Summary for ontology term: south america

Number of annotations with term: 308

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.013115
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.013115
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__CoprococcusTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGCGGAGCAAGTCAGAAGTGAAAGCCCGGGGCTCAACCCCGGGACGGCTTTTGAAACTGCCCTGCTTGATTTCAGGAGAGGTAAGCGGAATTCCTAG0.013115
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGAATGCAAGTCAGATGTGAAATCCATGGGCTTAACCCATGAACTGCATTTGAAACTGTATTTCTTGAGTACTGGAGAGGCAATCGGAATTCCTAG0.013115
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGATGGCAAGTCAGATGTGAAATCCATGGGCTCAACCCATGAACTGCATTTGAAACTGTCGTTCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.013115
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACATCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.013115
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__HoldemanellaTACGTAGGTGGCGAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGTAGGTGGCAGAACAAGTCTGGAGTAAAAGGTATGGGCTCAACCCGTACTGGCTCTGGAAACTGTTCAGCTAGAGAACAGAAGAGGACGGCGGAACTCCATGT0.013115
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__HoldemanellaTACGTAGGTGGCGAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGTAGGTGGCAGATCAAGTCTGGAGTAAAAGGTATGGGCTCAACCCGTACTGGCTCTGGAAACTGATCAGCTAGAGAACAGAAGAGGACGGCGGAACTCCATGT0.013115
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTATTAAGTCTGGTGTAAAAGGCAGTGGCTCAACCATTGTATGCATTGGAAACTGGTAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGT0.009836
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTGAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.009836

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCATGATAAGTCTGATGTGAAAACCCAAGGCTCAACCATGGGACTGCATTGGAAACTGTCGTGCTGGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.272727
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.272727
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.272727
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__TuricibacterTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTGATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTCAACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.272727
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGGTTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAATTGATACTGGCAGTCTTGAGTACAGTTGAGGTAGGCGGAATTCGTGG0.272727
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAAGGCAAGTCAGATGTGAAAGCCCGGGGCTCAACCCCGGTATTGCATTTGAAACTGTTTAGCTAGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.272727
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.181818
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATTCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.181818
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCACAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGTGGTTATGTAAGTCTGATGTGAAAATGCAGGGCTCAACTCTGTATTGCGTTGGAAACTGCATGACTAGAGTACTGGAGAGGTAAGCGGAACTACAAGT0.181818
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAAAGCAAGTTGGAAGTGAAATGCATGGGCTTAACCCATGAGCTGCTTTCAAAACTGTTTTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAG0.181818

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.148216
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACATCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.131796
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp3;g__Gp3TACGTAGGCAGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGAGTGTGTAGGCGGTGCTCTAAGTTCGGTGTGAAATCTCCTGGCTTAACTGGGAGGGTGCGCCGGAAACTGGAGTGCTCGAGCGTGGGAGAGGAAAGCGGAATTCCTGG0.112601
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGAGTACGTAGGTGGTTTATTAAGTCAGATGTGAAATCCCTGAGCTTAACTTAGGAACTGCATTTGAAACTGATAAACTAGAGTTTCGTAGAGGGGGGTAGAATTCCAGG0.111111
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.110092
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGAGGGCAAGTCAGATGTGAAATCCACGGGCTCAACTCGTGAACTGCATTTGAAACTACTCTTCTTGAGTATCGGAGAGGCAATCGGAATTCCTAG0.107486
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__Sphingobacteriaceae;g__SphingobacteriumTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTATTAAGTCAGGGGTGAAATACGGTGGCTCAACCATCGCAGTGCCTTTGATACTGATGGGCTTGAATCCATTTGAAGTGGGCGGAATAAGACA0.106977
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__ChryseobacteriumTACGGAGGGTGCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTCCGTAGGCGGATCTGTAAGTCAGTGGTGAAATCTCACAGCTTAACTGTGAAACTGCCATTGATACTGCAGGTCTTGAGTGTTGTTGAAGTAGCTGGAATAAGTAG0.106599
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Aeromonadales;f__Succinivibrionaceae;g__SuccinivibrioTACGGAGGGTGCAAGCGTTAATCGGAATAACTGGGCGTAAAGGGCATGCAGGCGGTTCATCAAGTAGGATGTGAAATCCCCGGGCTCAACCTGGGAACAGCATACTAAACTGGTGGACTAGAGTATTGCAGGGGGAGACGGAATTCCAGG0.105263
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.100200

Annotations:

common ontology terms
term enrichment score
TermScore
brazil0.621924
peru0.158470
minas gerais state0.144444
campos rupestres0.144444
ecuador0.129870
colombia0.129870
bolivia0.125000
campinas0.114943
amerindian0.112927
venezuela0.112927
sao paulo state0.110429
city0.109091
galapagos islands0.107463
hunter gatherer0.106892
homo sapiens0.105010
ants0.104651
tropical moist broadleaf forest biome0.104651
ant0.099448
saccharum0.099448
sugarcane0.099448
mouth0.098765
rural community0.097353
greenhouse0.093458
skin0.088889
age 5-13 years0.085106
feces0.081965
argentina0.081633
frog0.076923
adult0.076142
atlantic rainforest0.075000
parque estadual serra do mar-núcleo picinguaba0.075000
subgingival plaque0.074766
vellozia epidendroides0.072289
finch0.072289
liolaemus ruibali0.072289
chuquisaca department0.072289
digestive system0.071279
child0.066421
pond0.064516
odontomachus chelifer0.062893
stomach0.062127
leaf0.061538
barbacenia macrantha0.060976
intestine0.059642
cuticle0.056782
chitin-based cuticle0.056782
gaster0.055215
body proper0.054348
dentition0.053812
saliva0.053097
odontomachus hastatus0.050633
bird0.050420
la rioja province0.049383
lago grande do curuai0.049383
river amazon0.049383
