Summary for ontology term: state of colorado

Number of annotations with term: 39

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__Sphingobacteriaceae;g__PedobacterTACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTGTTAAGTCAGAGGTGAAAGACGGTAGCTCAACTATCGCAGTGCCTTTGATACTGATGGGCTTGAATAAACTAGAGGTAGGCGGAATGAGACA0.025641
d__BacteriaTACGTAGAAGACAAGTGTTATTCATCTTTAACAGGTTTAAAGGGTACCTAGACGGGAAATCAAGCCATAGTAGGGACTAATTTTCTAGAGTTTTATGTGTGAAGATCGAATTACCTGAAGAGCAATAAAATGCATTGACACAGGGAAGAC0.025641
d__BacteriaGACGGTAAAGACTAGTGTTATTCATCTTTAATAGGTTTAAAGGGTACCTAGACGGTATATCAAGCCCCAAAAGGGAACGGATATTACTAGAGTTTTATGTGAGAGGTTTATTTTAGTACTATCGGAGTAGAGATGAAATTCTTTGATACT0.025641
d__BacteriaTACGTAGAAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGTAAAATTAATCTTAAATAGGATATGTTTTTACTAGAGTTATATACGAGGAGGTGAGTATTTATGGAGTAGAGTTGAAATTCGTTGATACCATAAC0.025641
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__OxalobacteraceaeTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGTTTGTCGTGAAAGCCCCGGGCTCAACCTGGGAATTGCGATGAAGACTGCAAGGCTTGAATCTGGCAGAGGGGGGGAGAATTCCACG0.025641
d__BacteriaGACGGTAAAGACTAGTGTTATTCATCTTTAATAGGTTTAAAGGGTACCTAGACGGTATATCACGCCCCAAAAGGGAACGAATATTACTAGAGTTTTATGTGAGAGGTTTATTTTAGTACTATCGGAGTAGAGATGAAATTCTTTGATACT0.025641
d__BacteriaTACGTAGAAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGCATTATTAGCCCAAAATAGGGTACGGTTTTGCTAGAGTTTTATATGAGGAGGGGAGTATTCATAGAGTAGAGATAAAATTCTGTCATACTATGAC0.025641
TACGAGGAAGACTAGTGTTATTCATCTTTAATAGGTTTAAAGGGTACCTAGACAGTATATCAAGCCCCAAAAGGGAACAGATTTACTAGAGTTTTATGTAAGAGGAAGATTTAGAACTATTGGAGTAGAGATGAAATTTTTTCATACTAA0.025641
CACAAGTAAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGCGTACCTAGACGGCATTTTTACTCTTTATGGGAAATTATTTGCTAGAGTTTTATGTGAGAGGAAAATATTAGGACTATTGGTGTAGAGATGAAATTCTTTGATACTAA0.025641
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTCTATAAGTCAGTGGTGAAAGGTACCCGCTTAACGGGGACACTGCCATTGATACTGTGGAGCTGGAGTACAGATGAAGTGGGCGGAATGTGTCA0.025641

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Aerococcaceae;g__AbiotrophiaTACGTAGGTGGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGTGTAGGCGGTCTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGCGGAATTCCATG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTATGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__FinegoldiaTACGTATGGAGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTACGCAGGCGGTTTAATAAGTCGAATGTTAAAGATCGGGGCTCAACCCCGTAAAGCATTGGAAACTGATAAACTTGAGTAGTGGAGAGGAAAGTGGAATTCCTAGT0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTCGTTTGTGTAAGCCCGCAGCTTAACTGCGGGACTGCAGGCGATACGGGCATAACTTGAGTGCTGTAGGGGAGACTGGAATTCCTG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCTCGTAGGTGGTTTGTCGCGTCGTCTGTGAAATTCCGGGGCTTAACTCCGGGCGTGCAGGCGATACGGGCATAACTTGAGTACTGTAGGGGTAACTGGAATTCCTG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__DolosigranulumTACGTAGGTGACAAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGCGCAGGCGGTCTGTTTAGTCTAATGTGAAAGCCCACGGCTTAACCGTGGAACGGCATTGGAAACTGACAGACTTGAATGTAGAAGAGGAAAATGGAATTCCAAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptoniphilaceae;g__PeptoniphilusTACGTAGGGGGCTAGCGTTGTCCGGAATCACTGGGCGTAAAGGGTTCGCAGGCGGAAATGCAAGTCAGATGTAAAAGGCAGTAGCTTAACTACTGTAAGCATTTGAAACTGCATATCTTGAGAAGAGTAGAGGTAAGTGGAATTTTTAGT0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaGACGAAGGGGGCGAGCGTTATCCGGAATGACTGGGCGTAAAGGGTCCGTAGGCAGCATTTTTTGTTGGAAGTTAAATAAAAAAGCTTAACTTTTTTCCGCTTCTAAAACGTAAATGCTTTGAGTTTGATAGAAGATAGCAGAATTTCACA0.260870
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__"Saprospiraceae"TACGGAGGGTGCAAGCGTTATCCGGAATCACTGGGTTTAAAGGGTGCGTAGGCGGCTTAGTAAGTCAGAAGTGAAAGCCCGTCGCTCAACGATGGAATTGCTTTTGATACTGCTGAGCTTGAATTGAGTTGAGGCTGGCGGAATGTGGCA0.260870
