Summary for ontology term: state of california

Number of annotations with term: 260

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGAGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTTTTTCTAGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.015564
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGCGCGCCAAGTCAGCGGTCAAAGTTCCGGGCTCAACCCGGTGTCGCCGTTGAAACTGGCGTGCTCGAGTGCGTGCGAGGAAGGCGGAATGCGTTGT0.015564
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGGGTAAGCGTGTTGTGAAATGCAGTTGCTCAACATCTGCACTGCAGCGCGAACTGTTCTCCTTGAGTGCGCAGGAAGTAGGCGGAATTCGTCG0.015564
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Ruminococcus2TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGTGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAATCTAGAGTACCGGAGAGGTAAGCGGAATTCCTAG0.011673
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGTCTGCAAGTCAGATGTGAAATCCATGGGCTCAACCCATGAACTGCATTTGAAACTGTAGATCTTGAGTGTCGGAGGGGCAATCGGAATTCCTAG0.011673
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGCATGCAAGTCAGATGTGAAATCTCAGGGCTTAACCCTGAAACTGCATTTGAAACTGTATGTCTTGAGTGCCGGAGAGGTAATCGGAATTCCTTG0.011673
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MitsuokellaTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGCGGGAGGTCAAGTCTATCTTAAAAGTGCGGGGCTCAACCCCGTGAGGGGATGGAAACTGGTCTTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.011673
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAAGAGCAAGTCTGATGTGAAAGGCTGGGGCTTAACCCCAGGACTGCATTGGAAACTGTTTTTCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.011673
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGGAGACAAGTTGAATGTTTAAACTATCGGCTTAACTGATAGTCGCGTTCAAAACTATCACTCTTGAGTGCAGTAGAGGTAGGCGGAATTCCTAGT0.011673
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGTGTAGGTGGCCATGCAAGTCAGAAGTGAAAATCCGGGGCTCAACCCCGGAACTGCTTTTGAAACTGTGAGGCTAGAGTGCAGGAGGGGTGAGTGGAATTCCTAG0.011673

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__PeptostreptococcaceaeTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTTAAGTCAGAAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTTTTGAAACTGGAGGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.800000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGAAGAGCAAGTCTGATGTGAAAACCCGGGGCTTAACCCCGGGCCTGCATTGGAAACTGTTTTTCTGGAGTACTGGAAGGGCAGGCGGAATTCCTGG0.800000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTCCTTTAAGCGTGTTGTGAAATACTGCCGCTCAACGGCAGAGGTGCAGCGCGAACTGGAGGACTTGAGTGCGCGGAAGGCAGGCGGAATTCGTCG0.800000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.600000
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTCTTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGAGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.600000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCGGTTCAATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGGAGAATTGCATCAGAAACTGTTGAACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.600000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Lachnospiracea_incertae_sedisTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGTGTAGGTGGCCATGCAAGTCAGAAGTGAAAATCCGGGGCTCAACCCCGGAACTGCTTTTGAAACTGTAAGGCTGGAGTGCAGGAGGGGTGAGTGGAATTCCTAG0.600000
d__BacteriaCACGTAAGGTGCGAGCGTTGTTCGGAATCATTGGGCGTAAAGGGCATGTAGGCGGTCTGTCAAGCCAGGCGTGAAAGCCAGGGGCTCAACCCCTGAACTGCGCTTGGAACTGGCGGACTGGAGTCGCTGAGGGGGAGCCGGAATTCCTGG0.600000
d__BacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTTGTTTTGTAAGTCAGAGGTGTAATCCCACGGCTTAACCGTGGAACTGCCTTTGATACTGCATAACTTGGATCCGGGAGAGGACAGCGGAATTCCAGG0.600000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTACGTAGGGAGCGAGCGTTGTCCGGAATGACTGGGTGTAAAGGGAGCGTAGGCGGGATGGCAAGTCAGATGTGAAACCTGAGGGCTCAACCTTCAGACTGCATTTGAAACTGCTGTTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCTGG0.600000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGTACGTAGGCGGATTAATAAGTTAGAGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTTAAAACTGTTAGTCTTGAGATCGAGAGAGGTGAGTGGAATTCCAAG0.289694
d__BacteriaTACATAGGGGTCAAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGTTCAACAAGTCGGTCGTAAAAGTTTAGGGCTCAACCCTAAAATGTCGATCGATACTGTTGTGACTAGGATACGGTAGAGGTGAATGGAATTCCGA0.260116
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGTTTATTAAGTCAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTGAAACTGGTCAACTAGAGTATGGTAGAGGAAAGTGGAATTTCTGG0.255452
d__Bacteria;p__"Verrucomicrobia"TACGAAGGTCCCGAGCGTTATTCGGAATCACTGGGCGTAAAGAGTACGTAGGCGGTTTGGTAAGTCAGGTGTGAAATCCCGGAGCTCAACTCCGGAACTGCATCCGATACTGCTAGACTAGAGTAATGGAGAGGCAGGTGGAATTCTCGG0.249180
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATTAGTAAGTTAGAGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTTAATACTGCTAGTCTTGAGTTCGAGAGAGGTAAGTGGAATTCCGAG0.246575
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__FormosaTACGGAGGATCCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGTAGGTGGATAATTAAGTCAGAGGTGAAATCTTGCAGCTCAACTGTAAAATTGCCTTTGATACTGGTTATCTTGAGTTATTATGAAGTAGTTAGAATATGTAG0.237389
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;f__SAR11;g__Candidatus PelagibacterTACGAAGGGACCTAGCGTAGTTCGGAATTACTGGGCTTAAAGAGTTCGTAGGTGGTTGAAAAAGTTAGTGGTGAAATCCCAGAGCTTAACTCTGGAACTGCCATTAAAACTTTTCAGCTAGAGTATGATAGAGGAAAGCAGAATTTCTAG0.236181
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTACGGAGGATCCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGCAGGCTGTTTTTTAAGTCAGAGGTGAAATCCTACAGCTCAACTGTAGAACTGCCTTTGATACTGAAAAACTTGAGTTATTGTGAAGTGGTTAGAATGTGTGG0.234921
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAAGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAAGCCCTGGGCTCAACCTAGGAACTGCATCCAAAACTAACTCACTAGAGTACGATAGAGGGAGGTAGAATTCATAG0.233503
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__PolaribacterTACGGAGGGTCCGAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGCAGGCGGTCAATTAAGTCAGAGGTGAAATCCCATAGCTTAACTATGGAACTGCCTTTGATACTGGTTGACTTGAGTCATATGGAAGTAGATAGAATGTGTAG0.224852

Annotations:

common ontology terms
term enrichment score
TermScore
state of california0.959612
pacific ocean0.225210
monterey bay0.207792
