield, soil2022-03-20v4No1 / 187
631sheryoHigher in maize field biochar amended bulk soil, after 6 years of biochar amended, compared to unamended soil ( high in biochar compared to unamended soil in china guizhou province kaiyang county soil maize field bulk soil after 6 years )2020-06-02v3No1 / 188
402amnon high in zone 1 compared to zone 2,3 in sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region china 2018-11-18v4No1 / 189
628sheryoHigher in rhizosphere of barley roots after 180 days in treatments unamended with biochar ( high in unamended with biochar compared to biochar in china zhejiang province quzhou county soil depth (soil) 15cm ph 4-5 hordeum vulgare rhizosphere days 180 mature barley plants )2020-05-18v4No1 / 190
786sheryoHigher at 133-166cm depth compared to 60-100cm depth in flood plain soil near cosumnes river, california ( high in depth 133-166cm compared to depth 60-100cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-14v3No1 / 191
156amnonlower in soil and rhizosphere supplemented with struvite ( high in control compared to struvite in soil rhizosphere brassica brassica oleracea china )2017-07-27v4No1 / 191
600sheryoIncearses after 12 days of stover ammendment in soil ( high in day 12 compared to day 1 in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 196
316amnoncommon united states of america, soil, topsoil, state of ohio, depth (soil) 0-10cm, ph 5, forest ecosystem2018-04-10v4No1 / 199
989amnon high in high nutrient availability downhill compared to low nutrient availability uphill in soil china farm ph 4-5 anxi county cinnamomum camphora depth (soil) 0-20cm 2022-12-26v3No1 / 199
527amnoncommon soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, brugdedalen2019-07-14v4No1 / 200
375amnonlower in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in control compared to rhizosphere planted soil in soil kuwait desert oil contaminated soil )2018-09-09v4No1 / 200
761sheryoHigher in maize rhizosphere compared to bulk soil in sandy soil maize field in Germany ( high in rhizosphere compared to bulk soil in ph 5 lower saxony sandy soil germany maize field )2021-04-06v3No1 / 200
631sheryoHigher in maize field unamended bulk soil, after 6 years of biochar amended, compared to biochar amended soil ( high in unamended soil compared to biochar in china guizhou province kaiyang county soil maize field bulk soil after 6 years )2020-06-02v3No1 / 201
791sheryoHigh at 80cm depth compared to 0cm depth in highly saline sodic soil in China ( high in depth (soil) 80cm compared to depth (soil) 0-20cm depth 0cm in high salinity high sodicity soil salic solonetz da'an station china songnen plain )2021-06-07v4No1 / 203
298amnonlower in wetted soil 18hrs compared to dried soil ( high in dry compared to irrigated in soil desert united states of america state of utah depth 1cm soil crust )2018-02-20v4No1 / 205
783sheryohigher in desert soil in mongolia under water addition treatment compared to soil without water addition ( high in 100% above ambient precipitation water addition compared to no water addition ambient precipitation in ph 7.85 luvic gypsisols cambic arenosols china mongolia dengkou county ulan buh desert bajada sandy desert soil )2021-05-11v4No1 / 206
786sheryoHigher at 166-200cm depth compared to 400-700cm depth in flood plain soil near cosumnes river, california ( high in depth 166-200cm compared to depth 400-700cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 206
755sheryocommon in wild soybean (Glycine soja) rhizosphere (common ph 7, jilin province, rhizosphere, soil, black soil, china, glycine soja)2021-03-18v3No1 / 210
421amnonlower in paddy field soil incubated with copper compared to controls ( high in control compared to copper in soil research facility zhejiang province paddy field soil china )2018-12-02v4No1 / 212
360amnon high in summer compared to spring in desert mexico state of california soil rhizosphere 2018-08-21v4No1 / 214
855sheryoHigher in soil depth of 350cm compared to soil depth of 75cm in fertilized soil in china ( high in depth 350cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 217
347amnon high in depth 100-150cm depth 150-200cm compared to depth (soil) 20-30cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 221
129amnon high in soil compared to rhizosphere in ph 6-6.5 mexico myrtillocactus geometrizans opuntia robusta cactus semi-arid 2017-04-15v4No1 / 221
762sheryoHigh in rhizosphere compared to bulk soil of a pot experiment with lettuce planted in albic luvisol Germany ( high in rhizosphere compared to bulk soil in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 226
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common depth 30-45cm, mature forest, brunisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 227
426amnon high in site 2 compared to site 1 in soil tundra permafrost russia nenets autonomous okrug 2018-12-08v4No1 / 228
824sheryoHigher in soil at 0-10cm depth after 0-9 years compared to after 27-35 years of grazing exclusion, Ningxia china ( high in 0-9 years of grazing exclusion compared to 27-35 years of grazing exclusion in depth (soil) 0-10cm yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 230
583amnoncommon soil, mountain, switzerland, ph 4-6, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, rhone river valley2020-01-27v3No1 / 234
755sheryocommon in domesticated soybean (Glycine max) rhizosphere (common glycine max, china, black soil, soil, rhizosphere, jilin province, ph 7)2021-03-18v3No1 / 234
279amnoncommon grassland, steppe, mongolia, soil, china2018-01-24v4No1 / 235
837sheryoHigher at 40-100cm depth compared to 0-40cm in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 40-100cm compared to depth 0-40cm in robinia pseudoacacia 10 years reforestation silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 239
855sheryoCommon in soil depth of 350cm in fertilized soil in china (common depth 350cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 242
854sheryoHigher at soil depth of 125-175cm compared to soil depth of 25-100cm of colluvial soil, Czech rebuplic ( high in depth 125-175cm compared to depth 25-100cm in calcic chernozem colluvial soil ph 8 south moravian region czech republic soil )2021-12-23v3No1 / 243
628sheryoHigher in rhizosphere of barley roots after 180 days in treatments amended with biochar ( high in biochar compared to unamended with biochar in china zhejiang province quzhou county soil depth (soil) 15cm ph 4-5 hordeum vulgare rhizosphere days 180 mature barley plants )2020-05-18v4No1 / 243
824sheryoHigher soil at 40-60cm depth after 0-9 years compared to 27-35 years after of grazing exclusion, Ningxia china ( high in 0-9 years of grazing exclusion compared to 27-35 years of grazing exclusion in depth 40-60cm yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 247
829sheryoHigher soil depth of 56-140cm compared to soil depth 0-56cm in Mollisol soil, Dekalb, Illinois, united states of america ( high in depth 56-140 compared to depth 0-56 in dekalb county illinois state of illinois mollisol silt loam soil united states of america )2021-08-26v3No1 / 249
101amnon high in soil compared to rhizosphere in state of new york vitis vinifera united states of america merlot grapevine 2017-04-03v4No1 / 249
837sheryoHigher at 100-300cm depth compared 0-40cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 100-300cm compared to depth 0-40cm in robinia pseudoacacia 10 years reforestation silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 250
375amnonhigher in oil contaminated soil planted with plants compared to control oil contaminated soil ( high in rhizosphere planted soil compared to control in soil kuwait desert oil contaminated soil )2018-09-09v4No1 / 251
600sheryohigher in biochar ammendment soil ( high in biochar compared to unamended in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 252
767sheryoHigh in control treatment soil with high fusarium indices compared to soil with low fusarium indices planted with Chrysanthemum in Nanjing China ( high in fusarium high fusarium cumulative disease incidence compared to conventional tillage paenibacillus paenibacillus polymyxa compost soil bio-organic fertilizer soil fumigation dazomet deep plough low fusarium cumulative disease incidence in soil ph 6.9 chrysanthemum morifolium ramat. chrysanthemum china nanjing county )2021-04-18v4No1 / 252
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 15-30cm compared to depth 30-45cm in luvisol dipsacus fullonum solidago apocynum daucus carota decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 253
279amnoncommon grassland, soil, alpine soil, tibetan plateau, china2018-01-24v4No1 / 253
282amnoncommon soil, mangrove swamp, mangrove, united states of america, state of florida, avicennia germinans, rhizophora mangle2018-01-25v4No1 / 259
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common mature forest, brunisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 261
415amnonlower in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in mediterranean semi-arid compared to subtropical in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 264
746sheryoHigh in saline soil fertilized with chemical fertilizer compared to biological fertilizer, planted with tomatos, in dafeng, china ( high in chemical fertilization n,p,k compared to trichoderma guizhouense njau 4742 chicken manure biological fertilization in saline soil solonchak china dafeng city jiangsu province ph 7.5 solanum lycopersicum )2021-03-03v4No1 / 269
752sheryoHigher in treatments without biochar compared to treatments with biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in without biochar compared to biochar in panax notoginseng sanqi plants ph 6 xundian county yunnan province china pot expreiment soil )2021-03-11v3No1 / 273
527amnoncommon soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, lorentzenpiggen2019-07-14v4No1 / 280
259amnonhigher in fertilized soil (npk) compared to non-fertilized ( high in fertilized soil compared to non-fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 280
357amnon high in ph<4 compared to ph>4 in soil topsoil depth (soil) 0-10cm southern temperate forest temperate broadleaf and mixed forest biome woodland area forest ecosystem 2018-08-19v4No1 / 282
823sheryoHigher in 25-50cm depth compared to 10-25cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 25-50cm compared to depth (soil) 10-25cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 283
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common thyrow, switzerland, haplic luvisol, mineral fertilization, pot expreiment, lettuce, soil, rhizosphere, npk fertilization)2021-04-08v3No1 / 286
824sheryoHigher in soil at 0-10cm depth after 27-35 years compared to after 0-9 years of grazing exclusion, Ningxia china ( high in 27-35 years of grazing exclusion compared to 0-9 years of grazing exclusion in depth (soil) 0-10cm yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 294
761sheryoHigher in bulk soil compared to maize rhizosphere in sandy soil maize field in Germany ( high in bulk soil compared to rhizosphere in ph 5 lower saxony sandy soil germany maize field )2021-04-06v3No1 / 294
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in organic fertilized compared to npk fertilized haplic luvisol Switzerland ( high in manured soil manure fertilization bio-dynamic fertilizer organic fertilization compared to npk fertilization mineral fertilization in therwil switzerland haplic luvisol soil bulk soil lettuce pot expreiment )2021-04-07v3No1 / 294
357amnon high in ph<3 compared to ph>3 in soil topsoil depth (soil) 0-10cm subpolar coniferous forest biome boreal forest woodland area forest ecosystem 2018-08-19v4No1 / 297
