Summary for ontology term: state of georgia

Number of annotations with term: 41

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACCATGGGCTCAACCCATGGCCTGCATTTGAAACTGTAGTTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.024390
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.024390
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCAGTCTTGAGTGCAGTAGAGGTGGGCGGAATTCGTGG0.024390
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAGTGCAAGTCAGGTGTGAAAACTATGGGCTCAACCCATAGACTGCACTTGAAACTGCATTTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCTGG0.024390
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__OlsenellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCAGTTAGGTCGGGAGTCAAATTTCGGGGCTCAACCCCGTCTCGCTCCCGATACCGGCTGGCTTGAGTGTGGTAGGGGAAGGCGGAATTCCCGGT0.024390
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__AkkermansiaTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG0.024390
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGTTTAATAAGTCAGTGGTGAAAACTGAGGGCTCAACCCTCAGCCTGCCACTGATACTGTTAGACTTGAGTATGGAAGAGGAGAATGGAATTCCTAG0.024390
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGAAAGATAAGTCTGATGTGAAAGCCCCCGGCTTAACCGAGGAATTGCATCGGAAACTGTGTTTCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.024390
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.024390
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGGAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.024390

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__BacillalesTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGGTGTGAAAACTCAAGGCTCAACCTTGAGCTTGCATCGGGTACGGGCAGACTAGAGTGCGGTAGGGGTGACTGGAATTCCTGG0.500000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__AllobaculumTACGTAGGTGGCAAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGCAGGCGGCATATCAAGTCTGAAGTGAAAGGTACGGGCTCAACCTGTACAGGCTTTGGAAACTGGTATGCTCGAGGACAGGAGAGGGCGGTGGAACTCCACGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGAAGAATAAGTCTGATGTGAAAGCCCTCGGCTTAACCGAGGAACTGCATCGGAAACTGTTTTTCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGCAGCAAGTCTGATGTGAAAGGCAGGGGCTTAACCCCTGGACTGCATTGGAAACTGCTGTGCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGAACGCAGGCGGTCTTTTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGTAGTGCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__CollinsellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGCAGGCCGGGGGTCGAAGCGGGGGGCTCAACCCCCCGAAGCCCCCGGAACCTCCGCGGCTTGGGTCCGGTAGGGGAGGGTGGAACACCCGG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTACGTAAAAGACTAGTGTTAGTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGTAAATAACACTTTAATAGAGTACTTATTTGCTAGAGTTTTATAAGAGAAGGAAGAACTTCTGGAGTAGTGATAAAATACTTTGATACCAGAGGGA0.259259
TACGTAGAAGACTAGTGTTAGTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGTAAAATAAACTCTAAATGAGTACTTTTTTACTAGAGTTTTATGTGAGAAGGGAGAATTTCTGGAGGAGAGATGGAATATGTTGATACCAGAAGGA0.250000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Xanthomonadales;f__XanthomonadaceaeTACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGTCTTTTAAGTCTGCTGTGAAATCCCCGGGCTCAACCTGGGAATGGCAGTGGATACTGGGAGGCTAGAGTGTGATAGAGGATGGTGGAATTCCCGG0.250000
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__ChitinophagaceaeTACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGTGTAGGCGGGTTTGTAAGTCAGTGGTGAAATCCCGAAGCTTAACTTCGGAACTGCCATTGATACTATAAGTCTTGAGTACTGTGGAGGTAGGCGGAATACGTCA0.212766
d__Bacteria;p__"Proteobacteria"TACGAAGGGGGCGAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGCGCCGCAAGTCGCGTGTGAAAGCCCCGGGCTCAACCTGGGAATTGCGCTCGAGACTGCGGTGCTGGAGTTCGGGAGAGGAGCGTGGAATTCCCAG0.212766
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp2;g__Gp2TACGTAGGGGGCCAGCGTTGTTCGGAATTACTGGGTGTAAAGGGTTCGTAGGCGGTGCGGCAAGTTGGGAGTGAAATCTCTGGGCTTAACCCAGAGACGGCTTCCAAAACTGCTGTGCTTGAGTGTGGGAGAGGCTCGTGGAATTGCAGG0.212766
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__Acetobacteraceae;g__AcidisomaTACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGCGTAGGTGGCGATCAAAGTCAGGCGTGAAATTCCTGGGCTCAACCTGGGGGCTGCGTTTGATACTTGGTTGCTAGAGTGAGGAAGAGGGTCGTGGAATTCCCAG0.212766
TACGTAGAAGACTAGTGTTAGTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGTAAATAACACTTGAGTAGAGTACTTATTTACTAGAGTTTTATGTGAGAAGGAAGAACTTCTGGAGTAGTGATAAAATACGTTGATACCAGAGGGA0.212766