sea water0.190909
beach0.162544
water0.144828
flood plain0.144737
sacramento0.144737
cosumnes river preserve0.144737
microbial biomat0.122744
united states of america0.117422
biomat0.109589
water treatment pond0.109589
benthic biomat0.109589
engineered wetland0.109589
los angeles district0.088235
bodega bay0.084507
desert0.082474
hispanic0.081081
agave0.078014
rice0.077922
hispanic or latin american0.077922
infant0.076923
surface water0.076923
air0.076923
captive0.072539
late time points0.072368
oryza sativa0.069767
zostera marina0.068966
marine eelgrass0.068966
6-month-old human stage0.063717
rhizosphere0.062500
early time points0.060811
haliotis sorenseni0.057971
white abalone0.057971
rhesus macaque0.057971
agave deserti0.057971
sand0.057971
red abalone0.057971
haliotis rufescens0.057971
female0.056426
swiss webster0.056338
ocean0.053097
adult0.052467
macaca mulatta0.051948
aerosol0.051095
soil0.050633
feces0.050258
leaf0.047059
homo sapiens0.045320
san diego zoo0.044118
san francisco bay0.044118
monkey0.043011
saline water0.039216
mexico0.038961
LOWER IN control0.038147
depth (water) 5m0.037037
outlet0.037037
size < 1um0.037037
size 1-80um0.037037
control0.036718
particle bound0.035714
formula fed0.035714
breast fed0.035714
research facility0.035011
free floating0.034483
1-month-old human stage0.034483
zoological garden0.034286
subgingival plaque0.030303
santa cruz province0.030303
shell0.029851
mallard0.029851
foot0.029412
dust0.029412
floor0.029412
influent0.029412
anas platyrhynchos0.028986
depth 5cm0.028571
aquarium0.028169
LOWER IN state of oregon0.028169
state of oregon0.028169
cloaca0.027027
ph 6-70.023810
depth (water) 75m0.022556
ceratotherium simum simum0.022556
outdoor0.022556
indoor0.022556
office0.022556
mouse0.022346
depth (water) 300m0.022305
drought environment0.022305
LOWER IN drought environment0.022305
rhinoceros unicornis0.022305
greater one-horned rhinoceros0.022305
vitis vinifera0.022305
grape0.022305
endosphere0.022305
depth (water) 150m0.022059
depth (soil) 0-30 cm0.022059
LOWER IN late time points0.022059
Fraction of dbbact annotations with this term covered by the query
TermScore
saline lake1.000000
deep lake1.000000
shark bay1.000000
microbial biomat1.000000
LOWER IN spring1.000000
spring1.000000
los angeles district1.000000
beach1.000000
santa cruz province1.000000
santa cruz county1.000000
state of california0.961538
monterey bay0.666667
haliotis sorenseni0.500000
white abalone0.500000
shell0.500000
cleanroom0.500000
microbial mat0.500000
diarrhea0.500000
LOWER IN diarrhea0.500000
depth (water) 75m0.500000
depth (water) 5m0.500000
LOWER IN depth (water) 75m0.500000
flood plain0.500000
sacramento0.500000
cosumnes river preserve0.500000
depth (soil) 100-133cm0.500000
depth (soil) 133-166cm0.500000
depth (soil) 166-200cm0.500000
depth (soil) 400-700cm0.500000
biomat0.500000
water treatment pond0.500000
benthic biomat0.500000
engineered wetland0.500000
outlet0.500000
inlet0.500000
LOWER IN outlet0.500000
LOWER IN inlet0.500000
LOWER IN flooded soil0.500000
flooded soil0.500000
rhesus macaque0.500000
age 8 months0.500000
san diego zoo0.500000
ceratotherium simum simum0.500000
LOWER IN ceratotherium simum simum0.500000
size < 1um0.500000
xylella fastidiosa temecula10.500000
pierce disease0.500000
outdoor0.500000
indoor0.500000
office0.500000
LOWER IN outdoor0.500000
LOWER IN indoor0.500000
LOWER IN office0.500000
agave0.500000
agave deserti0.500000
guanajuato0.500000
LOWER IN agave0.500000
deth 5-100m0.500000
depth (water) 30m0.500000
depth (water) 500m0.500000
bodega bay0.500000
depth (water) 80m0.500000
depth (water) 60m0.500000
heteromeles arbutifolia0.500000
ceanothus jepsonii0.500000
LOWER IN depth 30-60cm0.500000
depth 30-60cm0.500000
depth 166-200cm0.500000
LOWER IN depth 400-700cm0.500000
depth 400-700cm0.500000
LOWER IN depth 166-200cm0.500000
LOWER IN depth 60-100cm0.500000
depth 60-100cm0.500000
LOWER IN depth 133-166cm0.500000
depth 133-166cm0.500000
LOWER IN influenza0.500000
mallard0.500000
influenza0.500000
LOWER IN size 1-80um0.500000
size 1-80um0.500000
LOWER IN size &lt; 1um0.500000
sand0.500000
LOWER IN sand0.500000
aerosol0.500000
LOWER IN aerosol0.500000
san francisco bay0.500000
red abalone0.500000
haliotis rufescens0.500000
6-month-old human stage0.400000
foot0.333333
dust0.333333
floor0.333333
depth (water) 300m0.333333
LOWER IN depth (water) 300m0.333333
depth (soil) 30-60cm0.333333
influent0.333333
nipple0.333333
drought environment0.333333
LOWER IN drought environment0.333333
apis mellifera0.333333
Fraction of annotations for the query sequences containing the term
TermScore
state of california0.957692
united states of america0.626923
pacific ocean0.257692
water0.215385
sea water0.215385
feces0.203846
homo sapiens0.184615
soil0.153846
research facility0.123077
monterey bay0.123077
adult0.107692
saline water0.100000
beach0.088462
flood plain0.084615
sacramento0.084615
cosumnes river preserve0.084615
infant0.076923
female0.069231
microbial biomat0.065385
biomat0.061538
water treatment pond0.061538
benthic biomat0.061538
engineered wetland0.061538
desert0.061538
rhizosphere0.057692
captive0.053846
surface water0.050000
air0.050000
oryza sativa0.046154
rice0.046154
ocean0.046154
bodega bay0.046154
hispanic or latin american0.046154
los angeles district0.046154
hispanic0.046154
control0.042308
late time points0.042308
root0.042308
agave0.042308
LOWER IN control0.038462
zostera marina0.038462
marine eelgrass0.038462
early time points0.034615
6-month-old human stage0.034615
haliotis sorenseni0.030769
white abalone0.030769
macaca mulatta0.030769
monkey0.030769
rhesus macaque0.030769
leaf0.030769
agave deserti0.030769
mus musculus0.030769
mouse0.030769
swiss webster0.030769
sand0.030769
red abalone0.030769
haliotis rufescens0.030769
aerosol0.026923
zoological garden0.023077
san diego zoo0.023077
mexico0.023077
san francisco bay0.023077
depth (water) 5m0.019231