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__ChlorophytaTACAGAGGGTGCAAGCGTTGTCCGGAATGATTGGGCGTAAAGCATCTGTAGGTGGTTTCTAAAGTCAACTGTTAAATCCCAGAGCTCAACTTTGGTCGAGCAGTTGAGTACTTAGGGACTTGAGTACGGTAGGGGTAGAGGGAATTCCTT0.222222
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__Cytophagales;f__Cytophagaceae;g__FluviimonasTACGTAGGTGGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTTTTTAAGTCGGTGGTTAAAGGTAGCAGCTTAACTGTTTTACATGCCATCGATACTGAAGAGCTTGAGTTATCAGAAGGCAGGCGGAATTTCTG0.181818
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Rhodobiaceae;g__ParvibaculumTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTATCCAAGTTGGGGGTGAAATCCCTGGGCTTAACCCAGGAACTGCCTTCAAAACTGGATGGCTAGAGTCCGAGAGAGGTGAGTGGAATTTCCAG0.153846
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__ChloroplastGACGGGGGATGCAAGTGTTATCCGGATTTACTGGGCGTAAAGCGTCTGCAGGTGGTTTCTTAAGTCTACTGTTAAATCTTGAGGCTCAACCTCAAATCTGCAGTAGAAACTAGGAGACTTGAGTATAGTAGGGGTAGAGGGAATTTCCAG0.139535
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__FlavobacteriaceaeTACGGAGGATGCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGTAGGTGGATCGGTAAGTCAGAGGTGAAAGCCTGCAGCTCAACTGTAGAACTGCCTTTGATACTGCTGGTCTTGAATTATTGTGAAGTGGTTAGAATATGTAG0.139535
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Bdellovibrionales;f__Pseudobacteriovoracaceae;g__PseudobacteriovoraxTACGAAAGGTGCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGCGCGTAGGCGGGACTGTAGGTCAATTGTGAAAGCCCAGGGCTCAACCTTGGAATTGCAGTTGAAACCATAGTTCTTGAATACCTGAGAGGGTGGGAGAATTCCTGG0.139535
TTCCAGCTCCAATAGCGTATACTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCTGGCGGGGACGGCTGGTCGGTCTCGAAAGGGGCTGTACTGTTGTTGGTTCCCGTCATCCTTGGGGAGAGCGGCTCTTACATTAAGTTGTC0.139535
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Caulobacterales;f__Hyphomonadaceae;g__HenriciellaTACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGGTTGTTAAGTCAGATGTGAAAGCCCGGGGCTCAACCTCGGAATTGCATTTGAAACTAGCAGCCTAGAGACCAGGAGAGGTTAGCGGAATACCGAG0.139535

Annotations:

common ontology terms
term enrichment score
TermScore
state of colorado0.929664
denver0.290909
gay0.290909
homosexual0.253968
msm0.253968
bioreactor0.235294
algae production system0.235294
heterosexual0.222222
msw0.222222
ground beef food product0.170213
depth 0-5cm0.156863
snow0.145455
age 8-12 years0.133333
cat0.100000
oral cavity0.097561
LOWER IN gay0.093023
hirundo rustica0.093023
barn swallow0.093023
felis catus0.090909
LOWER IN heterosexual0.090909
LOWER IN msw0.090909
LOWER IN homosexual0.088889
LOWER IN msm0.088889
city0.075472
mouth0.065574
united states of america0.062693
foodon product type0.054422
LOWER IN age 8-12 years0.048780
sarcocystis0.048780
no antimicrobial treatment0.048780
LOWER IN antimicrobial treatment0.048780
lapland0.048780
LOWER IN lapland0.048780
LOWER IN chronic kidney disease0.048780
finland0.043478
LOWER IN finland0.043478
kingdom of norway0.042553
LOWER IN kingdom of norway0.042553
LOWER IN state of colorado0.041667
LOWER IN hiv infection0.040816
hiv infection0.040816
child0.040816
sweden0.037037
LOWER IN sweden0.037037
water0.032520
LOWER IN child0.026667
feces0.024828
adult0.022018
homo sapiens0.021672
control0.017857
LOWER IN adult0.009434
LOWER IN control0.008929
LOWER IN united states of america0.006993
Fraction of dbbact annotations with this term covered by the query
TermScore
state of colorado0.888889
LOWER IN gay0.500000
denver0.500000
gay0.500000
age 8-12 years0.500000
LOWER IN age 8-12 years0.500000
hirundo rustica0.500000
barn swallow0.500000
bioreactor0.500000
algae production system0.500000
ground beef food product0.500000
sarcocystis0.500000
no antimicrobial treatment0.500000