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGTCCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTTGTTGCGTCGGAAGTGAAAACTTCGAGCTTAACTCGGAGCTTGCTTTCGATACGGGCAGACTTGAGGCATTCAGGGGAGAACGGAATTTCTGG0.212766
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__RhizobialesTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGATCGCTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGGCAATCTCGAGTCCGGGAGAGGTGAGTGGAACTGCGAG0.212766

Annotations:

common ontology terms
term enrichment score
TermScore
state of georgia0.829091
mesocosm0.327869
cow0.224299
jackson laboratories0.198020
30-60 days0.196078
bos taurus0.167832
angus steer0.163265
icr/cd-1 mice0.163265
low fat diet0.150943
post-weaning0.150943
charles river laboratories0.140351
high fat diet + inulin0.127660
cherokia georgiana georgiana0.127660
millipede0.127660
plant litter0.120000
late timepoints0.109890
c57bl/60.090498
city of boston0.088889
LOWER IN low fat diet0.085106
green turtle0.085106
chelonia mydas0.085106
juvenile0.085106
mouse chow0.079208
high fat diet0.077922
juvenile organism0.075472
rattus norvegicus0.072289
commonwealth of massachusetts0.067797
mouse0.063636
rat0.063158
dentition0.060150
mus musculus0.058091
LOWER IN mouse chow0.056338
united states of america0.055118
research facility0.051246
farm0.048632
LOWER IN high fat diet + inulin0.046512
0-2 days0.046512
LOWER IN 30-60 days0.046512
LOWER IN 0-2 days0.046512
unshaded0.046512
sunlight0.046512
LOWER IN shaded0.046512
shaded0.046512
LOWER IN unshaded0.046512
LOWER IN sunlight0.046512
LOWER IN cherokia georgiana georgiana0.046512
LOWER IN millipede0.046512
LOWER IN city of boston0.046512
LOWER IN days 14-280.046512
days 14-280.046512
LOWER IN plant litter0.045455
days 1-20.045455
LOWER IN days 1-20.045455
fiber diet0.045455
LOWER IN fiber diet0.045455
LOWER IN new york city0.041667
new york city0.041667
early timepoints0.040000
LOWER IN early timepoints0.040000
LOWER IN commonwealth of massachusetts0.040000
LOWER IN late timepoints0.039216
LOWER IN state of new york0.037736
LOWER IN high fat diet0.037736
state of new york0.037736
feces0.037244
LOWER IN control diet0.036364
control diet0.036364
LOWER IN wild0.030769
wild0.030769
soil0.018307
LOWER IN soil0.016736
LOWER IN research facility0.010638
LOWER IN feces0.005634
Fraction of dbbact annotations with this term covered by the query
TermScore
state of georgia0.750000
city of boston0.500000
high fat diet + inulin0.500000
LOWER IN high fat diet + inulin0.500000
0-2 days0.500000
LOWER IN 30-60 days0.500000
30-60 days0.500000
LOWER IN 0-2 days0.500000
mesocosm0.500000
cherokia georgiana georgiana0.500000
millipede0.500000
unshaded0.500000
sunlight0.500000
LOWER IN shaded0.500000
shaded0.500000
LOWER IN unshaded0.500000
LOWER IN sunlight0.500000
LOWER IN cherokia georgiana georgiana0.500000
LOWER IN millipede0.500000
LOWER IN city of boston0.500000
angus steer0.500000
LOWER IN days 14-280.500000
days 14-280.500000
icr/cd-1 mice0.500000
low fat diet0.333333
LOWER IN low fat diet0.333333
LOWER IN plant litter0.333333
plant litter0.333333
green turtle0.333333
chelonia mydas0.333333
juvenile0.333333
post-weaning0.333333
days 1-20.333333
LOWER IN days 1-20.333333
fiber diet0.333333
LOWER IN fiber diet0.333333
charles river laboratories0.250000
cow0.181818
jackson laboratories0.166667
juvenile organism0.166667
LOWER IN new york city0.142857
new york city0.142857
bos taurus0.117647
commonwealth of massachusetts0.111111
early timepoints0.111111
LOWER IN early timepoints0.111111
LOWER IN commonwealth of massachusetts0.111111
LOWER IN late timepoints0.100000
late timepoints0.100000
LOWER IN state of new york0.083333
high fat diet0.083333
LOWER IN high fat diet0.083333
state of new york0.083333
rattus norvegicus0.071429
LOWER IN control diet0.071429
control diet0.071429
mouse chow0.066667
LOWER IN mouse chow0.066667
rat0.055556
c57bl/60.055556
dentition0.043478
LOWER IN wild0.041667
wild0.041667
mouse0.035088
mus musculus0.031746
united states of america0.028340
farm0.027778
research facility0.027211
feces0.019108
LOWER IN soil0.010101
soil0.010101
LOWER IN research facility0.006803
LOWER IN feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