outlet0.019231
free floating0.019231
size < 1um0.019231
subgingival plaque0.019231
saliva0.019231
particle bound0.019231
size 1-80um0.019231
formula fed0.019231
breast fed0.019231
1-month-old human stage0.019231
shell0.015385
foot0.015385
aquarium0.015385
dust0.015385
floor0.015385
influent0.015385
depth 5cm0.015385
LOWER IN state of oregon0.015385
state of oregon0.015385
LOWER IN state of california0.015385
ph 6-70.015385
cloaca0.015385
anas platyrhynchos0.015385
mallard0.015385
santa cruz province0.015385
depth (water) 300m0.011538
depth (water) 75m0.011538
depth (water) 150m0.011538
depth (soil) 0-20cm0.011538
depth (soil) 0-30 cm0.011538
LOWER IN late time points0.011538
LOWER IN early time points0.011538
drought environment0.011538
LOWER IN drought environment0.011538
LOWER IN rhizosphere0.011538
LOWER IN root0.011538
LOWER IN soil0.011538
Exp. ID User ID Description Date Region Flag Sequences
171amnonhigh freq. in soil with rice growth irrigation protocol (dominant united states of america, soil, state of california, depth 5cm)2017-07-25v4No1 / 1
460amnonhigher in occupied indoor air compared to outdoor air ( high in indoor office compared to outdoor in united states of america air state of california )2019-01-12v4No1 / 1
171amnondominant united states of america, soil, rhizosphere, oryza sativa, state of california, rice2017-07-25v4No1 / 2
171amnondominant united states of america, oryza sativa, state of california, rice, root2017-07-25v4No1 / 2
304amnondominant united states of america, beach, sand, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 2
16amnon high in diarrhea compared to control in feces felis catus state of california 2016-11-08v4No1 / 3
786sheryoDominant in flood plain soil near cosumnes river, california, at 30-60cm depth (dominant united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 30-60cm)2021-05-18v3No1 / 3
360amnondominant desert, soil, rhizosphere, state of california, agave, agave deserti2018-08-21v4No1 / 3
278amnon high in control compared to periodontitis in homo sapiens united states of america saliva adult state of california 2018-01-23v4No1 / 3
360amnondominant desert, soil, state of california2018-08-21v4No1 / 4
710amnon high in stomach small intestine compared to feces in united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 4
236amnondominant ocean, leaf, zostera marina, state of california, bodega bay, marine eelgrass2017-11-07v4No1 / 4
308amnonhigh freq. in spacecraft assembly cleanroom floor (dominant united states of america, dust, state of california, floor, cleanroom)2018-03-31v4No1 / 5
786sheryoDominant in flood plain soil near cosumnes river, california, at 0-30cm depth (dominant united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 0-20cm, depth (soil) 0-30 cm)2021-05-18v3No1 / 5
786sheryoDominant in flood plain soil near cosumnes river, california, at 60-100cm depth (dominant united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 60-100cm)2021-05-18v3No1 / 5
189amnondominant united states of america, stem, vitis vinifera, state of california, grape, endosphere2017-08-30v4No1 / 5
236amnondominant ocean, sediment, marine sediment, zostera marina, state of california, bodega bay, marine eelgrass2017-11-07v4No1 / 5
665amnondominant united states of america, state of california, influent, late time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 6
52amnondominant homo sapiens, nipple, skin, state of california2017-01-19v4No1 / 6
360amnondominant desert, leaf, state of california, agave, agave deserti, leaf surface2018-08-21v4No1 / 6
665amnondominant united states of america, state of california, influent, early time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 7
665amnondominant united states of america, state of california, late time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland, outlet2020-09-23v4No1 / 7
52amnoncommon homo sapiens, nipple, skin, state of california2017-01-19v4No1 / 7
304amnondominant united states of america, beach, air, aerosol, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 7
236amnondominant ocean, zostera marina, state of california, bodega bay, marine eelgrass, root2017-11-07v4No1 / 8
394amnon high in ulcerative colitis compared to control in feces homo sapiens united states of america adult state of california 2018-11-06v4No1 / 8
284amnon high in age 2 months compared to 12-month-old human stage in feces homo sapiens female infant state of california 2018-01-27v4No1 / 8
859amnon high in 1-month-old human stage compared to 6-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v4No1 / 8
786sheryoDominant in flood plain soil near cosumnes river, california, at 166-200cm depth (dominant united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve)2021-05-18v3No1 / 9
665amnondominant united states of america, state of california, early time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland, outlet2020-09-23v4No1 / 9
479amnondominant united states of america, rhizosphere, state of california, ph 6-7, heteromeles arbutifolia2019-02-05v4No1 / 9
479amnondominant united states of america, rhizosphere, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 9
304amnondominant united states of america, beach, sand, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 9
308amnondominant feces, united states of america, research facility, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 9
308amnondominant united states of america, research facility, foot, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 10
786sheryoDominant in flood plain soil near cosumnes river, california, at 400-700cm depth (dominant united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 400-700cm)2021-05-18v3No1 / 10
665amnondominant united states of america, state of california, late time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 10
859amnoncommon feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 10