wild0.048780
stem0.047619
tick0.047059
depth (water) 1m0.047059
lake water0.047059
rhizosphere0.045802
kingdom of spain0.044720
periodontitis0.044444
fresh water0.043668
leaf endosphere0.043478
coffea arabica0.043478
root0.043478
endosphere0.041667
whole body0.040404
mouse0.040201
mus musculus0.037915
arm0.037855
exosphere0.037500
marine iguana0.037500
amblyrhynchus cristatus0.037500
cloacal swab0.037500
alimentary part of gastrointestinal system0.036810
water0.034305
balb/c0.033708
soil0.033629
cloaca0.033149
medellin metropolitan area0.031696
depth < 3mm0.031447
shallow pocket depth0.031447
leaf surface0.031201
filtered 2.7um0.030488
particle bound0.030488
south america0.027650
caecum0.027473
infant0.026110
dendropsophus minutus0.025478
shuar population0.025316
small village0.025316
teenager0.025316
age 9-17 years0.025316
daycare0.025316
1-5-years-old human0.025316
lesser foam frog0.025316
upper stem0.025316
santa catarina state0.025316
Fraction of dbbact annotations with this term covered by the query
TermScore
brazil1.000000
LOWER IN chitin-based cuticle1.000000
LOWER IN cuticle1.000000
atlantic rainforest1.000000
parque estadual serra do mar-núcleo picinguaba1.000000
sao paulo state1.000000
odontomachus hastatus1.000000
cuticle1.000000
chitin-based cuticle1.000000
LOWER IN odontomachus chelifer1.000000
LOWER IN odontomachus hastatus1.000000
odontomachus chelifer1.000000
LOWER IN reserva biológica de mogi-guaçu1.000000
LOWER IN parque estadual serra do mar-núcleo picinguaba1.000000
LOWER IN atlantic rainforest1.000000
reserva biológica de mogi-guaçu1.000000
bolivia0.750000
ecuador0.714286
colombia0.714286
stem endosphere0.666667
galapagos islands0.666667
age 5-13 years0.666667
amerindian0.666667
venezuela0.666667
arm0.666667
medellin metropolitan area0.666667
dendropsophus minutus0.666667
shuar population0.500000
LOWER IN upano valley0.500000
cross-cutucu0.500000
LOWER IN cross-cutucu0.500000
upano valley0.500000
minas gerais state0.500000
campos rupestres0.500000
ph 3.50.500000
vellozia epidendroides0.500000
leaf endosphere0.500000
barbacenia macrantha0.500000
LOWER IN digestive tract0.500000
digestive tract0.500000
el salvador0.500000
small village0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
shantytown0.500000
lima0.500000
LOWER IN el salado0.500000
LOWER IN small village0.500000
low income0.500000
LOWER IN sewage0.500000
sewage0.500000
linepithema humile0.500000
argentine ant0.500000
peru0.500000
carpenter ant0.500000
myrmelachista0.500000
ants0.500000
dolichoderus0.500000
turtle ants0.500000
azteca0.500000
coffea arabica0.500000
dry processing0.500000
wet processing0.500000
finch0.500000
camarhynchus parvulus0.500000
small tree finch0.500000
geospiza fortis0.500000
medium ground finch0.500000
geospiza scandens0.500000
common cactus finch0.500000
start0.500000
LOWER IN start0.500000
odontomachus0.500000
solenopsis0.500000
low hdl0.500000
LOWER IN high hdl0.500000
high hdl0.500000
LOWER IN low hdl0.500000
curitiba microregion0.500000
fermented milk0.500000
gaster0.500000
tropical moist broadleaf forest biome0.500000
LOWER IN gaster0.500000
LOWER IN savanna0.500000
savanna0.500000
clavelina oblonga0.500000
harbor0.500000
inner tunic0.500000
neoponera0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
external ear0.500000
urocyon littoralis0.500000
quito0.500000
geospiza difficilis0.500000
sharp-beaked ground finch0.500000
geospiza fuliginosa0.500000
small ground finch0.500000
brown dog tick0.500000
rhipicephalus sanguineus0.500000
Fraction of annotations for the query sequences containing the term
TermScore
brazil0.451299
homo sapiens0.334416
feces0.243506
adult0.178571
digestive system0.110390
peru0.094156
minas gerais state0.084416
campos rupestres0.084416
city0.077922
ecuador0.071429
colombia0.071429
skin0.071429
mouth0.071429
bolivia0.068182
campinas0.064935
greenhouse0.064935
rural community0.061688
hunter gatherer0.061688
amerindian0.061688
venezuela0.061688
research facility0.058442
ants0.058442
galapagos islands0.058442
tropical moist broadleaf forest biome0.058442
sao paulo state0.058442
ant0.058442
child0.058442
saccharum0.058442
sugarcane0.058442
mouse0.051948
mus musculus0.051948
subgingival plaque0.051948
intestine0.048701
saliva0.045455
leaf0.045455
argentina0.045455
age 5-13 years0.045455
frog0.045455
pond0.045455
stomach0.042208
vellozia epidendroides0.038961
bird0.038961
finch0.038961
atlantic rainforest0.038961
parque estadual serra do mar-núcleo picinguaba0.038961
liolaemus ruibali0.038961
dentition0.038961
chuquisaca department0.038961
rhizosphere0.035714
wild0.035714
barbacenia macrantha0.032468
body proper0.032468
odontomachus chelifer0.032468
united states of america0.032468
caecum0.032468
fresh water0.032468
water0.032468
soil0.029221
gaster0.029221
cuticle0.029221
chitin-based cuticle0.029221
kingdom of spain0.029221
root0.025974
stem0.025974
odontomachus hastatus0.025974
whole body0.025974
la rioja province0.025974
tick0.025974
periodontitis0.025974
depth (water) 1m0.025974
lago grande do curuai0.025974
river amazon0.025974
lake water0.025974
leaf endosphere0.022727
coffea arabica0.022727
endosphere0.022727
balb/c0.019481
south america0.019481
arm0.019481
control0.019481
exosphere0.019481
marine iguana0.019481
amblyrhynchus cristatus0.019481
cloacal swab0.019481
alimentary part of gastrointestinal system0.019481
cloaca0.019481
infant0.016234
leaf surface0.016234
LOWER IN feces0.016234
LOWER IN united states of america0.016234
depth < 3mm0.016234
shallow pocket depth0.016234
medellin metropolitan area0.016234
filtered 2.7um0.016234
particle bound0.016234
cultivated environment0.012987
shuar population0.012987
village0.012987
small village0.012987
small intestine0.012987
Exp. ID User ID Description Date Region Flag Sequences
67amnondominant bacteria in coffee beans during fermentation (other coffea arabica, ecuador)2017-02-19v4No1 / 1