237amnonlower in burrow soil compared to bird ( high in oceanodroma leucorhoa bird seabird compared to soil burrow in canada bon portage island )2017-11-07v4No1 / 298
824sheryoHigher soil at 40-60cm depth after 27-35 years compared to after 0-9 years of grazing exclusion, Ningxia china ( high in 27-35 years of grazing exclusion compared to 0-9 years of grazing exclusion in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 299
786sheryoHigher at 60-100cm depth compared to 133-166cm depth in flood plain soil near cosumnes river, california ( high in depth 60-100cm compared to depth 133-166cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-14v3No1 / 300
751sheryoCommon in tomato soil infected with Fusarium oxysporum (common china, shandong province, luojiazhuang, fusarium oxysporum, solanum lycopersicum, soil)2021-03-11v3No1 / 305
615amnon high in soil compared to rhizosphere in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 306
828sheryoHigher at 0-20cm depth compared to 20-40cm depth in gleysol soil of poplar plantation, sihong, china ( high in depth (soil) 0-20cm compared to depth 20-40cm in ph 6-7 clay loam gleysol china jiangsu province sihong county chenwei forest soil poplar plantation poplar )2021-08-25v4No1 / 312
298amnonhigher in mature soil crust ( high in mature crust compared to non mature crust in soil desert united states of america state of utah depth 1cm soil crust )2018-02-20v4No1 / 316
752sheryoHigher in treatments with biochar compared to treatments without biochar in soil planted with Panax notoginseng amended with 2% biochar ( high in biochar compared to without biochar in panax notoginseng sanqi plants ph 6 xundian county yunnan province china pot expreiment soil )2021-03-11v3No1 / 317
801sheryoHigher at depth 60-90cm compared to depth 0-15cm in corn and soybean agriculture fields, Iowa USA ( high in depth (soil) 60-90cm compared to depth (soil) 0-15cm in subsurface drainage glycine max kelley nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-16v4No1 / 321
828sheryoHigher at 20-40cm depth compared to 0-20cm depth in gleysol soil of poplar plantation, sihong, china ( high in depth 20-40cm compared to depth (soil) 0-10cm in ph 6-7 clay loam gleysol china jiangsu province sihong county chenwei forest soil poplar plantation poplar )2021-08-25v4No1 / 321
402amnon high in zone 2,3 compared to zone 1 in sediment soil mine tailing alkaline mine tailing guangxi zhuang autonomous region china 2018-11-18v4No1 / 322
628sheryoHigher in bulk soil with barley plants after 180 days in treatments unamended with biochar ( high in unamended with biochar compared to biochar in bulk soil china zhejiang province quzhou county soil depth (soil) 15cm ph 4-5 hordeum vulgare days 180 mature barley plants )2020-05-18v4No1 / 327
512amnoncommon fen, peatland, peat soil, soil, hani peatland, baekdudaegan, ph 5-6, china2019-03-22v4No1 / 329
855sheryoHigher in soil depth of 175cm compared to soil depth of 75cm in fertilized soil in china ( high in depth 175cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 334
837sheryoHigher at 40-100cm depth compared 100-300cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 40-100cm compared to depth 100-300cm in robinia pseudoacacia 10 years reforestation silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 336
175amnonhigher in winter compared to summer in heavy metal contaminated soils in china ( high in winter compared to summer in soil heavy metal china )2017-07-29v4No1 / 337
750sheryoCommon in soil of wheat field in China (common fluvo-aquic soil, ph 7.6, hebei province, luancheng county, china, triticum aestivum, soil)2021-03-11v3No1 / 337
762sheryoHigher in bulk soil of a pot experiment with lettuce planted in npk fertilized compared to organic fertilized haplic luvisol Switzerland ( high in npk fertilization mineral fertilization compared to organic fertilization bio-dynamic fertilizer manure fertilization manured soil in therwil switzerland haplic luvisol soil bulk soil lettuce pot expreiment )2021-04-07v3No1 / 347
767sheryoHigh in conservation tillage compared to conventional tillage soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' in Nanjing China ( high in conservation tillage compared to deep plough conventional tillage in dazomet soil fumigation soil ph 6.9 chrysanthemum morifolium ramat. chrysanthemum china nanjing county bio-organic fertilizer compost biofilter paenibacillus polymyxa paenibacillus compost soil pig manure )2021-04-18v4No1 / 350
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in npk fertilized albic luvisol Germany (common pot expreiment, lettuce, soil, rhizosphere, germany, thyrow, albic luvisol, mineral fertilization, npk fertilization)2021-04-08v3No1 / 353
767sheryoHigh in conventional tillage compared to conservation tillage soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' in Nanjing China ( high in deep plough conventional tillage compared to conservation tillage in dazomet soil fumigation soil ph 6.9 chrysanthemum morifolium ramat. chrysanthemum china nanjing county bio-organic fertilizer compost biofilter paenibacillus polymyxa paenibacillus compost soil pig manure )2021-04-18v4No1 / 355
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, siliceous parent material, ph 4.5-7, canton of graubunden2020-01-27v3No1 / 359
762sheryoCommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized albic luvisol Germany (common organic fertilization, manure fertilization, manured soil, albic luvisol, thyrow, germany, rhizosphere, soil, lettuce, pot expreiment)2021-04-08v3No1 / 359
767sheryoHigh in soil with low fusarium indices compared to control treatment soil with high fusarium indices planted with Chrysanthemum in Nanjing China ( high in low fusarium cumulative disease incidence conventional tillage deep plough dazomet soil fumigation bio-organic fertilizer paenibacillus polymyxa paenibacillus compost soil pig manure compared to control high fusarium cumulative disease incidence in soil ph 6.9 chrysanthemum morifolium ramat. chrysanthemum china nanjing county )2021-04-18v4No1 / 360
512amnon high in hani peatland baekdudaegan ph 5-6 compared to riganqiao peatland tibetan plateau ph 5.5-6.5 in fen peatland peat soil soil china 2019-03-22v4No1 / 363
527amnoncommon soil, antarctica, east antarctica, nunatak, valterkulten, depth (soil) 2cm2019-07-14v4No1 / 364
527amnoncommon soil, antarctica, east antarctica, nunatak, depth (soil) 2cm, grunehogna2019-07-14v4No1 / 367
801sheryoHigher at depth 60-90cm compared to depth 0-15cm in corn agriculture fields, Iowa USA ( high in depth (soil) 60-90cm compared to depth (soil) 0-15cm in kanawha nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-15v4No1 / 369
791sheryoCommon in highly saline sodic soil at8 80cm depth in China (common depth (soil) 80cm, ph 10, high salinity, high sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 377
798amnon high in hay litter bag plant litter compared to ph 7-8 soil in depth (soil) 10 cm depth (soil) 0-20cm orchard apricot prunus armeniaca apennine mountains italy 2021-06-13v3No1 / 377
426amnon high in mature soil compared to sand in soil tundra permafrost russia nenets autonomous okrug 2018-12-08v4No1 / 377
512amnon high in tibetan plateau riganqiao peatland ph 5.5-6.5 compared to hani peatland baekdudaegan ph 5-6 in fen peatland peat soil soil china 2019-03-22v4No1 / 381
801sheryoHigher at depth 60-90cm compared to depth0-15cm in soybean and corn agriculture fields , Iowa USA ( high in depth (soil) 60-90cm compared to depth (soil) 0-15cm in united states nicollet soil series glycine max zea mays ames des moines iowa agricultural field soil )2021-06-15v4No1 / 386
813amnonhigher in epiphytic materiall attached to intact branch compared to severed suspended branch ( high in intact branch compared to severed branch in epiphytic material united states of america state of washington olympic national park canopy soil soil )2021-06-22v4No1 / 390
842sheryoCommon in soil depth of 30-45cm in an old growth forest in Ontario, Canada (common depth 30-45cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 390
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common depth 30-45cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 393
412amnonhigh in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in manured soil compared to non-manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 395
147amnoncommon soil, siberia, peatland, ph 4.5, lichen, moss2017-04-20v4No1 / 396
259amnonlower in manured soil compared to non-manured ( high in non-manured soil compared to manured soil in soil rhizosphere ph 5 arachis hypogaea peanut fertilized soil china )2017-12-02v4No1 / 397
662amnoncommon clay soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 402
263amnonhigher in heat stressed soil (65C) compared to control ( high in heat stressed soil compared to control in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 402
791sheryoHigher in high sodicity and high salinity soil compared to low sodicity and low salinity soil at 80cm depth in China ( high in ph 10 high sodicity high salinity compared to ph 9 low sodicity low salinity in depth (soil) 80cm soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 404
883amnon high in oilfield oil contaminated soil compared to non-contaminated soil in yellow river delta shengli oilfield china soil 2022-03-20v4No1 / 404
347amnoncommon depth (soil) 0-20cm, kingdom of norway, svalbard archipelago, permafrost, soil, permafrost active layer2018-07-15v4No1 / 405
755sheryocommon in domesticated rice (Oryza stavia) rhizosphere (common oryza sativa, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 415
147amnoncommon pinus sibirica, tundra, soil, pine forest, ph 4, siberia, forest ecosystem2017-04-20v4No1 / 416
855sheryoHigher in soil depth of 350cm compared to soil depth of 800cm in fertilized soil in china ( high in depth 350cm compared to depth 800cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 418
829sheryohigher soil depth of 12-44cm compared to 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 12-44cm compared to depth 44-108cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 428
837sheryoHigher in agricultural field at depths 0-40cm compared to 100-300cm, shaanxi, China ( high in depth 0-40cm compared to depth 100-300cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 431
792amnon high in soil compared to haloxylon ammodendron nitraria tangutorum rhizosphere in depth (soil) 20-60cm sand ph 9 minqin county depth (soil) 50cm desert china 2021-06-07v4No1 / 432
360amnoncommon desert, soil, rhizosphere, agave, agave deserti, state of california2018-08-21v4No1 / 432
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 15-30cm compared to depth 0-15cm in dipsacus fullonum solidago apocynum daucus carota brunisol decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 432
842sheryoCommon in soil depth of 15-30cm in a mature forest in Ontario, Canada (common depth 15-30cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 433
360amnoncommon desert, soil, mexico, guanajuato2018-08-21v4No1 / 437
412amnonlower in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in non-manured soil compared to manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 437
135amnoncommon soil, tundra, alaska, permafrost, depth (soil) 15cm2017-04-17v4No1 / 438
829sheryohigher soil depth of 44-108cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 44-108cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 442
989amnon high in soil compared to rhizosphere in china farm ph 4-5 anxi county cinnamomum camphora depth (soil) 0-20cm 2022-12-26v3No1 / 448