304amnondominant united states of america, beach, air, aerosol, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 10
304amnondominant united states of america, beach, sand, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 10
308amnonhigh freq. in neonatal intensive care unit floor (dominant united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 11
171amnonhigh in draught soil compared to soil with rice growth irrigation protocol ( high in drought environment compared to control flooded soil in united states of america soil state of california depth 5cm )2017-07-25v4No1 / 11
57amnondominant digestive system, apis mellifera, state of california, forager2017-01-31v4No1 / 11
308amnondominant feces, united states of america, research facility, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 12
786sheryoDominant in flood plain soil near cosumnes river, california, at 133-166cm depth (dominant united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 133-166cm)2021-05-18v3No1 / 12
460amnonhigh freq. in outdoor air (dominant united states of america, air, state of california, outdoor)2019-01-12v4No1 / 12
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 500m2019-01-16v4No1 / 12
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 80m2019-01-16v4No1 / 12
460amnonhigh freq. in occupied office air (dominant united states of america, air, state of california, indoor, office)2019-01-12v4No1 / 13
360amnondominant desert, state of california, agave, agave deserti, root endosphere, root2018-08-21v4No1 / 13
710amnondominant united states of america, research facility, mus musculus, state of california, mouse, mouse chow, swiss webster, control diet2028-05-20v4No1 / 13
859amnoncommon feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 13
859amnoncommon feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 13
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 100m2019-01-16v4No1 / 13
308amnondominant united states of america, research facility, foot, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 13
786sheryoDominant in flood plain soil near cosumnes river, california, at 100-133cm depth (dominant united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 100-133cm)2021-05-18v3No1 / 14
665amnondominant united states of america, state of california, early time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 14
560amnondominant united states of america, female, zoological garden, ceratotherium simum, white rhinoceros, captive, san diego zoo, ceratotherium simum simum2019-11-04v4No1 / 14
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 200m2019-01-16v4No1 / 14
308amnondominant united states of america, research facility, shell, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 14
308amnondominant united states of america, research facility, shell, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 15
560amnondominant united states of america, female, zoological garden, captive, san diego zoo, rhinoceros unicornis, greater one-horned rhinoceros2019-11-04v4No1 / 15
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 60m2019-01-16v4No1 / 15
304amnondominant united states of america, beach, water, sea water, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 15
308amnonhigh freq. in water of aquarium with red abalone (dominant united states of america, research facility, water, sea water, aquarium, state of california, red abalone, haliotis rufescens)2018-03-30v4No1 / 15
884amnondominant feces, homo sapiens, united states of america, adult, state of california, human adult stage2022-03-24v4No1 / 16
317amnondominant united states of america, water, sea water, state of california, pacific ocean, depth (water) 300m, depth (water) 75m, depth (water) 150m2018-04-15v4No1 / 16
683amnondominant during antibiotics treatment in feces (dominant feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 16
710amnondominant united states of america, research facility, mus musculus, state of california, mouse, ketogenic diet, swiss webster2028-05-20v4No1 / 16
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 40m2019-01-16v4No1 / 16
505amnondominant water, surface water, sea water, state of california, pacific ocean, particle bound, size 1-80um2019-03-14v4No1 / 16
304amnondominant united states of america, beach, water, sea water, state of california, pacific ocean, santa cruz county2018-03-12v4No1 / 16
317amnondominant united states of america, water, surface water, sea water, state of california, pacific ocean, depth (water) 5m2018-04-15v4No1 / 17
460amnoncommon in occupied office air (common united states of america, air, state of california, indoor, office)2019-01-12v4No1 / 17
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 30m2019-01-16v4No1 / 17
81amnondominant cloaca, anas platyrhynchos, state of california, mallard2017-03-05v4No1 / 17
278amnondominant homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 17
859amnondominant feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 17
859amnondominant feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 17
308amnonhigh freq. in aquarium water with white abalone (dominant united states of america, research facility, water, sea water, aquarium, state of california, haliotis sorenseni, white abalone)2018-03-30v4No1 / 18
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 5m2019-01-16v4No1 / 18
284amnondominant feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 18
304amnondominant united states of america, beach, air, aerosol, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 18
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 20m2019-01-16v4No1 / 19
394amnondominant feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 20
284amnoncommon feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
284amnondominant feces, homo sapiens, female, infant, state of california, age 2 months2018-01-27v4No1 / 20