932amnon high in odontomachus hastatus compared to odontomachus chelifer in atlantic rainforest parque estadual serra do mar-núcleo picinguaba sao paulo state cuticle chitin-based cuticle ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 1
184amnoncommon peru, digestive system, dolichoderus, ants2017-08-15v4No1 / 2
184amnoncommon peru, digestive system, cephalotes, turtle ants2017-08-15v4No1 / 2
727amnondominant red sheep tick, haemaphysalis punctata, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 2
67amnonincreases during fermentation of coffee beans ( high in end compared to start in coffea arabica ecuador )2017-02-19v4No1 / 3
727amnondominant brown dog tick, rhipicephalus sanguineus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 3
482amnonlower in kids with parasitic worms compared to non-infected kids ( high in control compared to trichuriasis in homo sapiens feces colombia medellin metropolitan area child daycare 1-5-years-old human )2019-02-12v4No1 / 3
727amnondominant ornate sheep tick, dermacentor marginatus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 3
615amnondominant saccharum, sugarcane, rhizosphere, campinas, brazil, greenhouse2020-04-27v4No1 / 3
32amnon high in infant compared to adult in homo sapiens saliva bolivia 2016-12-05v4No1 / 4
184amnondominant peru, digestive system, myrmelachista, ants2017-08-15v4No1 / 4
184amnoncommon peru, digestive system, ants, pseudomyrmex2017-08-15v4No1 / 4
440amnoncommon galapagos islands, feces, bird, finch, geospiza fortis, medium ground finch2019-01-06v4No1 / 4
440amnoncommon galapagos islands, feces, bird, finch, geospiza scandens, common cactus finch2019-01-06v4No1 / 4
404amnonnegatively correlated with hdl levels ( high in low hdl compared to high hdl in colombia city adult feces homo sapiens )2019-01-10v4No1 / 4
71amnonhigher in stomach in lizards eating mixed diet (plant+insects) compared to only plant diet ( high in diet mixed compared to high fiber in liolaemus ruibali stomach research facility argentina )2017-02-25v4No1 / 4
733amnon high in lake compared to aquatic/terrestrial transition zone in filtered 2.7um particle bound depth (water) 1m lago grande do curuai river amazon lake water fresh water water brazil 2021-01-17v3No1 / 4
548amnondominant minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 5
548amnondominant minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 5
182amnondominant argentina, linepithema humile, argentine ant, body proper2017-08-15v4No1 / 5
184amnoncommon peru, camponotus, carpenter ant, digestive system2017-08-15v4No1 / 5
184amnoncommon peru, digestive system, ants, solenopsis2017-08-15v4No1 / 5
692amnondominant curitiba microregion, brazil, fermented beverage, fermented milk2028-03-16v4No1 / 5
184amnoncommon peru, digestive system, ants, neoponera2017-08-15v4No1 / 5
440amnoncommon galapagos islands, feces, bird, finch, green warbler-finch, certhidea olivacea2019-01-06v4No1 / 5
96amnon high in control compared to systemic lupus erythematosus in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 5
97amnondominant calophya, adult, brazil, state of florida2017-04-01v4No1 / 5
499amnondominant digestive system, pond, intestine, brazil, remartinia, aeshnidae, dragonfly, larval stage2019-03-05v4No1 / 5
548amnonhigh freq in phosphorus impoverished soil (dominant soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 6
548amnondominant minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 6
548amnondominant minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 6
184amnondominant peru, digestive system, azteca, ants2017-08-15v4No1 / 6
67amnondisappears during fermentation of coffee beans ( high in start compared to end in coffea arabica ecuador )2017-02-19v4No1 / 6
932amnon high in odontomachus chelifer compared to odontomachus hastatus in atlantic rainforest parque estadual serra do mar-núcleo picinguaba sao paulo state cuticle chitin-based cuticle ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 6
932amnon high in reserva biológica de mogi-guaçu savanna compared to parque estadual serra do mar-núcleo picinguaba atlantic rainforest in odontomachus chelifer sao paulo state cuticle chitin-based cuticle ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 6
440amnoncommon galapagos islands, feces, bird, finch, geospiza fuliginosa, small ground finch2019-01-06v4No1 / 6
482amnonhigher in kids with parasitic worms compared to non-infected kids ( high in trichuriasis compared to control in homo sapiens feces colombia medellin metropolitan area child daycare 1-5-years-old human )2019-02-12v4No1 / 6
615amnondominant endosphere, root, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 6
182amnoncommon argentina, linepithema humile, argentine ant, body proper2017-08-15v4No1 / 7
184amnoncommon peru, digestive system, azteca, ants2017-08-15v4No1 / 7
184amnondominant peru, digestive system, ants, crematogaster2017-08-15v4No1 / 7
184amnondominant peru, digestive system, ants, solenopsis2017-08-15v4No1 / 7
932amnoncommon odontomachus chelifer, sao paulo state, ant, gaster, brazil, stomach, tropical moist broadleaf forest biome2022-08-30v4No1 / 7
932amnondominant odontomachus chelifer, sao paulo state, ant, gaster, brazil, stomach, tropical moist broadleaf forest biome2022-08-30v4No1 / 7
932amnon high in reserva biológica de mogi-guaçu savanna compared to parque estadual serra do mar-núcleo picinguaba atlantic rainforest in odontomachus chelifer sao paulo state ant gaster brazil stomach tropical moist broadleaf forest biome 2022-08-30v4No1 / 7
727amnoncommon brown dog tick, rhipicephalus sanguineus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 7
378amnon high in periodontitis compared to control in homo sapiens brazil subgingival plaque dentition adult mouth 2018-09-14v4No1 / 7
415amnondominant rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 8
184amnondominant peru, digestive system, dolichoderus, ants2017-08-15v4No1 / 8
440amnoncommon galapagos islands, feces, bird, finch, camarhynchus parvulus, small tree finch2019-01-06v4No1 / 8
184amnondominant peru, digestive system, ants, odontomachus2017-08-15v4No1 / 8