823sheryoHigher in 10-25cm depth compared to 25-50cm depth in ultisol soil in auburn, alabama ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in alabama auburn upland soil ultisol agricultural field soil )2021-08-07v3No1 / 455
762sheryocommon in rhizosphere soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common bio-dynamic fertilizer, manured soil, manure fertilization, organic fertilization, thyrow, switzerland, haplic luvisol, pot expreiment, lettuce, soil, rhizosphere)2021-04-08v3No1 / 455
415amnonhigher in citrus from humid subtropical compared to mediterranean and semi-arid climate ( high in subtropical compared to mediterranean semi-arid in rhizosphere soil citrus orchard cultivated environment )2018-11-27v4No1 / 458
823sheryoCommon at 70-100cm depth in ultisol soil in auburn, alabama (common depth 70-100cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 459
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common depth 0-15cm, luvisol, mature forest, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 460
964amnoncommon stratovolcano, ph 4-5, soil, depth (soil) 10-25cm, ecuador, volcan sumaco2022-12-21v3No1 / 472
357amnoncommon soil, topsoil, depth (soil) 0-10cm, woodland area, forest ecosystem2018-08-19v4No1 / 474
813amnoncommon intact branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 475
347amnon high in depth (soil) 0-20cm permafrost transition layer compared to depth (soil) 20-30cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 477
298amnonhigher in non-mature soil crust ( high in non mature crust compared to mature crust in soil desert united states of america state of utah depth 1cm soil crust )2018-02-20v4No1 / 480
786sheryoCommon in flood plain soil near cosumnes river, california, at 400-700cm depth (common depth (soil) 400-700cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 481
259amnonlower in fertilized soil (npk) compared to non-fertilized ( high in non-fertilized soil compared to fertilized soil in soil rhizosphere ph 5 arachis hypogaea peanut china )2017-12-02v4No1 / 483
512amnoncommon fen, peatland, peat soil, soil, ph 5.5-6.5, tibetan plateau, riganqiao peatland, china2019-03-22v4No1 / 483
360amnoncommon desert, soil, rhizosphere, agave, agave salmiana, mexico, guanajuato2018-08-21v4No1 / 484
662amnoncommon loam soil, loam, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-21v3No1 / 489
375amnoncommon in oil contaminated desert soil (common soil, kuwait, desert, oil contaminated soil)2018-09-09v4No1 / 490
829sheryoCommon in soil depth of 56-116cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 56-116cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 491
415amnoncommon rhizosphere, soil, citrus, orchard, united states of america, cultivated environment2018-11-27v4No1 / 494
791sheryoHigh at 0cm depth compared to 80cm depth in highly saline sodic soil in China ( high in depth (soil) 0-20cm depth 0cm compared to depth (soil) 80cm in high salinity high sodicity soil salic solonetz da'an station china songnen plain )2021-06-07v4No1 / 496
259amnonhigher in manured soil compared to non-manured ( high in manured soil compared to non-manured in soil rhizosphere ph 5 arachis hypogaea peanut fertilized soil china )2017-12-02v4No1 / 497
357amnoncommon soil, topsoil, depth (soil) 0-10cm, southern temperate forest, temperate broadleaf and mixed forest biome, woodland area, forest ecosystem2018-08-19v4No1 / 499
360amnoncommon desert, soil, mexico, guanajuato, cultivated environment2018-08-21v4No1 / 500
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in kanawha nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-15v4No1 / 501
373amnoncommon soil, rhizosphere, oryza sativa, rice, hunan province, rice field, china2018-09-08v4No1 / 501
616amnon high in ph 6.7 non-fertilized soil compared to ph 5.5-6 fertilized soil in depth (soil) 0-20cm sugarcane saccharum soil topsoil china guangzhou city prefecture 2020-04-27v3No1 / 504
842sheryoCommon in soil depth of 15-30cm in an old growth forest in Ontario, Canada (common depth 15-30cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 507
829sheryoCommon in soil depth of 116-140cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 116-140cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 516
824sheryoHigher at 40-60cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 40-60cm compared to depth 20-40cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 520
755sheryocommon in wild rice (Oryza rufipogon) rhizosphere (common oryza rufipogon, ph 7, jilin province, rhizosphere, soil, black soil, china)2021-03-18v3No1 / 530
762sheryocommin in bulk soil of a pot experiment with lettuce planted in npk fertilzed albic luvisol from Germany (common mineral fertilization, npk fertilization, germany, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 531
357amnoncommon soil, topsoil, depth (soil) 0-10cm, subpolar coniferous forest biome, boreal forest, woodland area, forest ecosystem2018-08-19v4No1 / 538
823sheryoHigher at 50-90cm depth compared to 15-30cm depth in foot slope ultisol soil in auburn, alabama ( high in depth 50-90cm compared to depth (soil) 15-30cm in foot slope alabama auburn ultisol agricultural field soil )2021-08-08v3No1 / 539
821sheryoHigher at 50-100cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth 50-100m compared to depth (soil) 25-50cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 543
357amnoncommon soil, topsoil, depth (soil) 0-10cm, mediterranean forest biome, forest ecosystem, woodland area2018-08-19v4No1 / 564
600sheryohigher in stover ammendment soil ( high in stover amended soil compared to unamended soil in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 567
667amnoncommon depth (soil) 0-20cm, ph 4.5, elevation 500-600m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 575
762sheryoHigh in bulk soil comparedc to rhizosphere of a pot experiment with lettuce planted in haplic luvisol Switzerland ( high in bulk soil compared to rhizosphere in thyrow switzerland haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 577
762sheryoHigh in bulk soil compared to rhizosphere of a pot experiment with lettuce planted in albic luvisol Germany ( high in bulk soil compared to rhizosphere in thyrow albic luvisol germany haplic luvisol pot expreiment lettuce soil )2021-04-08v3No1 / 578
893amnon high in sandy loam compared to silty clay loam in raphanus sativus greenhouse radish commonwealth of virginia rhizosphere fertilized soil research facility united states of america 2022-04-11v4No1 / 582
788amnon high in cherokia georgiana georgiana millipede feces compared to soil in mesocosm state of georgia united states of america 2021-05-31v4No1 / 589
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 590
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 20cm, wetland area2017-03-06v4No1 / 590
357amnoncommon soil, topsoil, depth (soil) 0-10cm, montane forest, woodland area, forest ecosystem2018-08-19v4No1 / 592
360amnon high in rhizosphere agave compared to soil in desert mexico state of california 2018-08-21v4No1 / 593
792amnoncommon depth (soil) 20-60cm, sand, ph 9, minqin county, depth (soil) 50cm, soil, desert, china2021-06-07v4No1 / 595
791sheryoCommon in highly saline sodic soil at 20cm depth in China (common ph 10.5, depth 20cm, high salinity, high sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 596
801sheryoCommon at depth 15-30cm in corn agriculture fields, Iowa USA (common kanawha, depth (soil) 15-30cm, nicollet soil series, ph 7.7, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 598
842sheryoHigher in soil depth 15-30cm compared soil depth of 0-15cm to in a zea mays agricultural field in Ontario, Canada ( high in depth 15-30cm compared to depth 0-15cm in zea mays preston flats agricultural field soil luvisol grand river watershed canada province of ontario cambridge rare charitable research reserve )2021-11-14v3No1 / 598
415amnoncommon rhizosphere, soil, citrus, orchard, south africa, cultivated environment2018-11-27v4No1 / 600
842sheryoHigher in soil depth of 0-15cm compared soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in dipsacus fullonum solidago apocynum daucus carota brunisol decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 601
444amnonhigher in continuously cropped strawberry soil ( high in continuous cropping age 5 years age 10 years compared to age 1 year in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 602
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized haplic luvisol Switzerland (common ph 6.6, manured soil, manure fertilization, organic fertilization, bio-dynamic fertilizer, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 602
893amnon high in silty clay loam compared to sandy loam in research facility greenhouse raphanus sativus radish fertilized soil commonwealth of virginia united states of america rhizosphere 2022-04-11v4No1 / 605
662amnoncommon loamy sand soil, irrigated, neve yaar, depth (soil) 0-10cm, soil, agricultural field, israel2020-09-22v3No1 / 609
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil soilwater water in canada province of quebec )2017-12-11v4No1 / 610
667amnoncommon depth (soil) 0-20cm, jiangxi province, lushan mountain, china, forested area, ph 4.5, elevation 200-300m, topsoil, soil2020-09-25v4No1 / 613
357amnoncommon soil, topsoil, depth (soil) 0-10cm, savanna, forest ecosystem, woodland area2018-08-19v4No1 / 614
791sheryoCommon in highly saline sodic soil at 40cm depth in China (common depth (soil) 40cm, ph 10.5, high salinity, high sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 618
823sheryoCommon at 50-70cm depth in ultisol soil in auburn, alabama (common depth 50-70cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 620
786sheryoHigher at 0-30cm depth compared to 30-60cm depth in flood plain soil near cosumnes river, california ( high in depth (soil) 0-30 cm depth (soil) 0-20cm compared to depth 30-60cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 627
883amnon high in depth (soil) 60-100cm compared to depth (soil) 0-20cm in oilfield yellow river delta china shengli oilfield oil contaminated soil soil 2022-03-20v4No1 / 627
667amnoncommon depth (soil) 0-20cm, coniferous forest biome, ph 4-4.5, elevation 1000-1100m, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 630
829sheryoHigher in soil depth of 0-56cm compared to soil depth of 56-140cm in Mollisol soil, Dekalb, Illinois, united states of america ( high in depth 0-56 compared to depth 56-140 in united states of america soil silt loam mollisol state of illinois illinois dekalb county )2021-08-26v3No1 / 631
813amnoncommon severed branch, epiphytic material, united states of america, state of washington, olympic national park, canopy soil, soil2021-06-22v4No1 / 633
609sheryoCommon in soil with tobacco plants amended with difenoconazole fungicide and biochar (common biochar, tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 634
360amnoncommon desert, soil, state of california2018-08-21v4No1 / 637
237amnoncommon in burrow soil of seabird (common bird, oceanodroma leucorhoa, seabird, canada, bon portage island, burrow, soil)2017-11-07v4No1 / 638
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
791sheryoCommon in highly saline sodic soil at 0cm depth in China (common depth (soil) 0-20cm, ph 10.5, high salinity, high sodicity, depth 0cm, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 648
820naCommon in upper subsoil, 45-75cm depth, wheat rhizosphere haplic luvisol in germany (common silty clay loam, ph 6.9, depth (soil) 45-75cm, triticum aestivum, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 648