460amnoncommon in outdoor air (common united states of america, air, state of california, outdoor)2019-01-12v4No1 / 21
236amnondominant ocean, water, sea water, state of california, pacific ocean, bodega bay2017-11-07v4No1 / 21
278amnondominant homo sapiens, united states of america, adult, state of california, subgingival plaque2018-01-23v4No1 / 21
505amnondominant water, surface water, sea water, state of california, pacific ocean, free floating, size < 1um2019-03-14v4No1 / 21
859amnoncommon feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 21
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 10m2019-01-16v4No1 / 21
304amnondominant united states of america, beach, water, sea water, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 21
278amnon high in periodontitis compared to control in homo sapiens united states of america saliva adult state of california 2018-01-23v4No1 / 22
284amnondominant feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 22
859amnon high in breast fed compared to formula fed in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 6-month-old human stage 2022-01-12v4No1 / 22
859amnondominant feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 22
308amnoncommon in spacecraft assembly cleanroom floor (common united states of america, dust, state of california, floor, cleanroom)2018-03-31v4No1 / 23
394amnondominant feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 23
284amnondominant feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 23
683amnondominant feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 24
683amnoncommon during antibiotics treatment in feces (common feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 25
460amnonlower in occupied indoor air compared to outdoor air ( high in outdoor compared to indoor office in united states of america air state of california )2019-01-12v4No1 / 25
284amnoncommon feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 25
859amnondominant feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 25
710amnonsuspected contaminant (common in blanks) (contamination)2028-05-20v4No1 / 28
360amnondominant desert, leaf, state of california, agave, agave deserti, leaf endosphere2018-08-20v4No1 / 30
81amnoncommon cloaca, anas platyrhynchos, state of california, mallard2017-03-05v4No1 / 30
284amnoncommon feces, homo sapiens, female, infant, state of california, 12-month-old human stage2018-01-27v4No1 / 30
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america stem vitis vinifera state of california grape endosphere )2017-08-30v4No1 / 31
57amnoncommon digestive system, apis mellifera, state of california, forager2017-01-31v4No1 / 33
284amnon high in 12-month-old human stage compared to age 2 months in feces homo sapiens female infant state of california 2018-01-27v4No1 / 35
81amnonhigh in influenza A positive mallards compared to healthy mallards ( high in influenza compared to control in cloaca anas platyrhynchos state of california mallard )2017-03-05v4No1 / 37
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 3-month-old human stage 2020-09-27v4No1 / 38
859amnon high in formula fed compared to breast fed in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 6-month-old human stage 2022-01-12v4No1 / 41
189amnoncommon united states of america, stem, vitis vinifera, state of california, grape, endosphere2017-08-30v4No1 / 43
171amnonlow in draught soil compared to soil with rice growth irrigation protocol ( high in control flooded soil compared to drought environment in united states of america soil state of california depth 5cm )2017-07-25v4No1 / 46
360amnoncommon desert, leaf, state of california, agave, agave deserti, leaf endosphere2018-08-20v4No1 / 48
710amnon high in mouse chow control diet compared to ketogenic diet in feces united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 49
16amnon high in control compared to diarrhea in feces felis catus state of california 2016-11-08v4No1 / 51
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 3-month-old human stage 2020-09-27v4No1 / 52
360amnoncommon desert, state of california, agave, agave deserti, root endosphere, root2018-08-21v4No1 / 52
278amnon high in periodontitis compared to control in homo sapiens united states of america adult state of california subgingival plaque 2018-01-23v4No1 / 52
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 55
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
308amnoncommon in neonatal intensive care unit floor (common united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 57
317amnoncommon united states of america, water, surface water, sea water, state of california, pacific ocean, depth (water) 5m2018-04-15v4No1 / 62
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 66
394amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america adult state of california 2018-11-06v4No1 / 71
859amnon high in 6-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v4No1 / 72
171amnonlower in rice rhizosphere soil compared to bulk soil (no rice) ( high in soil compared to rhizosphere in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 73
786sheryoHigher at 400-700cm depth compared to 166-200cm depth in flood plain soil near cosumnes river, california ( high in depth 400-700cm compared to depth 166-200cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-13v3No1 / 77
786sheryoHigher at 60-100cm depth compared to 30-60cm depth in flood plain soil near cosumnes river, california ( high in depth 60-100cm compared to depth 30-60cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-14v3No1 / 77
304amnonlower in seawater compared sea spray aerosol ( high in air aerosol compared to water sea water in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 77
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