932amnoncommon stomach, gaster, atlantic rainforest, parque estadual serra do mar-núcleo picinguaba, odontomachus hastatus, sao paulo state, ant, brazil, tropical moist broadleaf forest biome2022-08-30v4No1 / 8
184amnondominant peru, digestive system, ants, eciton2017-08-15v4No1 / 8
184amnondominant peru, digestive system, ants, neoponera2017-08-15v4No1 / 8
440amnoncommon galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v4No1 / 8
440amnondominant galapagos islands, feces, bird, finch, green warbler-finch, certhidea olivacea2019-01-06v4No1 / 8
71amnonhigher in small intestine of lizards on plant only diet compared to mixed (plant+insects) ( high in diet high fiber compared to mixed in liolaemus ruibali argentina research facility small intestine )2017-02-25v4No1 / 8
474amnondominant farm, soil, soybean, glycine max, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 8
727amnoncommon red sheep tick, haemaphysalis punctata, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 8
733amnon high in aquatic/terrestrial transition zone compared to lake in filtered 2.7um particle bound depth (water) 1m lago grande do curuai river amazon lake water fresh water water brazil 2021-01-17v3No1 / 8
615amnondominant in control soil with no sugarcane (dominant campinas, brazil, greenhouse, soil)2020-04-27v4No1 / 8
517amnondominant homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 8
932amnondominant atlantic rainforest, parque estadual serra do mar-núcleo picinguaba, odontomachus hastatus, sao paulo state, cuticle, chitin-based cuticle, ant, brazil, tropical moist broadleaf forest biome2022-08-30v4No1 / 9
304amnondominant united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-12v4No1 / 9
932amnondominant odontomachus chelifer, sao paulo state, cuticle, chitin-based cuticle, ant, brazil, tropical moist broadleaf forest biome2022-08-30v4No1 / 10
71amnondominant liolaemus ruibali, small intestine, argentina, research facility2017-02-25v4No1 / 10
378amnon high in control compared to periodontitis in homo sapiens brazil subgingival plaque dentition adult mouth 2018-09-14v4No1 / 10
727amnoncommon ornate sheep tick, dermacentor marginatus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 10
740amnon high in male male organism compared to female female organism in marine iguana amblyrhynchus cristatus ecuador galapagos islands cloacal swab alimentary part of gastrointestinal system cloaca 2021-02-08v4No1 / 10
304amnondominant united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 10
548amnonhigh freq. in endopytic roots of Vellozia epidendroides (dominant minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 11
184amnondominant peru, camponotus, carpenter ant, digestive system2017-08-15v4No1 / 11
184amnondominant peru, digestive system, ants, pseudomyrmex2017-08-15v4No1 / 11
932amnondominant atlantic rainforest, parque estadual serra do mar-núcleo picinguaba, odontomachus hastatus, sao paulo state, ant, gaster, brazil, stomach, tropical moist broadleaf forest biome2022-08-30v4No1 / 11
371amnondominant feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 11
386amnondominant mouse, mus musculus, caecum, wild, bolivia2018-10-28v4No1 / 11
96amnon high in systemic lupus erythematosus compared to control in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 11
499amnondominant brazil, pond, digestive system, intestine, dendropsophus minutus, frog, tadpole2019-03-05v4No1 / 11
757amnon high in female compared to male in feces adult santa catarina state brazil homo sapiens 2021-03-28v3No1 / 11
328amnondominant mouse, mus musculus, brazil, research facility, adult, balb/c, feces2018-04-30v4No1 / 12
548amnondominant minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf endosphere2019-08-17v4No1 / 12
67amnonhigh freq. in wet processing of coffee beans (dominant coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 12
440amnondominant galapagos islands, feces, bird, finch, geospiza scandens, common cactus finch2019-01-06v4No1 / 12
184amnoncommon peru, digestive system, ants, crematogaster2017-08-15v4No1 / 12
932amnoncommon cuticle, chitin-based cuticle, odontomachus chelifer, sao paulo state, ant, brazil, tropical moist broadleaf forest biome2022-08-30v4No1 / 12
440amnondominant galapagos islands, feces, bird, finch, geospiza difficilis, sharp-beaked ground finch2019-01-06v4No1 / 12
71amnondominant liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 12
75amnondominant homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 12
727amnondominant ixodes ricinus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 12
932amnon high in atlantic rainforest parque estadual serra do mar-núcleo picinguaba compared to savanna reserva biológica de mogi-guaçu in odontomachus chelifer sao paulo state cuticle chitin-based cuticle ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 13
492amnondominant brazil, skin, frog, dendropsophus minutus, lesser treefrog, adult2019-02-27v4No1 / 13
492amnondominant brazil, skin, adult, lesser foam frog, scinax perereca, frog2019-02-27v4No1 / 13
97amnoncommon calophya, adult, brazil, state of florida2017-04-01v4No1 / 13
615amnondominant leaf endosphere, leaf, endosphere, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 13
404amnon high in male compared to female in feces homo sapiens city adult colombia 2018-11-20v4No1 / 13
517amnondominant homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 13
371amnondominant homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 14
386amnondominant mouse, mus musculus, caecum, wild, ecuador2018-10-28v4No1 / 14
499amnondominant ranatra, water stick-insect, brazil, pond, digestive system, intestine2019-03-05v4No1 / 14
499amnondominant brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 14
499amnondominant brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 14
404amnon high in high bmi obesity compared to lean body mass low bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 14