616amnon high in ph 5.5-6 fertilized soil compared to ph 6.7 non-fertilized soil in depth (soil) 0-20cm sugarcane saccharum soil topsoil china guangzhou city prefecture 2020-04-27v3No1 / 648
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in npk fertilized haplic luvisol Switzerland (common npk fertilization, mineral fertilization, ph 5.6, therwil, switzerland, haplic luvisol, soil, bulk soil, lettuce, pot expreiment)2021-04-07v3No1 / 648
801sheryoCommon in soybean and corn agriculture fields at depth 60-90cm, Iowa USA (common ph 7.7, depth (soil) 60-90cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 650
823sheryoCommon at 25-50cm depth in ultisol soil in auburn, alabama (common depth (soil) 25-50cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 652
842sheryoHigher in soil depth of 0-15cm compared to soil depth of 15-30cm in an old growth forest in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in old growth forest luvisol grand river watershed rare charitable research reserve quercus velutina quercus alba quercus rubra acer saccharum acer saccharum subsp. nigrum fagus grandifolia cambridge forest forested area province of ontario canada soil )2021-11-14v3No1 / 653
175amnonhigher in summer compared to winter in heavy metal contaminated soils in china ( high in summer compared to winter in soil heavy metal china )2017-07-29v4No1 / 658
462amnon high in depth 30-75cm depth (soil) 20-60cm silt clay loam compared to depth (soil) 0-30 cm depth (soil) 0-20cm silt loam in soil united states of america state of tennessee cultivated environment 2019-01-12v4No1 / 665
801sheryoCommon at depth 60-90cm in corn and soybean agriculture fields, Iowa USA (common depth (soil) 60-90cm, ph 7.9, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-16v4No1 / 667
791sheryoHigher in high sodicity and high salinity soil compared to low sodicity and low salinity soil at 0cm depth in China ( high in ph 10.5 high sodicity high salinity compared to ph 8.5 low sodicity low salinity in depth (soil) 0-20cm depth 0cm soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 670
609sheryocommon in soil with tobacco plants amended with difenoconazole fungicide (common tobacco plant present, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-04-21v4No1 / 671
791sheryoHigher at 80cm depth compared to 0cm depth in low saline low sodicity soil in China ( high in depth (soil) 80cm compared to depth (soil) 0-20cm depth 0cm in ph 9 low salinity low sodicity soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 675
786sheryoHigher at 30-60cm depth compared to 0-30cm depth in flood plain soil near cosumnes river, california ( high in depth 30-60cm compared to depth (soil) 0-30 cm depth (soil) 0-20cm in flood plain soil united states of america state of california sacramento cosumnes river preserve )2021-09-13v3No1 / 675
842sheryoCommon in soil depth of 30-45cm in a zea mays agricultural field in Ontario, Canada (common depth 30-45cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 676
237amnonhigher deep in burrow compared to burrow entrance ( high in deep burrow compared to surface burrow in bird oceanodroma leucorhoa seabird canada bon portage island burrow soil )2017-11-07v4No1 / 676
357amnoncommon in temperate deciduous forests around the world (common soil, topsoil, depth (soil) 0-10cm, temperate woodland biome, temperate deciduos forest, woodland area, forest ecosystem)2018-08-18v4No1 / 681
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 6-7, cultivated environment, china2018-12-04v4No1 / 682
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 685
100amnoncommon soil, urban biome, park, new york city, central park2017-04-03v4No1 / 685
820naHigher in 45-75cm depth compared to 0-20cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 45-75cm compared to depth (soil) 0-20cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v1No1 / 686
506amnoncommon soil, boreal wetland, seasonal frozen marsh, depth (soil) 0-10cm, peat soil, northeast china, china, wetland area2019-03-16v4No1 / 690
829sheryohigher soil depth of 12-44cm compared to 0-12cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 12-44cm compared to depth 0-12cm in sandy loam sandy loam soil hapludalf alfisol united states of america soil state of illinois illinois dekalb county )2021-08-26v3No1 / 692
667amnoncommon depth (soil) 0-20cm, elevation 800-900m, ph 4.5, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 694
824sheryoHigher at 20-40cm depth compared to 10-20cm depth in soil after grazing exclusion, Ningxia china ( high in depth 20-40cm compared to depth 10-20cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 695
347amnoncommon kingdom of norway, svalbard archipelago, permafrost, soil, depth (soil) 20-30cm2018-07-15v4No1 / 698
820naCommon in lower subsoil, 75-105cm depth, wheat rhizosphere haplic luvisol in germany (common depth (soil) 75-105cm, silty clay loam, ph 6.9, triticum aestivum, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 700
754sheryoCommon in soil planted with cucmber, fertilized with bioorganic fertilizer (Bacillus amyloliquefaciens SQR 9) and infected with Fusarium oxysporum f. sp. cucumerinum (common bacillus amyloliquefaciens sqr9, zhejiang province, cucumber, fusarium oxysporum, bio-organic fertilizer, soil, china)2021-03-15v3No1 / 701
801sheryoCommon at depth 30-60cm in corn agriculture fields, Iowa USA (common ph 8.1, depth (soil) 30-60cm, kanawha, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 703
746sheryoHigh in saline soil fertilized with biological fertilizer compared to chemical fertilizer, planted with tomatos, in dafeng, china ( high in trichoderma guizhouense njau 4742 chicken manure biological fertilization compared to chemical fertilization n,p,k in saline soil solonchak china dafeng city jiangsu province ph 7.5 solanum lycopersicum )2021-03-03v4No1 / 703
762sheryoCommon in bulk soil of a pot experiment with lettuce planted in organic fertilized albic luvisol from Germany (common manured soil, manure fertilization, germany, organic fertilization, soil, bulk soil, thyrow, albic luvisol, ph 6.4, lettuce, pot expreiment)2021-04-07v3No1 / 704
412amnon high in ph<5 compared to ph>5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 706
357amnon high in ph>3 compared to ph<3 in soil topsoil depth (soil) 0-10cm subpolar coniferous forest biome boreal forest woodland area forest ecosystem 2018-08-19v4No1 / 719
829sheryoCommon in soil depth of 12-44m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 12-44cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 721
415amnoncommon rhizosphere, soil, citrus, orchard, reunion island, cultivated environment2018-11-27v4No1 / 721
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common depth 50-100m, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 726
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 5-6, cultivated environment, china2018-12-04v4No1 / 726
462amnoncommon depth (soil) 20-60cm, united states of america, state of tennessee, soil, depth 30-75cm, silt clay loam, cultivated environment2019-01-13v4No1 / 728
823sheryoCommon at 0-10cm depth in ultisol soil in auburn, alabama (common depth (soil) 0-10cm, auburn, alabama, upland soil, agricultural field, ultisol, soil)2021-08-07v3No1 / 730
752sheryoCommon in soil planted with Panax notoginseng (common panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 730
823sheryoCommon at 10-25cm depth in ultisol soil in auburn, alabama (common depth (soil) 10-25cm, alabama, auburn, upland soil, ultisol, agricultural field, soil)2021-08-07v3No1 / 732
824sheryoHigher at 10-20cm depth compared to 0-10cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth (soil) 0-10cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 734
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common depth 0-12cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 737
989amnoncommon depth (soil) 0-20cm, cinnamomum camphora, anxi county, ph 4-5, farm, china, soil2022-12-26v3No1 / 738
813amnoncommon forested area, temperate rainforest, united states of america, state of washington, olympic national park, soil2021-06-22v4No1 / 740
820naHigher in 75-105cm depth compared to 0-20cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 75-105cm compared to depth (soil) 0-20cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v1No1 / 740
421amnoncommon in paddy field soil incubated with copper (common soil, research facility, zhejiang province, paddy field soil, copper, china)2018-12-02v4No1 / 740
415amnoncommon rhizosphere, soil, citrus, australia, orchard, cultivated environment2018-11-27v4No1 / 743
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common depth 50-100m, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 744
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 stover ammendment soil )2020-03-27v4No1 / 747
791sheryoHigher at 0cm depth compared to 80cm depth in low saline low sodicity soil in China ( high in depth (soil) 0-20cm depth 0cm compared to depth (soil) 80cm in ph 9 low salinity low sodicity soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 748
854sheryoCommon in soil depth of 275-325cm of colluvial soil, Czech rebuplic (common depth 275-325cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 749
271amnon high in rhizosphere glycine max soybean compared to soil in depth (soil) 0-20cm china 2018-01-09v4No1 / 750
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 44-108cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 751
709sheryoCommon in potting mix soil from the Netherlands, substraat arabidopsis, Lentse Potgrond (common substraat arabidopsis, lentse potgrond, soil, potting mix, kingdom of the netherlands)2028-05-16v4No1 / 752
823sheryoCommon at 30-50cm depth in foot slope ultisol soil in auburn, alabama (common depth 30-50cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 753
801sheryoCommon at depth 30-60cm in corn and soybean agriculture fields, Iowa USA (common ph 6.7, depth (soil) 30-60cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 760
357amnon high in ph>4 compared to ph<4 in soil topsoil depth (soil) 0-10cm southern temperate forest temperate broadleaf and mixed forest biome woodland area forest ecosystem 2018-08-19v4No1 / 761
801sheryoCommon at depth 60-90cm in corn agriculture fields, Iowa USA (common depth (soil) 60-90cm, ph 8.3, kanawha, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 764
813amnonlower in epiphytic materiall attached to intact branch compared to severed suspended branch ( high in severed branch compared to intact branch in epiphytic material united states of america state of washington olympic national park canopy soil soil )2021-06-22v4No1 / 768
842sheryoCommoon in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 30-45cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 768
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common depth 50-100m, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 769
171amnon high in drought environment compared to control in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 770
171amnoncommon soil, united states of america, state of california, rhizosphere, oryza sativa, rice2017-07-25v4No1 / 772
667amnoncommon depth (soil) 0-20cm, ph 4, elevation 1300-1400m, coniferous forest biome, jiangxi province, lushan mountain, china, forested area, topsoil, soil2020-09-25v4No1 / 777
615amnoncommon in control soil with no sugarcane (common campinas, brazil, greenhouse, soil)2020-04-27v4No1 / 780
823sheryoCommon at 90-100cm depth in foot slope ultisol soil in auburn, alabama (common depth 90-100cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 782