884amnoncommon feces, homo sapiens, united states of america, adult, state of california, human adult stage2022-03-24v4No1 / 88
278amnoncommon homo sapiens, united states of america, adult, state of california, subgingival plaque2018-01-23v4No1 / 96
505amnon high in early time points compared to late time points in water surface water sea water state of california pacific ocean free floating size < 1um 2019-03-16v4No1 / 96
360amnon high in spring compared to summer in desert soil rhizosphere state of california mexico 2018-08-21v4No1 / 97
317amnoncommon united states of america, water, sea water, state of california, pacific ocean, depth (water) 300m, depth (water) 75m, depth (water) 150m2018-04-15v4No1 / 101
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
710amnon high in ketogenic diet compared to mouse chow control diet in feces united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 107
278amnon high in control compared to periodontitis in homo sapiens united states of america adult state of california subgingival plaque 2018-01-23v4No1 / 107
786sheryoHigher at 30-60cm depth compared to 60-100cm depth in flood plain soil near cosumnes river, california ( high in depth 30-60cm compared to depth 60-100cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-14v3No1 / 124
81amnonhigh in healthy mallards compared to influenza A positive mallars ( high in control compared to influenza in cloaca anas platyrhynchos state of california mallard )2017-03-05v4No1 / 131
278amnoncommon homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 133
171amnonhigher in rice rhizosphere soil compared to bulk soil (no rice) ( high in rhizosphere compared to soil in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 140
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 140
710amnoncommon united states of america, research facility, mus musculus, state of california, mouse, ketogenic diet, swiss webster2028-05-20v4No1 / 141
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america adult state of california 2018-01-23v4No1 / 146
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america adult state of california 2018-01-23v4No1 / 149
710amnoncommon united states of america, research facility, mus musculus, state of california, mouse, mouse chow, swiss webster, control diet2028-05-20v4No1 / 151
171amnoncommon united states of america, oryza sativa, state of california, rice, root2017-07-25v4No1 / 156
786sheryoHigher at 133-166cm depth compared to 60-100cm depth in flood plain soil near cosumnes river, california ( high in depth 133-166cm compared to depth 60-100cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-14v3No1 / 191
786sheryoHigher at 166-200cm depth compared to 400-700cm depth in flood plain soil near cosumnes river, california ( high in depth 166-200cm compared to depth 400-700cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-13v3No1 / 206
171amnonhigher in roots compared to rhizosphere soil in rice ( high in root compared to rhizosphere in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 213
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 10m2019-01-16v4No1 / 213
360amnon high in summer compared to spring in desert soil rhizosphere state of california mexico 2018-08-21v4No1 / 214
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 217
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 5m2019-01-16v4No1 / 220
505amnon high in early time points compared to late time points in water surface water sea water state of california pacific ocean particle bound size 1-80um 2019-03-16v4No1 / 223
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 20m2019-01-16v4No1 / 225
505amnoncommon water, surface water, sea water, state of california, pacific ocean, free floating, size < 1um2019-03-14v4No1 / 225
665amnoncommon united states of america, state of california, early time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 229
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 232
886amnoncommon microbial mat, australia, saline lake, deep lake, shark bay, microbial biomat, microbialite forming mat2022-03-27v1No1 / 233
308amnoncommon in water of aquarium with red abalone (common united states of america, research facility, water, sea water, aquarium, state of california, red abalone, haliotis rufescens)2018-03-30v4No1 / 240
505amnon high in late time points compared to early time points in water surface water sea water state of california pacific ocean free floating size < 1um 2019-03-16v4No1 / 249
665amnoncommon united states of america, state of california, early time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland, outlet2020-09-23v4No1 / 252
308amnoncommon feces, united states of america, research facility, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 258
304amnonhigher in seawater compared sea spray aerosol ( high in water sea water compared to air aerosol in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 260
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 263
171amnonhigher in roots of drought irrigated rice compared to irrigated conrols ( high in drought environment compared to control in united states of america oryza sativa state of california rice root )2017-07-25v4No1 / 282
505amnon high in free floating size < 1um compared to particle bound size 1-80um in water surface water sea water state of california pacific ocean 2019-03-14v4No1 / 283
236amnon high in leaf compared to root in ocean zostera marina state of california bodega bay marine eelgrass 2017-11-07v4No1 / 287
171amnonlower in roots of drought irrigated rice compared to irrigated conrols ( high in control compared to drought environment in united states of america oryza sativa state of california rice root )2017-07-25v4No1 / 288
473amnon high in summer compared to winter in water saline water sea water state of california pacific ocean monterey bay deth 5-100m 2019-01-16v4No1 / 293