548amnondominant minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 15
328amnondominant mouse, mus musculus, brazil, research facility, adult, balb/c, intestine, mucosa, digestive tract2018-04-30v4No1 / 15
440amnondominant galapagos islands, feces, bird, finch, camarhynchus parvulus, small tree finch2019-01-06v4No1 / 15
371amnonNEGATIVELY correlated with age in amerindians ( high in infant obsolete_juvenile stage compared to adult in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 15
371amnondominant homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v4No1 / 15
75amnondominant homo sapiens, feces, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 15
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 15
517amnondominant feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 15
548amnonhigh freq. in leaf surface of barbacenia macrantha (dominant minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 16
67amnonhigh freq. in dry processing of coffee beans (dominant coffea arabica, ecuador, dry processing)2017-02-19v4No1 / 16
440amnondominant galapagos islands, feces, bird, finch, geospiza fortis, medium ground finch2019-01-06v4No1 / 16
692amnoncommon curitiba microregion, brazil, fermented beverage, fermented milk2028-03-16v4No1 / 16
932amnoncommon chitin-based cuticle, cuticle, atlantic rainforest, parque estadual serra do mar-núcleo picinguaba, odontomachus hastatus, sao paulo state, ant, brazil, tropical moist broadleaf forest biome2022-08-30v4No1 / 16
932amnon high in odontomachus hastatus compared to odontomachus chelifer in stomach gaster atlantic rainforest parque estadual serra do mar-núcleo picinguaba sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 16
371amnonnegatively correlated with age in amerindian saliva ( high in obsolete_juvenile stage infant compared to adult in homo sapiens venezuela hunter gatherer amerindian saliva )2018-09-06v4No1 / 16
492amnondominant skin, adult, rana catesbeiana, lithobates catesbeianus, bullfrog, brazil, frog2019-02-27v4No1 / 16
499amnondominant brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 16
660amnondominant shuar population, village, rural community, ecuador, feces, homo sapiens2020-09-20v4No1 / 17
32amnondominant homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 17
32amnondominant homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 17
548amnondominant minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf, leaf endosphere2019-08-17v4No1 / 17
184amnoncommon peru, digestive system, myrmelachista, ants2017-08-15v4No1 / 17
404amnonpositively correlated with hdl levels ( high in high hdl compared to low hdl in colombia city adult feces homo sapiens )2019-01-10v4No1 / 17
71amnondominant liolaemus ruibali, argentina, research facility, feces2017-02-25v4No1 / 17
371amnonpositively correlated with age in amerindian saliva ( high in adult compared to obsolete_juvenile stage infant in homo sapiens venezuela hunter gatherer amerindian saliva )2018-09-06v4No1 / 17
386amnondominant mouse, mus musculus, caecum, wild, brazil2018-10-28v4No1 / 17
492amnondominant brazil, skin, adult, leptodactylus latrans, frog, lesser foam frog2019-02-27v4No1 / 17
733amnondominant filtered 2.7um, particle bound, depth (water) 1m, lago grande do curuai, river amazon, lake water, fresh water, water, brazil2021-01-17v3No1 / 17
499amnondominant brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 17
548amnonhigh freq. on leaf surface (dominant minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v4No1 / 18
184amnondominant peru, digestive system, cephalotes, turtle ants2017-08-15v4No1 / 18
932amnon high in odontomachus chelifer compared to odontomachus hastatus in atlantic rainforest parque estadual serra do mar-núcleo picinguaba sao paulo state ant gaster brazil stomach tropical moist broadleaf forest biome 2022-08-30v4No1 / 18
440amnondominant galapagos islands, feces, bird, finch, geospiza fuliginosa, small ground finch2019-01-06v4No1 / 18
492amnondominant brazil, skin, adult, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 18
95amnonhigh freq. in root canal (dominant homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 18
615amnondominant stem surface, upper stem, stem, exosphere, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 18
772amnondominant in sediment from southern colombian caribbean sea (dominant depth (water) 2000-5000m, depth (water) 1000-2000m, sediment, colombia, caribbean sea, depth (water) 2000-3000m, marine sediment)2021-04-22v3No1 / 18
449amnondominant homo sapiens, feces, colombia2019-01-09v4No1 / 19
482amnondominant homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, 1-5-years-old human2019-02-12v4No1 / 19
276amnondominant feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 19
615amnondominant exosphere, leaf surface, leaf, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 19
757amnondominant feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v3No1 / 19
404amnondominant homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 19
328amnonlower in feces compared to intestinal mucosa in mice ( high in mucosa intestine digestive tract compared to feces in mouse mus musculus brazil research facility adult balb/c )2018-04-30v4No1 / 20
184amnoncommon peru, digestive system, ants, odontomachus2017-08-15v4No1 / 20
184amnoncommon peru, digestive system, ants, eciton2017-08-15v4No1 / 20
238amnondominant homo sapiens, feces, colombia2017-11-07v4No1 / 20
492amnondominant skin, adult, chile, eupsophus vertebralis, frog2019-02-27v4No1 / 20
105amnondominant brazil, homo sapiens, dentition, pulpitis, mouth2017-04-05v4No1 / 20
740amnondominant marine iguana, amblyrhynchus cristatus, ecuador, galapagos islands, cloacal swab, alimentary part of gastrointestinal system, cloaca2021-02-08v4No1 / 20
548amnondominant minas gerais state, campos rupestres, brazil, vellozia epidendroides, stem2019-08-17v4No1 / 21