662amnon high in dry compared to irrigated in neve yaar depth (soil) 0-10cm soil agricultural field israel 2020-09-21v3No1 / 782
752sheryoCommon in soil planted with Panax notoginseng amended with2% biochar (common biochar, panax notoginseng, sanqi plants, ph 6, xundian county, yunnan province, china, pot expreiment, soil)2021-03-11v3No1 / 783
821sheryoHigher at 25-50cm depth compared to 50-100cm depth in soil in Michigan USA ( high in depth (soil) 25-50cm compared to depth 50-100m in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 784
347amnon high in depth (soil) 20-30cm compared to depth (soil) 0-20cm permafrost transition layer in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 788
828sheryoCommon in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (common depth 40-50cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 790
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 0-27cm, dekalb county, illinois, state of illinois, mollisol, silt loam, soil, united states of america)2021-08-26v3No1 / 798
824sheryoHigher at 0-10cm depth compared to 10-20cm depth in soil after grazing exclusion at 0-10cm depth, Ningxia china ( high in depth (soil) 0-10cm compared to depth 10-20cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 807
746sheryoCommon in saline soil fertilized with chemical fertilizer, planted with tomatos, in dafeng, china (common chemical fertilization n,p,k, solanum lycopersicum, ph 7.5, jiangsu province, dafeng city, china, solonchak, saline soil)2021-03-03v4No1 / 811
821sheryoHigher at 25-50cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 25-50cm compared to depth (soil) 10-25cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 812
823sheryoCommon at 50-90cm depth in foot slope ultisol soil in auburn, alabama (common depth 50-90cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 815
480amnoncommon soil, pasture, farm, ireland2019-02-05v4No1 / 816
422amnoncommon soil, paddy field soil, oryza sativa, yunnan province, china, cultivated environment2018-12-02v4No1 / 821
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
421amnoncommon in paddy field soil incubated without copper (common research facility, soil, paddy field soil, zhejiang province, china)2018-12-02v4No1 / 824
583amnoncommon soil, mountain, switzerland, depth (soil) 0-10cm, elevation 2000-3000m, canton of graubunden, calcareous parent material, ph 7-82020-01-28v3No1 / 830
415amnoncommon rhizosphere, soil, citrus, orchard, china, cultivated environment2018-11-27v4No1 / 830
837sheryoHigher at 0-40cm depth compared to 40-100cm in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 0-40cm compared to depth 40-100cm in robinia pseudoacacia 10 years reforestation silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 831
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, continuous cropping, age 5 years, age 10 years, china, cultivated environment2019-01-07v4No1 / 833
356amnoncommon in deciduous broad leaved forest top soil in japan (common soil, depth (soil) 0-10cm, hokkaido, topsoil, ph 5.4, japan, forest ecosystem)2018-08-15v4No1 / 834
842sheryoCommon in soil depth of 0-15cm in an old growth forest in Ontario, Canada (common depth 0-15cm, old growth forest, luvisol, grand river watershed, rare charitable research reserve, quercus velutina, quercus alba, quercus rubra, acer saccharum, acer saccharum subsp. nigrum, fagus grandifolia, cambridge, forest, forested area, province of ontario, canada, soil)2021-11-14v3No1 / 834
761sheryoCommon in bulk sandy soil maize field in Germany (common ph 5, lower saxony, sandy soil, germany, maize field, bulk soil)2021-04-06v3No1 / 835
801sheryoCommon in soybean and corn agriculture fields at depth 30-60cm, Iowa USA (common depth (soil) 30-60cm, ph 7.4, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 839
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common ph 6, depth (soil) 15-30cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 841
828sheryoCommon in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (common depth 30-4cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 844
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 856
769sheryocommon in conventional tillage wheat field in northern israel (common conventional tillage, bulk soil, soil, vertisol, israel, northen israel, triticum aestivum)2021-04-18v4No1 / 861
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common kanawha, ph 7.1, nicollet soil series, depth (soil) 0-15cm, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 862
837sheryoHigher at 0-40cm depth compared 100-300cm to in soil after 10 years reforestation with Black locust trees, shaanxi, China ( high in depth 0-40cm compared to depth 100-300cm in robinia pseudoacacia 10 years reforestation silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 863
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer in Nanjing China (common paenibacillus polymyxa, paenibacillus, compost, compost biofilter, pig manure, bio-organic fertilizer, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 866
829sheryoCommon in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (common depth 108-140cm, sandy loam, sandy loam soil, hapludalf, alfisol, united states of america, soil, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 871
769sheryocommon in no tillage wheat field in northern israel (common bulk soil, soil, vertisol, israel, northen israel, no tillage, triticum aestivum)2021-04-18v4No1 / 871
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common depth 50-100m, panicum virgatum, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 872
855sheryoCommon in soil depth of 75cm in fertilized soil in china (common depth 75cm, luancheng county, china, agricultural field, fertilized soil, soil)2021-12-27v3No1 / 873
767sheryoCommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer and amended with soil fumigant 'Dazomet' in Nanjing China (common pig manure, compost soil, paenibacillus, paenibacillus polymyxa, compost biofilter, bio-organic fertilizer, nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 875
786sheryoCommon in flood plain soil near cosumnes river, california, at 60-100cm depth (common depth (soil) 60-100cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 878
854sheryoCommon in soil depth of 75-100cm of colluvial soil, Czech rebuplic (common depth 75-100cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 879
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil2017-04-15v4No1 / 884
171amnoncommon in soil with rice growth irrigation protocol (common soil, united states of america, state of california, depth 5cm)2017-07-25v4No1 / 890
854sheryoCommon in soil depth of 200-250cm of colluvial soil, Czech rebuplic (common depth 200-250cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 894
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 80cm depth in China ( high in ph 9 low sodicity low salinity compared to ph 10 high sodicity high salinity in depth (soil) 80cm soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 895
788amnoncommon soil, mesocosm, state of georgia, united states of america2021-05-31v4No1 / 897
786sheryoCommon in flood plain soil near cosumnes river, california, at 133-166cm depth (common depth (soil) 133-166cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 898
821sheryoCommon in soil of miscanthus field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 901
801sheryoCommon in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (common ph 7.4, depth (soil) 15-30cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 905
842sheryoCommon in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 15-30cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 905
854sheryoCommon in soil depth of 25-50cm of colluvial soil, Czech rebuplic (common ph 8, calcic chernozem, czech republic, south moravian region, colluvial soil, depth 25-50cm, soil)2021-12-23v3No1 / 905
829sheryoCommon in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (common depth 27-56cm, united states of america, soil, silt loam, mollisol, state of illinois, illinois, dekalb county)2021-08-26v3No1 / 906
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide and biochar (common biochar, without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 910
357amnon high in ph<4.5 compared to ph>4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 915
609sheryoCommon in soil without tobacco plants amended with difenoconazole fungicide (common without plants, difenoconazole, fungicide, ph 7-8, china, tobacco field, limestone, depth 0-20cm, soil)2020-07-05v4No1 / 915
820naHigher in 0-20cm depth compared to 75-105cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 0-20cm compared to depth (soil) 75-105cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v1No1 / 917
100amnon high in ph ph>7 compared to ph<7 in soil urban biome park new york city central park 2017-04-03v4No1 / 918
767sheryocommon in soil planted with Chrysanthemum, infested with fusarium in Nanjing China (common soil, fusarium, fusarium oxysporum f. sp. chrysanthemi, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county)2021-04-14v4No1 / 922
820naHigher in 0-20cm depth compared to 45-75cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 0-20cm compared to depth (soil) 45-75cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v1No1 / 923
842sheryoHigher in soil depth of 0-15cm compared to soil depth 15-30cm in a zea mays agricultural field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in zea mays preston flats agricultural field soil luvisol grand river watershed canada province of ontario cambridge rare charitable research reserve )2021-11-14v3No1 / 924
821sheryoHigher at 10-25cm depth compared to 0-10cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 0-10cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 930
791sheryoHigher in low sodicity and low salinity soil compared to high sodicity and high salinity soil at 0cm depth in China ( high in ph 8.5 low sodicity low salinity compared to ph 10.5 high sodicity high salinity in depth (soil) 0-20cm depth 0cm soil salic solonetz da'an station china songnen plain )2021-06-08v4No1 / 932
359amnoncommon soil, topsoil, depth (soil) 0-10cm, guangdong province, subtropical broadleaf forest biome, china, forest ecosystem, woodland area2018-08-19v4No1 / 935
786sheryoCommon in flood plain soil near cosumnes river, california, at 166-200cm depth (common depth (soil) 166-200cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 936
462amnoncommon depth (soil) 0-30 cm, depth (soil) 0-20cm, united states of america, state of tennessee, soil, silt loam, cultivated environment2019-01-13v4No1 / 938
842sheryoCommon in soil depth of 15-30cm in a zea mays agricultural field in Ontario, Canada (common depth 15-30cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 944
444amnoncommon in uncultivated soil plot (common yellow brown soil, nanjing city prefecture, soil, china)2019-01-07v4No1 / 946
767sheryoCommon in soil planted with Chrysanthemum, amended with soil fumigant 'Dazomet' in Nanjing China (common nanjing county, china, chrysanthemum, chrysanthemum morifolium ramat., ph 6.9, soil, soil fumigation, dazomet)2021-04-14v4No1 / 946
422amnoncommon soil, paddy field soil, jiangsu province, oryza sativa, china, cultivated environment2018-12-02v4No1 / 957
854sheryoCommon in soil depth of 125-175cm of colluvial soil, Czech rebuplic (common depth 125-175cm, calcic chernozem, colluvial soil, ph 8, south moravian region, czech republic, soil)2021-12-23v3No1 / 962
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 963
414amnon high in ph<6 npk fertilizer compared to ph>6 in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 963