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 30m2019-01-16v4No1 / 293
786sheryoHigher at 60-100cm depth compared to 133-166cm depth in flood plain soil near cosumnes river, california ( high in depth 60-100cm compared to depth 133-166cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-14v3No1 / 300
665amnoncommon united states of america, state of california, influent, early time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 301
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
710amnon high in feces compared to stomach small intestine in united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 329
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 40m2019-01-16v4No1 / 340
671amnon high in state of california compared to state of oregon in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 355
665amnoncommon united states of america, state of california, late time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 366
308amnoncommon united states of america, research facility, foot, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 368
560amnoncommon united states of america, female, zoological garden, ceratotherium simum, white rhinoceros, captive, san diego zoo, ceratotherium simum simum2019-11-04v4No1 / 373
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 60m2019-01-16v4No1 / 390
505amnoncommon water, surface water, sea water, state of california, pacific ocean, particle bound, size 1-80um2019-03-14v4No1 / 397
560amnoncommon united states of america, female, zoological garden, captive, san diego zoo, rhinoceros unicornis, greater one-horned rhinoceros2019-11-04v4No1 / 419
360amnoncommon desert, soil, rhizosphere, state of california, agave, agave deserti2018-08-21v4No1 / 432
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 80m2019-01-16v4No1 / 454
665amnoncommon united states of america, state of california, late time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland, outlet2020-09-23v4No1 / 461
786sheryoCommon in flood plain soil near cosumnes river, california, at 400-700cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 400-700cm)2021-05-18v3No1 / 481
236amnoncommon ocean, zostera marina, state of california, bodega bay, marine eelgrass, root2017-11-07v4No1 / 483
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 100m2019-01-16v4No1 / 486
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 200m2019-01-16v4No1 / 492
236amnoncommon ocean, leaf, zostera marina, state of california, bodega bay, marine eelgrass2017-11-07v4No1 / 505
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 518
665amnoncommon united states of america, state of california, influent, late time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 526
671amnon high in state of oregon compared to state of california in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 534
317amnonlower in depth>75m compared to depth >5m in ocean water ( high in surface water depth (water) 5m compared to depth (water) 300m depth (water) 75m depth (water) 150m in united states of america water sea water state of california pacific ocean )2018-04-15v4No1 / 544
304amnonhigher in seawater compared to beach sand ( high in water sea water compared to sand in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 547
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 558
308amnoncommon united states of america, research facility, shell, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 579
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 500m2019-01-16v4No1 / 587
308amnoncommon united states of america, research facility, foot, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 592
360amnon high in rhizosphere agave compared to soil in desert state of california mexico 2018-08-21v4No1 / 593
308amnoncommon feces, united states of america, research facility, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 609
505amnon high in late time points compared to early time points in water surface water sea water state of california pacific ocean particle bound size 1-80um 2019-03-16v4No1 / 612
786sheryoHigher at 0-30cm depth compared to 30-60cm depth in flood plain soil near cosumnes river, california ( high in depth (soil) 0-20cm depth (soil) 0-30 cm compared to depth 30-60cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-13v3No1 / 627
308amnoncommon united states of america, research facility, shell, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 632
360amnoncommon desert, soil, state of california2018-08-21v4No1 / 637
360amnonhigher in leaf surface compared to soil in agave plants ( high in leaf leaf surface compared to soil in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 645
360amnoncommon desert, leaf, state of california, agave, agave deserti, leaf surface2018-08-21v4No1 / 649
560amnon high in rhinoceros unicornis greater one-horned rhinoceros compared to ceratotherium simum white rhinoceros ceratotherium simum simum in united states of america female zoological garden captive san diego zoo 2019-11-04v4No1 / 656
304amnoncommon united states of america, beach, water, sea water, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 667
236amnon high in root compared to sediment marine sediment in ocean zostera marina state of california bodega bay marine eelgrass 2017-11-07v4No1 / 674
786sheryoHigher at 30-60cm depth compared to 0-30cm depth in flood plain soil near cosumnes river, california ( high in depth 30-60cm compared to depth (soil) 0-20cm depth (soil) 0-30 cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-13v3No1 / 675
560amnon high in ceratotherium simum white rhinoceros ceratotherium simum simum compared to rhinoceros unicornis greater one-horned rhinoceros in united states of america female zoological garden captive san diego zoo 2019-11-04v4No1 / 677
308amnoncommon in aquarium water with white abalone (common united states of america, research facility, water, sea water, aquarium, state of california, haliotis sorenseni, white abalone)2018-03-30v4No1 / 727