932amnon high in gaster stomach compared to chitin-based cuticle cuticle in atlantic rainforest tropical moist broadleaf forest biome parque estadual serra do mar-núcleo picinguaba sao paulo state brazil odontomachus hastatus ant 2022-08-30v4No1 / 21
75amnondominant homo sapiens, saliva, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 21
733amnondominant filtered 0.2um, free floating, depth (water) 1m, lago grande do curuai, river amazon, lake water, fresh water, water, brazil2021-01-17v3No1 / 21
740amnon high in high body condition index compared to low body condition index in marine iguana amblyrhynchus cristatus ecuador galapagos islands cloacal swab alimentary part of gastrointestinal system cloaca 2021-02-08v4No1 / 21
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 22
96amnondominant homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 22
404amnonpositively correlated with fiber intake ( high in plant fiber cell high filber compared to low fiber in homo sapiens feces adult colombia city )2018-11-20v4No1 / 22
120amnondominant homo sapiens, feces, brazil2017-04-12v4No1 / 22
71amnondominant liolaemus ruibali, colon, hindgut, argentina, research facility2017-02-25v4No1 / 23
830amnondominant homo sapiens, feces, age 9-17 years, teenager, peru2021-09-10v4No1 / 23
492amnoncommon skin, adult, brazil, rana catesbeiana, bullfrog, lithobates catesbeianus, frog2019-02-27v4No1 / 23
371amnonhigher in saliva of amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in homo sapiens saliva )2018-09-06v4No1 / 24
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, depth > 3mm, deep pocket depth, periodontitis, mouth2018-09-14v4No1 / 24
96amnon high in control compared to periodontitis in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 24
53amnondominant lima, homo sapiens, feces, city, shantytown2017-01-21v4No1 / 25
740amnon high in low body condition index compared to high body condition index in marine iguana amblyrhynchus cristatus ecuador galapagos islands cloacal swab alimentary part of gastrointestinal system cloaca 2021-02-08v4No1 / 25
499amnoncommon ranatra, water stick-insect, brazil, pond, digestive system, intestine2019-03-05v4No1 / 26
371amnonpositively correlated with age in amerindians ( high in adult compared to infant obsolete_juvenile stage in feces homo sapiens venezuela hunter gatherer amerindian )2018-09-06v4No1 / 27
562amnondominant feces, quito, ecuador, child, age 5-13 years2019-11-05v4No1 / 28
378amnon high in depth < 3mm shallow pocket depth compared to depth > 3mm deep pocket depth in homo sapiens brazil subgingival plaque dentition adult periodontitis mouth 2018-09-13v4No1 / 28
492amnoncommon brazil, skin, adult, lesser foam frog, scinax perereca, frog2019-02-27v4No1 / 30
492amnoncommon brazil, skin, frog, dendropsophus minutus, lesser treefrog, adult2019-02-27v4No1 / 31
740amnon high in female female organism compared to male organism male in marine iguana amblyrhynchus cristatus ecuador galapagos islands cloacal swab alimentary part of gastrointestinal system cloaca 2021-02-08v4No1 / 31
404amnonnegatively correlated with fiber intake ( high in low fiber compared to plant fiber cell high fiber in homo sapiens feces adult colombia city )2018-11-20v4No1 / 32
71amnoncommon liolaemus ruibali, small intestine, argentina, research facility2017-02-25v4No1 / 33
492amnoncommon brazil, skin, adult, leptodactylus latrans, frog, lesser foam frog2019-02-27v4No1 / 34
378amnon high in deep pocket depth depth > 3mm compared to shallow pocket depth depth < 3mm in homo sapiens brazil subgingival plaque dentition adult periodontitis mouth 2018-09-13v4No1 / 40
95amnoncommon in root canal (common homo sapiens, brazil, tooth, root canal)2017-03-12v4No1 / 42
371amnoncommon homo sapiens, venezuela, hunter gatherer, amerindian, saliva2018-09-06v4No1 / 43
757amnon high in male compared to female in feces adult santa catarina state brazil homo sapiens 2021-03-28v3No1 / 44
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, mouth mucosa, mouth2019-05-29v4No1 / 44
32amnoncommon homo sapiens, saliva, bolivia, infant2016-12-05v4No1 / 46
733amnon high in filtered 0.2um free floating compared to filtered 2.7um particle bound in depth (water) 1m lago grande do curuai river amazon lake water fresh water water brazil 2021-01-17v3No1 / 46
830amnoncommon peru, teenager, age 9-17 years, feces, homo sapiens2021-09-10v4No1 / 47
482amnoncommon homo sapiens, feces, colombia, medellin metropolitan area, child, daycare, 1-5-years-old human2019-02-12v4No1 / 47
96amnon high in periodontitis compared to control in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 48
932amnon high in atlantic rainforest parque estadual serra do mar-núcleo picinguaba compared to savanna reserva biológica de mogi-guaçu in stomach gaster odontomachus chelifer sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 51
830amnon high in iga igg negative fraction iga negative fraction compared to iga positive fraction in peru teenager age 9-17 years feces homo sapiens 2021-09-10v4No1 / 52
492amnoncommon skin, adult, chile, eupsophus vertebralis, frog2019-02-27v4No1 / 55
67amnoncommon in wet processing of coffee beans (common coffea arabica, ecuador, wet processing)2017-02-19v4No1 / 59
32amnon high in adult compared to infant in homo sapiens saliva bolivia 2016-12-05v4No1 / 60
371amnonlower in saliva of amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in homo sapiens saliva )2018-09-06v4No1 / 60
71amnon high in small intestine stomach compared to feces hindgut colon in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 67
757amnoncommon feces, adult, santa catarina state, brazil, homo sapiens2021-03-28v3No1 / 67
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 69
727amnoncommon ixodes ricinus, body proper, whole body, la rioja province, kingdom of spain, tick2021-01-03v3No1 / 69
386amnon high in ecuador compared to bolivia in mouse mus musculus caecum wild 2018-10-28v4No1 / 70