united states of america1.000000
state of georgia0.926829
feces0.731707
research facility0.439024
mus musculus0.341463
mouse0.341463
bos taurus0.292683
cow0.292683
c57bl/60.243902
jackson laboratories0.243902
mesocosm0.243902
farm0.195122
late timepoints0.121951
30-60 days0.121951
low fat diet0.097561
mouse chow0.097561
soil0.097561
post-weaning0.097561
angus steer0.097561
dentition0.097561
charles river laboratories0.097561
icr/cd-1 mice0.097561
rattus norvegicus0.073171
rat0.073171
high fat diet + inulin0.073171
high fat diet0.073171
cherokia georgiana georgiana0.073171
millipede0.073171
plant litter0.073171
commonwealth of massachusetts0.048780
city of boston0.048780
LOWER IN low fat diet0.048780
LOWER IN mouse chow0.048780
LOWER IN soil0.048780
juvenile organism0.048780
green turtle0.048780
chelonia mydas0.048780
juvenile0.048780
LOWER IN state of new york0.024390
LOWER IN new york city0.024390
LOWER IN wild0.024390
LOWER IN high fat diet0.024390
LOWER IN high fat diet + inulin0.024390
early timepoints0.024390
0-2 days0.024390
LOWER IN late timepoints0.024390
LOWER IN 30-60 days0.024390
LOWER IN early timepoints0.024390
LOWER IN 0-2 days0.024390
unshaded0.024390
sunlight0.024390
LOWER IN shaded0.024390
shaded0.024390
LOWER IN unshaded0.024390
LOWER IN sunlight0.024390
LOWER IN feces0.024390
LOWER IN cherokia georgiana georgiana0.024390
LOWER IN millipede0.024390
LOWER IN plant litter0.024390
state of new york0.024390
new york city0.024390
wild0.024390
LOWER IN research facility0.024390
LOWER IN commonwealth of massachusetts0.024390
LOWER IN city of boston0.024390
days 1-20.024390
LOWER IN days 14-280.024390
days 14-280.024390
LOWER IN days 1-20.024390
fiber diet0.024390
LOWER IN control diet0.024390
control diet0.024390
LOWER IN fiber diet0.024390
Exp. ID User ID Description Date Region Flag Sequences
719amnonlower in diet containing fiber compared to non fiber containing diet ( high in control diet compared to fiber diet in united states of america research facility dentition mus musculus state of georgia mouse charles river laboratories icr/cd-1 mice )2028-05-23v4No1 / 3
788amnondominant united states of america, soil, state of georgia, mesocosm2021-05-31v4No1 / 6
518amnondominant feces, united states of america, bos taurus, state of georgia, cow, post-weaning, angus steer2019-06-11v4No1 / 8
466amnondominant feces, united states of america, farm, bos taurus, state of georgia, cow2019-01-14v4No1 / 9
589amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, state of georgia, mouse, jackson laboratories, high fat diet + inulin2020-02-10v4No1 / 12
788amnondominant feces, united states of america, state of georgia, mesocosm, cherokia georgiana georgiana, millipede2021-05-31v4No1 / 13
788amnondominant united states of america, state of georgia, mesocosm, plant litter2021-05-31v4No1 / 15
719amnondominant united states of america, research facility, dentition, mus musculus, state of georgia, mouse, charles river laboratories, icr/cd-1 mice2028-05-23v4No1 / 16
589amnondominant feces, united states of america, research facility, mus musculus, low fat diet, c57bl/6, state of georgia, mouse, mouse chow, jackson laboratories2020-02-10v4No1 / 16
589amnondominant in high fat diet supplemented with cellulose in mice feces (dominant feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v4No1 / 17
719amnonhigher in diet containing fiber compared to non fiber containing diet ( high in fiber diet compared to control diet in united states of america research facility dentition mus musculus state of georgia mouse charles river laboratories icr/cd-1 mice )2028-05-23v4No1 / 17
466amnonhigh freq. in cow feces left in field for 30-60 days (dominant feces, united states of america, farm, bos taurus, state of georgia, cow, late timepoints, 30-60 days)2019-01-14v4No1 / 18
589amnon high in high fat diet + inulin compared to low fat diet mouse chow in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 19
759amnondominant feces, united states of america, research facility, rattus norvegicus, commonwealth of massachusetts, rat, city of boston2021-04-06v4No1 / 21
641amnoncommon feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