665amnon high in outlet compared to inlet in united states of america state of california late time points biomat microbial biomat water treatment pond benthic biomat engineered wetland 2020-09-23v4No1 / 730
171amnon high in drought environment compared to control in united states of america soil rhizosphere oryza sativa state of california rice 2017-07-25v4No1 / 770
171amnoncommon united states of america, soil, rhizosphere, oryza sativa, state of california, rice2017-07-25v4No1 / 772
236amnon high in root compared to leaf in ocean zostera marina state of california bodega bay marine eelgrass 2017-11-07v4No1 / 819
473amnon high in depth (water) 150-500m compared to depth (water) 50-100m in water saline water sea water state of california pacific ocean monterey bay 2019-01-16v4No1 / 870
786sheryoCommon in flood plain soil near cosumnes river, california, at 60-100cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 60-100cm)2021-05-18v3No1 / 878
665amnon high in late time points compared to early time points in united states of america state of california biomat microbial biomat water treatment pond benthic biomat engineered wetland 2020-09-23v4No1 / 884
317amnonhigher in depth>75m compared to depth >5m in ocean water ( high in depth (water) 300m depth (water) 75m depth (water) 150m compared to surface water depth (water) 5m depth (water) 0cm in united states of america water sea water state of california pacific ocean )2018-04-15v4No1 / 889
171amnoncommon in soil with rice growth irrigation protocol (common united states of america, soil, state of california, depth 5cm)2017-07-25v4No1 / 890
786sheryoCommon in flood plain soil near cosumnes river, california, at 133-166cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 133-166cm)2021-05-18v3No1 / 898
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
473amnon high in depth (water) 5-50m compared to depth (water) 50-100m in water saline water sea water state of california pacific ocean monterey bay 2019-01-16v4No1 / 919
786sheryoCommon in flood plain soil near cosumnes river, california, at 166-200cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 166-200cm)2021-05-18v3No1 / 936
360amnon high in soil compared to rhizosphere agave in desert state of california mexico 2018-08-21v4No1 / 992
473amnon high in winter compared to summer in water saline water sea water state of california pacific ocean monterey bay deth 5-100m 2019-01-16v4No1 / 1006
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, heteromeles arbutifolia2019-02-05v4No1 / 1006
786sheryoCommon in flood plain soil near cosumnes river, california, at 100-133cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 100-133cm)2021-05-18v3No1 / 1015
304amnoncommon united states of america, beach, sand, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 1038
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 0-20cm, depth (soil) 0-30 cm)2021-05-18v3No1 / 1048
665amnon high in early time points compared to late time points in united states of america state of california biomat microbial biomat water treatment pond benthic biomat engineered wetland 2020-09-23v4No1 / 1052
473amnon high in depth (water) 50-100m compared to depth (water) 150-500m in water saline water sea water state of california pacific ocean monterey bay 2019-01-16v4No1 / 1072
360amnonlower in leaf surface compared to soil in agave plants ( high in soil compared to leaf leaf surface in desert state of california mexico guanajuato agave )2018-08-21v4No1 / 1108
236amnoncommon ocean, water, sea water, state of california, pacific ocean, bodega bay2017-11-07v4No1 / 1156
171amnon high in control compared to drought environment in united states of america soil rhizosphere oryza sativa state of california rice 2017-07-25v4No1 / 1164
304amnoncommon united states of america, beach, water, sea water, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 1166
786sheryoCommon in flood plain soil near cosumnes river, california, at 30-60cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 30-60cm)2021-05-18v3No1 / 1180
505amnon high in particle bound size 1-80um compared to free floating size < 1um in water surface water sea water state of california pacific ocean 2019-03-14v4No1 / 1218
304amnoncommon united states of america, beach, water, sea water, state of california, pacific ocean, santa cruz county2018-03-12v4No1 / 1425
304amnonlower in seawater compared to beach sand ( high in sand compared to water sea water in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 1599
665amnon high in inlet compared to outlet in united states of america state of california late time points biomat microbial biomat water treatment pond benthic biomat engineered wetland 2020-09-23v4No1 / 1629
473amnon high in depth (water) 50-100m compared to depth (water) 5-50m in water saline water sea water state of california pacific ocean monterey bay 2019-01-16v4No1 / 1656
304amnoncommon united states of america, beach, sand, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 1799
304amnoncommon united states of america, beach, sand, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 1838
236amnoncommon ocean, sediment, marine sediment, zostera marina, state of california, bodega bay, marine eelgrass2017-11-07v4No1 / 1904
304amnonhigher in beach sand compared to sea water and sea spray ( high in sand compared to water air sea water in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 2070
236amnon high in sediment marine sediment compared to root in ocean zostera marina state of california bodega bay marine eelgrass 2017-11-07v4No1 / 2745
171amnonlower in roots compared to rhizosphere soil in rice ( high in soil rhizosphere compared to root in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 7628

Problems / suggestions? Please email info AT dbbact DOT org