LOWER IN antimicrobial treatment0.500000
lapland0.500000
LOWER IN lapland0.500000
LOWER IN chronic kidney disease0.500000
heterosexual0.400000
msw0.400000
LOWER IN heterosexual0.400000
LOWER IN msw0.400000
LOWER IN homosexual0.333333
LOWER IN msm0.333333
homosexual0.333333
msm0.333333
depth 0-5cm0.333333
snow0.250000
cat0.142857
finland0.142857
LOWER IN finland0.142857
kingdom of norway0.125000
LOWER IN kingdom of norway0.125000
felis catus0.111111
LOWER IN state of colorado0.111111
LOWER IN hiv infection0.100000
hiv infection0.100000
oral cavity0.071429
sweden0.066667
LOWER IN sweden0.066667
city0.050000
mouth0.041667
foodon product type0.037037
united states of america0.032389
child0.027778
LOWER IN child0.027778
water0.018182
feces0.012739
adult0.011561
homo sapiens0.011070
control0.010811
LOWER IN adult0.005780
LOWER IN control0.005405
LOWER IN united states of america0.004049
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.974359
state of colorado0.974359
homo sapiens0.512821
feces0.487179
adult0.230769
denver0.205128
gay0.205128
homosexual0.205128
msm0.205128
heterosexual0.153846
msw0.153846
oral cavity0.153846
mouth0.153846
city0.153846
water0.153846
bioreactor0.153846
algae production system0.153846
foodon product type0.102564
ground beef food product0.102564
depth 0-5cm0.102564
snow0.102564
child0.076923
age 8-12 years0.076923
felis catus0.076923
cat0.076923
LOWER IN gay0.051282
LOWER IN homosexual0.051282
LOWER IN msm0.051282
control0.051282
hirundo rustica0.051282
barn swallow0.051282
LOWER IN heterosexual0.051282
LOWER IN msw0.051282
LOWER IN hiv infection0.025641
hiv infection0.025641
LOWER IN control0.025641
LOWER IN child0.025641
LOWER IN age 8-12 years0.025641
LOWER IN adult0.025641
sarcocystis0.025641
no antimicrobial treatment0.025641
LOWER IN antimicrobial treatment0.025641
kingdom of norway0.025641
sweden0.025641
finland0.025641
lapland0.025641
LOWER IN united states of america0.025641
LOWER IN state of colorado0.025641
LOWER IN kingdom of norway0.025641
LOWER IN sweden0.025641
LOWER IN finland0.025641
LOWER IN lapland0.025641
LOWER IN chronic kidney disease0.025641
Exp. ID User ID Description Date Region Flag Sequences
525amnonSarcocystis parasite (other united states of america, state of colorado, sarcocystis, foodon product type, ground beef food product)2019-07-10v4No1 / 1
344amnon high in control compared to hiv infection in feces homo sapiens united states of america state of colorado denver gay homosexual msm 2018-05-31v4No1 / 2
525amnonhigher in ground beef with no antimicrobial treatment ( high in no antimicrobial treatment compared to antimicrobial treatment in united states of america state of colorado foodon product type ground beef food product )2019-07-10v4No1 / 3
525amnonhigh freq. in ground beef (dominant united states of america, state of colorado, foodon product type, ground beef food product)2019-07-10v4No1 / 4
344amnon high in hiv infection compared to control in feces homo sapiens united states of america state of colorado denver gay homosexual msm 2018-05-31v4No1 / 6
305amnonhigh freq. in low volume algae production photobioreactor (dominant united states of america, water, bioreactor, state of colorado, algae production system)2018-03-12v4No1 / 7
305amnonhigh freq. in medium volume algae production photobioreactor (dominant united states of america, water, bioreactor, state of colorado, algae production system)2018-03-12v4No1 / 7
305amnonhigh freq. in large volume algae production photobioreactor (dominant united states of america, water, bioreactor, state of colorado, algae production system)2018-03-12v4No1 / 7