641amnondominant feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
589amnon high in low fat diet mouse chow compared to high fat diet + inulin in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 51
589amnon high in low fat diet mouse chow compared to high fat diet in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 74
589amnon high in high fat diet compared to low fat diet mouse chow in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 75
719amnoncommon united states of america, research facility, dentition, mus musculus, state of georgia, mouse, charles river laboratories, icr/cd-1 mice2028-05-23v4No1 / 75
589amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, state of georgia, mouse, jackson laboratories, high fat diet + inulin2020-02-10v4No1 / 78
759amnon high in state of new york new york city wild compared to research facility commonwealth of massachusetts city of boston in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
466amnonlower in shaded compared to unshaded samples in cow feces left in field for 30-60 days ( high in unshaded sunlight compared to shaded in feces united states of america farm bos taurus state of georgia cow late timepoints 30-60 days )2019-01-14v4No1 / 112
788amnon high in plant litter compared to soil in united states of america state of georgia mesocosm 2021-05-31v4No1 / 143
589amnoncommon feces, united states of america, research facility, mus musculus, low fat diet, c57bl/6, state of georgia, mouse, mouse chow, jackson laboratories2020-02-10v4No1 / 151
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v4No1 / 172
759amnon high in research facility commonwealth of massachusetts city of boston compared to state of new york new york city wild in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 217
466amnoncommon in cow feces left in field for 30-60 days (common feces, united states of america, farm, bos taurus, state of georgia, cow, late timepoints, 30-60 days)2019-01-14v4No1 / 221
788amnoncommon united states of america, state of georgia, mesocosm, plant litter2021-05-31v4No1 / 259
518amnonhigher in beginning of experiment ( high in days 1-2 compared to days 14-28 in feces united states of america bos taurus state of georgia cow post-weaning angus steer )2019-06-11v4No1 / 325
466amnonhigher in shaded compared to unshaded samples in cow feces left in field for 30-60 days ( high in shaded compared to unshaded sunlight in feces united states of america farm bos taurus state of georgia cow late timepoints 30-60 days )2019-01-14v4No1 / 432
518amnoncommon feces, united states of america, bos taurus, state of georgia, cow, post-weaning, angus steer2019-06-11v4No1 / 498
788amnon high in feces cherokia georgiana georgiana millipede compared to soil in united states of america state of georgia mesocosm 2021-05-31v4No1 / 589
788amnoncommon feces, united states of america, state of georgia, mesocosm, cherokia georgiana georgiana, millipede2021-05-31v4No1 / 607
518amnonhigher in end of experiment (older steers) ( high in days 14-28 compared to days 1-2 in feces united states of america bos taurus state of georgia cow post-weaning angus steer )2019-06-11v4No1 / 609
466amnonhigher in cow feces left in field for 30-60 days compared to initial feces ( high in late timepoints 30-60 days compared to early timepoints 0-2 days in feces united states of america farm bos taurus state of georgia cow )2019-01-14v4No1 / 662
466amnoncommon feces, united states of america, farm, bos taurus, state of georgia, cow2019-01-14v4No1 / 783
788amnoncommon united states of america, soil, state of georgia, mesocosm2021-05-31v4No1 / 897
788amnon high in soil compared to plant litter in united states of america state of georgia mesocosm 2021-05-31v4No1 / 1280
466amnonlower in cow feces left in field for 30-60 days compared to initial feces ( high in early timepoints 0-2 days compared to late timepoints 30-60 days in feces united states of america farm bos taurus state of georgia cow )2019-01-14v4No1 / 1329
788amnon high in soil compared to feces cherokia georgiana georgiana millipede in united states of america state of georgia mesocosm 2021-05-31v4No1 / 1395

Problems / suggestions? Please email info AT dbbact DOT org