624sheryoCommon in ryegrass rhizosphere soil after 30-40 days (common days 30-40, rhizosphere, ryegrass, ph 7-8, 10 cm depth, soil, jiangsu province, china)2020-05-11v4No1 / 966
917amnon high in qiao nature reserve compared to futian national nature reserve in mangrove biome mangrove depth (soil) 0-20cm china marsh soil saline marsh 2022-07-08v3No1 / 967
823sheryoHigher at 15-30cm depth compared to 50-90cm depth in foot slope ultisol soil in auburn, alabama ( high in depth (soil) 15-30cm compared to depth 50-90cm in foot slope alabama auburn ultisol agricultural field soil )2021-08-08v3No1 / 968
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 968
129amnoncommon ph 6-6.5, mexico, myrtillocactus geometrizans, opuntia robusta, cactus, semi-arid, soil, root zone soil2017-04-15v4No1 / 968
842sheryoCommon in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 30-45cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 970
480amnoncommon soil, pasture, farm, new zealand2019-02-05v4No1 / 970
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common panicum virgatum, depth (soil) 25-50cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, state of michigan, soil, united states of america)2021-08-03v4No1 / 974
842sheryoCommon in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 15-30cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 974
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
266amnoncommon in soil from MIL garden (common soil, united states of america, state of idaho, ph 6.5)2017-12-18v4No1 / 980
828sheryoCommon in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (common depth (soil) 20-30cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 989
360amnon high in soil compared to agave rhizosphere in desert mexico state of california 2018-08-21v4No1 / 992
746sheryoCommon in saline soil fertilized with biological fertilizer, planted with tomatos, in dafeng, china (common saline soil, solonchak, china, dafeng city, jiangsu province, ph 7.5, solanum lycopersicum, biological fertilization, chicken manure, trichoderma guizhouense njau 4742)2021-03-03v4No1 / 993
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
412amnon high in ph>5 compared to ph<5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 1005
610sheryoCommon in agricultural field soil amended with low biochar (common low biochar, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1009
820naCommon in top soil, 0-20cm depth, wheat rhizosphere haplic luvisol in germany (common depth (soil) 0-20cm, triticum aestivum, ph 6.5, silt loam, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 1011
786sheryoCommon in flood plain soil near cosumnes river, california, at 100-133cm depth (common depth (soil) 100-133cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 1015
624sheryocommon in ryegrass rhizosphere soil amended with biochar after 30-40 days (common china, jiangsu province, soil, 10 cm depth, ph 7-8, ryegrass, rhizosphere, days 30-40, biochar)2020-05-11v4No1 / 1017
628sheryocommon in bulk soil with barley plants after 180 days in treatments amended with biochar (common biochar, bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1023
824sheryoHigher at 20-40cm depth compared to 40-60cm depth in soil after grazing exclusion, Ningxia china ( high in depth 20-40cm compared to depth 40-60cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 1025
266amnoncommon in soil from PAR garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
768sheryoCommon in maize fields in Brittany, France (common zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1034
791sheryoCommon at 0cm depth in low saline low sodicity soil in China (common depth (soil) 0-20cm, ph 8.5, depth 0cm, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-07v4No1 / 1035
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn and soybean agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in subsurface drainage glycine max kelley nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-16v4No1 / 1036
824sheryoHigher at 10-20cm depth compared to 20-40cm depth in soil after grazing exclusion, Ningxia china ( high in depth 10-20cm compared to depth 20-40cm in yunwushan national natural grassland protection zone ningxia province calci-orthic aridisol haplic calcisol grazing exclusion china soil )2021-08-08v4No1 / 1038
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 15-30cm compared to depth 0-15cm in luvisol dipsacus fullonum solidago apocynum daucus carota decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 1044
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common depth (soil) 0-30 cm, depth (soil) 0-20cm, flood plain, soil, united states of america, state of california, sacramento, cosumnes river preserve)2021-05-18v3No1 / 1048
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, china, cultivated environment2018-12-02v4No1 / 1049
610sheryoCommon in agricultural field soil (common triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1053
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 100-300cm depth, shaanxi, China (common depth 100-300cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1061
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 40-100cm depth, shaanxi, China (common depth 40-100cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1065
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common depth (soil) 0-10cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 1069
917amnon high in futian national nature reserve compared to qiao nature reserve in depth (soil) 0-20cm china marsh mangrove mangrove biome soil saline marsh 2022-07-08v3No1 / 1071
263amnoncommon in desert soil irrigated daily in lab (common soil, israel, sandy loam soil, negev desert, ph 7-8, irrigated, research facility)2017-12-11v4No1 / 1076
610sheryoCommon in agricultural field soil amended with high biochar (common soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 1079
347amnon high in depth (soil) 20-30cm compared to depth 100-150cm depth 150-200cm in kingdom of norway svalbard archipelago permafrost soil 2018-07-15v4No1 / 1080
154amnon high in uranium high uranium compared to control in soil australia kakadu national park sediment 2017-06-29v4No1 / 1080
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, dipsacus fullonum, solidago, apocynum, daucus carota, brunisol, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1082
791sheryoCommon at 40cm depth in low saline low sodicity soil in China (common depth (soil) 40cm, ph 9, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1085
765sheryocommon in wheat field in the loess plateau in china (common triticum aestivum, ph 7.7, loess plateau, silt loam, chromic cambisol, shanxi province, china, soil)2021-04-12v3No1 / 1087
265amnoncommon canada, province of quebec, soil2017-12-11v4No1 / 1090
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
415amnoncommon rhizosphere, soil, citrus, orchard, kingdom of spain, cultivated environment2018-11-27v4No1 / 1099
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in soybean and corn agriculture fields , Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in united states nicollet soil series glycine max zea mays ames des moines iowa agricultural field soil )2021-06-15v4No1 / 1102
84amnoncommon soil, peatland, peat soil, sphagnum bog, temperate grassland biome, depth 5cm, wetland area2017-03-06v4No1 / 1103
357amnon high in ph<5 compared to ph>5 in soil topsoil depth (soil) 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1104
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 1105
917amnoncommon qiao nature reserve, depth (soil) 0-20cm, sonneratia apetala, china, marsh, mangrove, ph 7-8, soil2022-07-08v3No1 / 1107
360amnonlower in leaf surface compared to soil in agave plants ( high in soil compared to leaf leaf surface in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 1108
767sheryocommon in soil planted with Chrysanthemum, fertilized with bio-organic fertilizer, amended with soil fumigant 'Dazomet' and deep plough in Nanjing China (common dazomet, soil fumigation, soil, ph 6.9, chrysanthemum morifolium ramat., chrysanthemum, china, nanjing county, bio-organic fertilizer, compost biofilter, paenibacillus polymyxa, paenibacillus, compost soil, pig manure, conventional tillage, deep plough)2021-04-18v4No1 / 1109
855sheryoHigher in soil depth of 75cm compared to soil depth of 10cm in fertilized soil in china ( high in depth 75cm compared to depth (water) 10cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1112
824sheryocommon in soil after 0-9 years of grazing exclusion at 40-60cm depth, Ningxia china (common 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, depth 40-60cm, china, soil)2021-08-08v4No1 / 1113
828sheryoCommon in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (common depth 10-20cm, ph 6-7, clay loam, gleysol, china, jiangsu province, sihong county, chenwei forest, soil, poplar plantation, poplar)2021-08-25v4No1 / 1123
791sheryoCommon at 80cm depth in low saline low sodicity soil in China (common depth (soil) 80cm, ph 9, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1128
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common bernburg, germany, soil, triticum aestivum, crop rotation, ph 7.6, brassica napus, rapeseed pre-crop)2021-04-12v3No1 / 1129
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato slit loam ph 6 2017-04-20v4No1 / 1135
628sheryocommon in bulk soil with barley plants after 180 days in treatments unamended with biochar (common bulk soil, china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, days 180, mature barley plants)2020-05-18v4No1 / 1136
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common ph 7.6, crop rotation, cultivator tillage, conservation tillage, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1140
146amnoncommon united states of america, solanum lycopersicum, tomato, soil, slit loam soil, ph 62017-04-20v4No1 / 1144
842sheryoCommon in soil depth of 0-15cm in a zea mays agricultural field in Ontario, Canada (common depth 0-15cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 1147
791sheryoCommon at 20cm depth in low saline low sodicity soil in China (common ph 9, depth 20cm, ph 8.5, low salinity, low sodicity, soil, salic solonetz, da'an station, china, songnen plain)2021-06-08v4No1 / 1155
171amnon high in control compared to drought environment in soil united states of america state of california rhizosphere oryza sativa rice 2017-07-25v4No1 / 1164
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, spartina alterniflora, hainan autonomous prefecture, danzhou xinyinggang nature reserve2019-12-16v4No1 / 1169
422amnoncommon soil, paddy field soil, oryza sativa, heilongjiang province, ph 7-8, cultivated environment, china2018-12-04v4No1 / 1169
746sheryoCommon in saline soil in dafeng, china (common ph 7.6, jiangsu province, dafeng city, china, solonchak, saline soil)2021-03-03v4No1 / 1170
357amnon high in ph>5 compared to ph<5 in soil topsoil depth (soil) 0-10cm temperate woodland biome temperate deciduos forest woodland area forest ecosystem 2018-08-18v4No1 / 1171
786sheryoCommon in flood plain soil near cosumnes river, california, at 30-60cm depth (common depth (soil) 30-60cm, cosumnes river preserve, sacramento, state of california, united states of america, soil, flood plain)2021-05-18v3No1 / 1180
615amnon high in rhizosphere compared to soil in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 1181
628sheryocommon in rhizosphere of barley roots after 180 days in treatments amended with biochar (common mature barley plants, days 180, rhizosphere, hordeum vulgare, biochar, ph 4-5, depth (soil) 15cm, china, quzhou county, zhejiang province, soil)2020-05-18v4No1 / 1192