404amnon high in barranquilla bucaramanga municipality of santiago de cali compared to bogota medellin metropolitan area in homo sapiens feces adult colombia city 2018-11-20v4No1 / 71
404amnoncommon homo sapiens, feces, colombia, city, adult2018-11-20v4No1 / 79
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, depth > 3mm, deep pocket depth, periodontitis, mouth2018-09-14v4No1 / 80
562amnoncommon feces, quito, ecuador, child, age 5-13 years2019-11-05v4No1 / 82
733amnon high in filtered 2.7um particle bound compared to filtered 0.2um free floating in depth (water) 1m lago grande do curuai river amazon lake water fresh water water brazil 2021-01-17v3No1 / 82
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 84
404amnon high in lean body mass low bmi compared to high bmi in homo sapiens feces adult colombia city 2018-11-20v4No1 / 84
660amnonhigher in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in cross-cutucu compared to upano valley in shuar population village rural community ecuador feces homo sapiens )2020-09-20v4No1 / 88
71amnoncommon liolaemus ruibali, argentina, research facility, stomach2017-02-25v4No1 / 88
830amnon high in iga positive fraction compared to iga igg negative fraction iga negative fraction in homo sapiens feces age 9-17 years teenager peru 2021-09-10v4No1 / 88
404amnon high in female compared to male in homo sapiens feces adult colombia city 2018-11-20v4No1 / 88
386amnoncommon mouse, mus musculus, caecum, wild, ecuador2018-10-28v4No1 / 90
328amnonhigher in feces compared to intestinal mucosa in mice ( high in feces compared to digestive tract intestine mucosa in mouse mus musculus brazil research facility adult balb/c )2018-04-30v4No1 / 94
772amnoncommon in sediment from southern colombian caribbean sea (common depth (water) 2000-5000m, depth (water) 1000-2000m, sediment, colombia, caribbean sea, depth (water) 2000-3000m, marine sediment)2021-04-22v3No1 / 94
492amnoncommon brazil, skin, adult, rhinella icterica, toad, yellow cururu toad2019-02-27v4No1 / 95
238amnoncommon homo sapiens, feces, colombia2017-11-07v4No1 / 96
548amnon high in plant root compared to rhizosphere in minas gerais state campos rupestres brazil vellozia epidendroides 2019-08-15v4No1 / 100
105amnoncommon brazil, homo sapiens, dentition, pulpitis, mouth2017-04-05v4No1 / 100
499amnoncommon brazil, pond, digestive system, intestine, dendropsophus minutus, frog, tadpole2019-03-05v4No1 / 102
499amnoncommon digestive system, pond, intestine, brazil, remartinia, aeshnidae, dragonfly, larval stage2019-03-05v4No1 / 104
328amnoncommon mouse, mus musculus, brazil, research facility, adult, balb/c, intestine, mucosa, digestive tract2018-04-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
740amnoncommon marine iguana, amblyrhynchus cristatus, ecuador, galapagos islands, cloacal swab, alimentary part of gastrointestinal system, cloaca2021-02-08v4No1 / 110
71amnoncommon liolaemus ruibali, feces, argentina, research facility2017-02-25v4No1 / 113
517amnoncommon feces, homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department2019-05-29v4No1 / 113
32amnoncommon homo sapiens, saliva, bolivia, adult2016-12-05v4No1 / 116
328amnoncommon mouse, mus musculus, brazil, research facility, adult, balb/c, feces2018-04-30v4No1 / 116
615amnon high in leaf endosphere leaf compared to upper stem stem endosphere stem in endosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 118
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
517amnoncommon homo sapiens, child, age 5-13 years, bolivia, rural community, chuquisaca department, skin, arm, forearm2019-05-29v4No1 / 121
386amnonnegatively correlated with altitude (0-4km) in house mouse caecum ( high in low altitude compared to high altitude in mouse mus musculus caecum wild south america )2018-10-28v4No1 / 122
615amnoncommon leaf endosphere, leaf, endosphere, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 122
660amnoncommon shuar population, village, rural community, ecuador, feces, homo sapiens2020-09-20v4No1 / 123
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 123
449amnoncommon homo sapiens, feces, colombia2019-01-09v4No1 / 124
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, external ear, urocyon littoralis2020-01-22v4No1 / 124
67amnoncommon in dry processing of coffee beans (common coffea arabica, dry processing, ecuador)2017-02-19v4No1 / 126
75amnoncommon homo sapiens, venezuela, amerindian, hunter gatherer, saliva2017-02-27v4No1 / 129
386amnoncommon mouse, mus musculus, caecum, wild, bolivia2018-10-28v4No1 / 129
615amnoncommon stem surface, upper stem, stem, exosphere, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 129
660amnonlower in the cross cutcu population (more modern) comparen to upano valley (less modern) ( high in upano valley compared to cross-cutucu in shuar population village rural community ecuador feces homo sapiens )2020-09-20v4No1 / 132
615amnoncommon exosphere, leaf surface, leaf, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 143
615amnon high in stem surface upper stem stem compared to leaf surface leaf in exosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 143
71amnoncommon liolaemus ruibali, colon, hindgut, argentina, research facility2017-02-25v4No1 / 144
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in sewer wastewater treatment plant compared to feces in south america city low income )2017-01-21v4No1 / 148
615amnon high in stem endosphere upper stem stem compared to leaf endosphere leaf in endosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 153
96amnoncommon homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 158
517amnon high in mouth mucosa mouth compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 162
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf endosphere2019-08-17v4No1 / 164
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
499amnoncommon brazil, pond, digestive system, intestine, scinax fuscovarius, frog, tadpole2019-03-05v4No1 / 176
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 187