711amnondominant homo sapiens, united states of america, oral cavity, child, state of colorado, mouth, age 8-12 years2028-05-21v4No1 / 9
711amnondominant homo sapiens, united states of america, oral cavity, adult, state of colorado, mouth2028-05-21v4No1 / 10
525amnoncommon in ground beef (common united states of america, state of colorado, foodon product type, ground beef food product)2019-07-10v4No1 / 11
161amnonhigh freq. in barn swallows in colorado (dominant feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 12
393amnondominant feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 14
511amnondominant united states of america, state of colorado, depth 0-5cm, snow2019-03-20v4No1 / 19
344amnonhigh freq. in feces of homosexual males (dominant feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 20
393amnondominant feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 21
511amnon high in kingdom of norway sweden finland lapland compared to united states of america state of colorado in depth 0-5cm snow 2019-03-20v4No1 / 21
344amnonhigh freq. in feces of heterosexuals (dominant feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 23
511amnon high in united states of america state of colorado compared to kingdom of norway sweden finland lapland in depth 0-5cm snow 2019-03-20v4No1 / 24
436amnondominant feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 25
711amnoncommon homo sapiens, united states of america, oral cavity, adult, state of colorado, mouth2028-05-21v4No1 / 29
305amnoncommon in low volume algae production photobioreactor (common united states of america, water, bioreactor, state of colorado, algae production system)2018-03-12v4No1 / 31
436amnonlower in cats with chronic kidney disease compared to healthy controls ( high in control compared to chronic kidney disease in feces united states of america felis catus state of colorado cat )2018-12-25v4No1 / 31
711amnoncommon homo sapiens, united states of america, oral cavity, child, state of colorado, mouth, age 8-12 years2028-05-21v4No1 / 37
305amnoncommon in medium volume algae production photobioreactor (common united states of america, water, bioreactor, state of colorado, algae production system)2018-03-12v4No1 / 41
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
305amnoncommon in large volume algae production photobioreactor (common united states of america, water, bioreactor, state of colorado, algae production system)2018-03-12v4No1 / 83
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
344amnoncommon in feces of homosexual males (common feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 87
711amnon high in child age 8-12 years compared to adult in homo sapiens united states of america oral cavity state of colorado mouth 2028-05-21v4No1 / 88
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 94
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
393amnon high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 107
436amnoncommon feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 108
393amnon high in gay homosexual msm compared to heterosexual msw in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 121
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 124
711amnon high in adult compared to child age 8-12 years in homo sapiens united states of america oral cavity state of colorado mouth 2028-05-21v4No1 / 133
511amnoncommon united states of america, state of colorado, depth 0-5cm, snow2019-03-20v4No1 / 134
161amnoncommon in barn swallows in colorado (common feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 245

Problems / suggestions? Please email info AT dbbact DOT org