421amnoncommon soil, paddy field soil, zhejiang province, china2018-12-04v4No1 / 1194
917amnoncommon ph 7-8, futian national nature reserve, depth (soil) 0-20cm, kandelia candel, china, marsh, mangrove, soil2022-07-08v3No1 / 1197
823sheryoCommon at 0-15cm depth in foot slope ultisol soil in auburn, alabama (common foot slope , depth (soil) 0-15cm, alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1199
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common subsurface drainage, ph 6.2, depth (soil) 0-15cm, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 1202
628sheryocommon in rhizosphere of barley roots after 180 days in treatments unamended with biochar (common china, zhejiang province, quzhou county, soil, depth (soil) 15cm, ph 4-5, hordeum vulgare, rhizosphere, days 180, mature barley plants)2020-05-18v4No1 / 1209
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, hainan autonomous prefecture, danzhou xinyinggang nature reserve, mangrove, rhizophora stylosa2019-12-16v4No1 / 1210
917amnoncommon qiao nature reserve, depth (soil) 0-20cm, china, mudflat, marsh, ph 7-8, soil, saline marsh2022-07-08v3No1 / 1211
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common crop rotation, triticum aestivum, ph 7.6, mouldboard plough, conventional tillage, loess chernozem, bernburg, germany, soil)2021-04-12v3No1 / 1213
823sheryoCommon at 15-30cm depth in foot slope ultisol soil in auburn, alabama (common depth (soil) 15-30cm, foot slope , alabama, auburn, ultisol, agricultural field, soil)2021-08-08v3No1 / 1218
837sheryoCommon in agricultural field at depths 100-300cm, shaanxi, China (common depth 100-300cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1220
444amnonlower in continuously cropped strawberry soil ( high in age 1 year compared to age 5 years age 10 years continuous cropping in rhizosphere fragaria x ananassa strawberry greenhouse soil farm yellow brown soil nanjing city prefecture china cultivated environment )2019-01-07v4No1 / 1221
531amnoncommon rhizosphere, greenhouse soil, farm, orthic anthrosol, cucumis sativus, cucumber, china2019-07-21v3No1 / 1223
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1225
801sheryoCommon in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (common united states, ph 7.5, nicollet soil series, depth (soil) 0-15cm, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 1226
798amnoncommon depth (soil) 10 cm, depth (soil) 0-20cm, ph 7-8, soil, orchard, apricot, prunus armeniaca, apennine mountains, italy2021-06-13v3No1 / 1230
824sheryoCommon in soil after 27-35 years of grazing exclusion at 40-60cm depth, Ningxia china (common 27-35 years of grazing exclusion, depth 40-60cm, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1232
420amnoncommon in soil of vegetables in organic field (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, cultivated environment, china)2018-12-02v4No1 / 1240
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1241
237amnonlower deep in burrow compared to burrow entrance ( high in surface burrow compared to deep burrow in bird oceanodroma leucorhoa seabird canada bon portage island burrow soil )2017-11-07v4No1 / 1247
855sheryoCommon in soil depth of 10cm in fertilized soil in china (common luancheng county, china, depth (water) 10cm, fertilized soil, agricultural field, soil)2021-12-27v3No1 / 1253
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common depth 40-100cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1263
298amnoncommon soil, desert, united states of america, state of utah, depth 1cm, soil crust2018-02-20v4No1 / 1265
824sheryoCommoon in soil after 0-9 years of grazing exclusion at 20-40cm depth, Ningxia china (common depth 20-40cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1274
616amnoncommon in topsoil of non-fertilized sugarcane field (common depth (soil) 0-20cm, ph 6.7, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture, non-fertilized soil)2020-04-27v3No1 / 1277
415amnoncommon rhizosphere, soil, citrus, orchard, italy, cultivated environment2018-11-27v4No1 / 1279
788amnon high in soil compared to plant litter in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1280
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common depth 0-15cm, luvisol, dipsacus fullonum, solidago, apocynum, daucus carota, decomissioned agricultural field, meadow ecosystem, grand river watershed, rare charitable research reserve, cambridge, province of ontario, canada, soil)2021-11-14v3No1 / 1281
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 1282
798amnon high in ph 7-8 soil compared to hay plant litter litter bag in depth (soil) 10 cm depth (soil) 0-20cm orchard apricot prunus armeniaca apennine mountains italy 2021-06-13v3No1 / 1285
917amnoncommon ph 6-6.5, futian national nature reserve, depth (soil) 0-20cm, china, mudflat, marsh, soil, saline marsh2022-07-08v3No1 / 1290
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common ph 6.5, depth (soil) 0-10cm, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1291
837sheryoCommon in soil at 0-40-100cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common depth 40-100cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1294
420amnoncommon in soil of vegetables in organic plastic tunnel (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, organic farming, greenhouse soil, china, cultivated environment)2018-12-02v4No1 / 1294
266amnonCommon in soil from MAH garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1299
837sheryoCommon in soil at 40-100cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common depth 40-100cm, 30 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1311
837sheryoCommon in soil after 10 years reforestation with Black locust trees at 0-40cm depth, shaanxi, China (common depth 0-40cm, robinia pseudoacacia, 10 years, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 100-300cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common depth 100-300cm, 20 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1317
837sheryoCommon in soil at 0-40cm depth after 20 years reforestation with Black locust trees, shaanxi, China (common 20 years, depth 0-40cm, robinia pseudoacacia, loess plateau, shaanxi province, china, reforestation, silt loam, soil)2021-09-26v4No1 / 1323
783sheryocommon in desert soil in mongolia without water addition treatment (common no water addition, ambient precipitation, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 1324
600sheryoCommon in biochar ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, biochar, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82, stover ammendment )2020-03-27v4No1 / 1327
259amnoncommon in soil and rhizpsphere of peanut plants (common soil, rhizosphere, ph 5, arachis hypogaea, peanut, china)2017-12-02v4No1 / 1334
837sheryoCommon in soil at 0-40 cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common 30 years, depth 0-40cm, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1346
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mangrove, kandelia candel, hainan autonomous prefecture, dongzhaigang national nature reserve2019-12-16v4No1 / 1351
837sheryoCommon in soil at 100-300cm depth after 30 years reforestation with Black locust trees, shaanxi, China (common depth 100-300cm, 30 years, robinia pseudoacacia, reforestation, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1354
917amnoncommon ph 6-6.5, kandelia candel, depth (soil) 0-20cm, marsh, china, qiao nature reserve, mangrove, soil2022-07-08v3No1 / 1364
824sheryoCommon in soil after 27-35 years of grazing exclusion at 20-40cm depth, Ningxia china (common depth 20-40cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1369
420amnoncommon in soil of vegetable open field (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, npk fertilizer, cultivated environment, china)2018-12-02v4No1 / 1376
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-08-02v4No1 / 1377
917amnoncommon ph 6-7, depth (soil) 0-20cm, futian national nature reserve, sonneratia apetala, china, marsh, mangrove, soil2022-07-08v3No1 / 1379
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, state of michigan, kellogg biological station, ph 5.9, mesic type hapludalf, kalamazoo loam, depth (soil) 0-10cm, continuous corn, corn, soil)2021-07-28v4No1 / 1380
883amnon high in non-contaminated soil compared to oil contaminated soil oilfield in yellow river delta china shengli oilfield soil 2022-03-20v4No1 / 1381
821sheryoHigher at 0-10cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 0-10cm compared to depth (soil) 10-25cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1383
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, state of michigan, soil, united states of america)2021-08-02v4No1 / 1387
266amnoncommon in soil from SIL garden (common soil, united states of america, state of idaho, ph 6)2017-12-18v4No1 / 1389
1008amnoncommon ph 7-8, jinxiang county, garlic, allium sativum, fertilized soil, farm, china, rhizosphere2023-01-26v4No1 / 1393
788amnon high in soil compared to cherokia georgiana georgiana millipede feces in mesocosm state of georgia united states of america 2021-05-31v4No1 / 1395
600sheryoCommon in unammended soil after 82 days (common depth (soil) 0-5cm, state of new york, soil, united states of america, coarse-loamy soil, ph 6, day 82)2020-03-27v4No1 / 1395
420amnonhigh freq. in soil of vegetable in plastic tunnel (common soil, ph>7, ph 7-8, agricultural feature, farm, shanghai proper, clay loam, npk fertilizer, greenhouse soil, cultivated environment, china)2018-12-02v4No1 / 1396
824sheryoCommon in soil after 0-9 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1397
422amnoncommon soil, paddy field soil, oryza sativa, hunan province, hubei province, china, cultivated environment2018-12-02v4No1 / 1399
76amnoncommon in non-seleniferous soil (common soil, rhizosphere, united states of america, non-seleniferous, state of florida)2017-02-28v4No1 / 1414
40amnoncommon soil, field soil, nicotiana tabacum, rhizosphere, china2016-12-09v4No1 / 1420
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, hainan autonomous prefecture, dongzhaigang national nature reserve, mudflat2019-12-16v4No1 / 1422
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1435
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, leizhou nature reserve, spartina alterniflora2019-12-16v4No1 / 1437
76amnoncommon in seleniferous soil (common soil, rhizosphere, united states of america, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
444amnoncommon rhizosphere, fragaria x ananassa, strawberry, greenhouse soil, farm, yellow brown soil, nanjing city prefecture, age 1 year, china, cultivated environment2019-01-07v4No1 / 1439
783sheryocommon in desert soil in mongolia under water addition treatment (common 100% above ambient precipitation, water addition, ph 7.85, luvic gypsisols, cambic arenosols, china, mongolia, dengkou county, ulan buh desert, bajada, sandy desert, soil)2021-05-11v4No1 / 1442
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common depth (soil) 0-10cm, miscanthus, restored prairie, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, soil)2021-07-28v4No1 / 1447
100amnon high in ph ph<5 compared to ph>5 in soil urban biome park new york city central park 2017-04-03v4No1 / 1451
414amnon high in ph>6 compared to ph<6 npk fertilizer in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 1451
266amnoncommon in soil from JAM garden (common soil, united states of america, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