386amnoncommon mouse, mus musculus, caecum, wild, brazil2018-10-28v4No1 / 189
75amnoncommon homo sapiens, skin, arm, venezuela, amerindian, hunter gatherer2017-02-27v4No1 / 190
371amnoncommon homo sapiens, skin, amerindian, hunter gatherer, venezuela2018-09-06v4No1 / 195
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in homo sapiens skin )2018-09-06v4No1 / 195
548amnon high in rhizosphere compared to root in minas gerais state campos rupestres brazil vellozia epidendroides 2019-08-15v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
733amnoncommon filtered 0.2um, free floating, depth (water) 1m, lago grande do curuai, river amazon, lake water, fresh water, water, brazil2021-01-17v3No1 / 210
699amnon high in mediterranean sea italy kingdom of spain compared to brazil united states of america atlantic ocean in clavelina oblonga sea squirts harbor inner tunic 2028-04-01v4No1 / 216
499amnoncommon brazil, pond, water, pond water, fresh water2019-03-05v4No1 / 228
733amnoncommon filtered 2.7um, particle bound, depth (water) 1m, lago grande do curuai, river amazon, lake water, fresh water, water, brazil2021-01-17v3No1 / 235
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 236
404amnon high in medellin metropolitan area bogota compared to municipality of santiago de cali bucaramanga barranquilla in homo sapiens feces adult colombia city 2018-11-20v4No1 / 237
517amnon high in mouth mucosa mouth compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 242
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf, leaf endosphere2019-08-17v4No1 / 243
386amnon high in bolivia compared to ecuador in mouse mus musculus caecum wild 2018-10-28v4No1 / 246
71amnon high in feces colon hindgut compared to small intestine stomach in liolaemus ruibali argentina research facility 2017-02-25v4No1 / 255
386amnonpositively correlated with altitude (0-4km) in house mouse caecum ( high in high altitude compared to low altitude in mouse mus musculus caecum wild south america )2018-10-28v4No1 / 255
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
499amnoncommon brazil, pond, digestive system, intestine, astyanax paranae, fish, astyanax2019-03-05v4No1 / 273
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
615amnon high in soil compared to rhizosphere in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 306
499amnoncommon brazil, pond, poecilia reticulata, digestive system, intestine, fish, guppy2019-03-05v4No1 / 308
699amnon high in atlantic ocean united states of america brazil compared to mediterranean sea italy kingdom of spain in inner tunic harbor sea squirts clavelina oblonga 2028-04-01v4No1 / 317
615amnon high in leaf surface leaf compared to stem surface upper stem stem in exosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 321
932amnon high in cuticle chitin-based cuticle compared to stomach gaster in atlantic rainforest parque estadual serra do mar-núcleo picinguaba odontomachus hastatus sao paulo state ant brazil tropical moist broadleaf forest biome 2022-08-30v4No1 / 334
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, stem2019-08-17v4No1 / 431
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
75amnoncommon homo sapiens, venezuela, feces, amerindian, hunter gatherer2017-02-27v4No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in hunter gatherer amerindian venezuela compared to city united states of america in feces homo sapiens )2018-09-06v4No1 / 443
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
304amnoncommon united states of america, state of california, beach, pacific ocean, air, aerosol, santa cruz province2018-03-12v4No1 / 518
615amnon high in endosphere root compared to rhizosphere in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 529
548amnoncommon on leaf surface (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v4No1 / 548
548amnoncommon in leaf surface of barbacenia macrantha (common minas gerais state, campos rupestres, brazil, barbacenia macrantha, leaf, leaf surface)2019-08-17v4No1 / 550
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, root endosphere, root2019-08-17v4No1 / 575
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, rhizosphere2019-08-17v4No1 / 651
53amnonhigher in wastewater plant effluent compared to influent and sewer in south america ( high in effluent compared to influent sewage in south america city wastewater treatment plant )2017-01-21v4No1 / 657
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752
615amnoncommon endosphere, root, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 776
615amnoncommon in control soil with no sugarcane (common campinas, brazil, greenhouse, soil)2020-04-27v4No1 / 780
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
517amnon high in skin arm forearm compared to feces in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 836
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela hunter gatherer amerindian compared to city united states of america in homo sapiens skin )2018-09-06v4No1 / 854
615amnon high in rhizosphere compared to endosphere root in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 913
548amnoncommon minas gerais state, campos rupestres, brazil, rock2019-08-17v4No1 / 924
474amnoncommon soil, farm, glycine max, soybean, ph 4-6, brazil, cultivated environment2019-01-16v4No1 / 974
615amnoncommon saccharum, sugarcane, rhizosphere, campinas, brazil, greenhouse2020-04-27v4No1 / 974
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040
415amnoncommon rhizosphere, soil, citrus, orchard, brazil, cultivated environment2018-11-27v4No1 / 1091
615amnon high in rhizosphere compared to soil in saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 1181
548amnoncommon in phosphorus impoverished soil (common soil, minas gerais state, campos rupestres, brazil, ph 3.5)2019-08-15v4No1 / 1483
304amnoncommon united states of america, state of california, beach, pacific ocean, sand, santa cruz province2018-03-12v4No1 / 1838

Problems / suggestions? Please email info AT dbbact DOT org