837sheryoCommon in agricultural field at depths 0-40cm, shaanxi, China (common depth 0-40cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1470
824sheryoCommon in soil after 27-35 years of grazing exclusion at 10-20cm depth, Ningxia china (common depth 10-20cm, 27-35 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1477
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
760sheryoCommon in rhizosphere soil of rice plants with NPK fertilization in a long term fertilization experiment (common npk fertilization, npk fertilizer, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 1491
631sheryoCommon in maize field biochar amended rhizosphere soil (common ph 7.85, biochar, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1492
760sheryoCommon in rhizosphere soil of rice plants without fertilization in a long term fertilization experiment (common ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, no fertilization, oryza sativa, rhizosphere)2021-04-06v4No1 / 1506
145amnoncommon soil, rhizosphere, oryza sativa, rice, united states of america, ph 5.62017-04-19v4No1 / 1515
855sheryoHigher in soil depth of 75cm compared to soil depth of 175cm in fertilized soil in china ( high in depth 75cm compared to depth 175cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1522
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, leizhou nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1523
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, futian national nature reserve, mudflat2019-12-16v4No1 / 1587
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, guangdong province, shenzhen futian national nature reserve, mangrove, kandelia candel2019-12-16v4No1 / 1593
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in depth (soil) 0-5cm state of new york soil united states of america coarse-loamy soil ph 6 day 82 )2020-03-27v4No1 / 1612
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in soil united states of america rhizosphere woodland area )2017-02-28v4No1 / 1621
422amnon high in ph 5-6 compared to ph 7-8 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 1634
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mangrove, kandelia candel, ximendao national marine reserve, zhejiang province2019-12-16v4No1 / 1636
631sheryocommon in maize field unamended rhizosphere soil (common unamended soil, ph 7.6, rhizosphere, china, guizhou province, kaiyang county, soil, maize field, after 6 years)2020-06-02v3No1 / 1637
608sheryoCommon in wheat field in China, amended and unamended biochar, unamended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil)2020-04-20v4No1 / 1643
462amnon high in depth (soil) 0-30 cm depth (soil) 0-20cm silt loam compared to detph 30-75cm silt clay loam in soil united states of america state of tennessee cultivated environment 2019-01-12v4No1 / 1648
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, mudflat, guangdong province, shenzhen futian national nature reserve2019-12-16v4No1 / 1649
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common depth (soil) 10-25cm, united states of america, state of michigan, kellogg biological station, mesic type hapludalf, kalamazoo loam, continuous corn, corn, soil)2021-07-28v4No1 / 1649
824sheryoCommon in soil after 27-35 years of grazing exclusion at 0-10cm depth, Ningxia china (common yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, 27-35 years of grazing exclusion, grazing exclusion, china, depth (soil) 0-10cm, soil)2021-08-08v4No1 / 1659
154amnon high in control compared to uranium high uranium in soil australia kakadu national park sediment 2017-06-29v4No1 / 1663
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, ximendao national marine reserve, zhejiang province, spartina alterniflora2019-12-16v4No1 / 1668
760sheryoCommon in rhizosphere soil of rice plants with manure fertilization in a long term fertilization experiment (common manure fertilization, manured soil, ph 5.9, china, soil, qiyang county, hunan province, quaternary red clay, oryza sativa, rhizosphere)2021-04-06v4No1 / 1670
855sheryoHigher in soil depth of 10cm compared to soil depth of 75cm in fertilized soil in china ( high in depth (water) 10cm compared to depth 75cm in luancheng county china agricultural field fertilized soil soil )2021-12-27v3No1 / 1678
608sheryoCommon in wheat field in China, amended and unamended biochar, amended with nitrogen fertilizer (common triticum aestivum l. cv., xiaoyan no. 22, china, silty clay, soil, urea enriched soil)2020-04-20v4No1 / 1682
821sheryoHigher at 10-25cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in restored prairie corn miscanthus panicum virgatum kellogg biological station mesic type hapludalf kalamazoo loam state of michigan soil united states of america )2021-08-05v4No1 / 1704
616amnoncommon in topsoil of PK/NP/NPK/NK fertilized sugarcane field (common depth (soil) 0-20cm, fertilized soil, ph 5.5-6, sugarcane, saccharum, soil, topsoil, china, guangzhou city prefecture)2020-04-27v3No1 / 1710
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
842sheryoHigher in soil depth of 0-15cm compared to 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in luvisol dipsacus fullonum solidago apocynum daucus carota decomissioned agricultural field meadow ecosystem grand river watershed rare charitable research reserve cambridge province of ontario canada soil )2021-11-14v3No1 / 1723
571amnoncommon depth (soil) 0-20cm, china, soil, mangrove swamp, marine sediment, zhejiang province, spartina alterniflora, futian national nature reserve2019-12-16v4No1 / 1747
631sheryoCommon in maize field unamended bulk soil (common bulk soil, unamended soil, ph 7.9, maize field, soil, kaiyang county, guizhou province, china)2020-06-02v3No1 / 1814
631sheryocommon in maize field biochar amended bulk soil, after 6 years of biochar amended (common ph 8, china, guizhou province, kaiyang county, soil, maize field, bulk soil, biochar, after 6 years)2020-06-02v3No1 / 1872
156amnoncommon soil, rhizosphere, brassica, brassica oleracea, china2017-07-27v4No1 / 1885
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>4, ph<5, china2018-02-11v4No1 / 1886
263amnonlower in heat stressed soil (65C) compared to control ( high in control compared to heat stressed soil in soil israel sandy loam soil negev desert ph 7-8 irrigated research facility )2017-12-11v4No1 / 1893
824sheryoCommon in soil after 0-9 years of grazing exclusion at 0-10cm depth, Ningxia china (common depth (soil) 0-10cm, 0-9 years of grazing exclusion, yunwushan national natural grassland protection zone, ningxia province, calci-orthic aridisol, haplic calcisol, grazing exclusion, china, soil)2021-08-08v4No1 / 1903
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common kellogg biological station, mesic type hapludalf, kalamazoo loam, panicum virgatum, depth (soil) 0-10cm, state of michigan, soil, united states of america)2021-08-02v4No1 / 2067
175amnoncommon in heavy metal contaminated soils in china (common soil, heavy metal, ph 7-9, china)2017-07-29v4No1 / 2133
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>7, ph<8, china2018-02-11v4No1 / 2160
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>6, ph<7, china2018-02-11v4No1 / 2223
76amnonhigher in seleniferous soil compared to non-seleniferous soil ( high in selenium seleniferous compared to non-seleniferous in soil rhizosphere united states of america woodland area )2017-02-28v4No1 / 2259
296amnoncommon in wheat field soil (common soil, north china plain, depth 5cm, agricultural feature, wheat, winter, china)2018-02-11v4No1 / 2341
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
101amnoncommon state of new york, vitis vinifera, united states of america, merlot, grapevine, soil2017-04-03v4No1 / 2537
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>8, china2018-02-11v4No1 / 2646
265amnon high in soil compared to soilwater water in canada province of quebec 2017-12-11v4No1 / 2715
357amnon high in ph>4.5 compared to ph<4.5 in soil topsoil depth (soil) 0-10cm moist tropical forest woodland area forest ecosystem 2018-08-18v4No1 / 2773
271amnoncommon depth (soil) 0-20cm, soil, china2018-01-09v4No1 / 2856
84amnoncommon depth 20cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-06v4No1 / 2866
837sheryoHigher in soil of agricultural feild compared to after 20 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 20 years robinia pseudoacacia reforestation in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2892
837sheryoHigher in soil of agricultural feild compared to after 30 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to robinia pseudoacacia 30 years reforestation in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 2927
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 10 years reforestation robinia pseudoacacia in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2994
422amnon high in ph 7-8 compared to ph 5-6 in soil paddy field soil oryza sativa heilongjiang province cultivated environment china 2018-12-04v4No1 / 3267
265amnon high in soilwater water compared to soil in canada province of quebec 2017-12-11v4No1 / 3277
837sheryoHigher in soil after 10 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 10 years compared to 30 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3368
84amnoncommon depth 5cm, soil, temperate grassland biome, fen, peat soil, flooded grassland biome, united kingdom2017-03-07v4No1 / 3434
296amnoncommon depth (soil) 0-20cm, soil, north china plain, agricultural feature, wheat, winter, ph>5, ph<6, china2018-02-11v4No1 / 3508
837sheryoHigher in soil after 10 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 10 years compared to 20 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3585
237amnonhigher in burrow soil compared to bird ( high in soil burrow compared to bird seabird oceanodroma leucorhoa in canada bon portage island )2017-11-07v4No1 / 3656
837sheryoHigher in soil after 20 years compared to 30 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 30 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3893
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 10 years compared to agricultural field wheat zea mays in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 3932
837sheryoHigher in soil after 30 years compared to 20 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 20 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 3936
100amnon high in ph ph<5.5 compared to ph>5.5 in soil urban biome park new york city central park 2017-04-03v4No1 / 4262
271amnon high in soil compared to rhizosphere glycine max soybean in depth (soil) 0-20cm china 2018-01-09v4No1 / 4853
837sheryoHigher in soil after 30 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 30 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5245
837sheryoHigher in soil after 20 years compared to 10 years of reforestation with Black locust trees, shaanxi, China ( high in 20 years compared to 10 years in robinia pseudoacacia reforestation silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5270
100amnon high in ph ph>6 compared to ph<6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5365
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 5661
100amnon high in ph ph<6 compared to ph>6 in soil urban biome park new york city central park 2017-04-03v4No1 / 5770
171amnonlower in roots compared to rhizosphere soil in rice ( high in rhizosphere soil compared to root in united states of america state of california oryza sativa rice )2017-07-25v4No1 / 7628
271amnon high in soil rhizosphere compared to root structure root in depth (soil) 0-20cm glycine max soybean china 2018-01-09v4No1 / 7954

Problems / suggestions? Please email info AT dbbact DOT org