Summary for ontology term: state of michigan

Number of annotations with term: 80

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGAGTTACTGGGCGTAAAGCGCCCGCAGGCGGTGAGGTACGTTTTGCGTGACAGCTGCTGGCTTAACGAGCAGAGGATGCGAAAGACGGCCTGACTTGAGGGCCAGAGAGGGACCTGGAATTCCGGG0.450450
d__BacteriaTACGTAGGGGGCAAGCGTTATCCAGATTTACTGGGCGTAAAGCGCGTGTAGGCGGCTGGTTAGGTGTGATGTGAAATCTTCCGGCTCAACCGGAAAACTGCATTGCAAACCGGCCTGGCTAGAGTGCAGGAGAGGGAAGCGGAATTCCAG0.352201
d__Bacteria;p__"Proteobacteria"TACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGTTCGTTAAGTTCGTTGTGAAAGCCCCGGGCTCAACCTGGGAATGGCAATGGAAACTGGCGGGCTGGAGTATGGCAGAGGGGGGTGGAATTCCGCG0.350877
d__BacteriaTACGTAGGGGGCGAGCGTTATCCAGATTTACTGGGCGTAAAGCGCGTGTAGGCGGCTGGTTAAGTGTGATGTGAAATCTTCGGGCTCAACCCGAAAACTGCATTGCAAACTGGCCTGGCTAGAGTGCAGGAGAGGGAAGCGGAATTCCAG0.340000
d__BacteriaTACGGGGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGTTTGTAGGTGGTCTGTTAAGTCAGACGTGAAATCCCTCAGCTTAACTGGGGAACTGCGTCTGAGACTGATGGACTTGAGGGCAGGAGAGGAACGCGGAATTCCAGG0.336449
d__BacteriaTACGTAGGAGGCGAGCGTTGTCCGGAGTTACTGGGCGTAAAGGGTGCGCAGGCGGCGTTCCGCGTGGCGAGATGAAATCTCCTGGCTTACCTGGGAGGGTGGTCGCCAGACGGGAGCGCTTGAGGGTCGGAGAGGGGCGTGGAATTCCGG0.336449
d__BacteriaTACGTAGGGAGCGAGCGTTGTCCGAAGTTACTGGGCGTAAAGCGCGCGTAGGCGGGTTTGAAAGTCGGAGGTGAAAGGCTGGGGCTCAACCCCATGCAGTGCCTCCGATACTTCAAGTCTTGAGTGCGGTAGGGAGAAGTGGAATGGCTG0.327586
d__BacteriaTACGTAGGTGGCTAGCGTTGTCCGGATTTACTGGGCGTAAAGGGCTTGTAGGCGGTTCGTTAAGTCCGGTGTGAAATCTCCCGGCTCAACCGGGAGCGGCCATCGGATACTGGCGAGCTAGAGGTGGGCAGAGGAAGGCGGAATTCCCGG0.326531
d__BacteriaGACAGAGGAGCCAAGCGTTGTCCGGATTGACTGGGCGTAAAGGGCACGCAGGCGGCGCCGCGCGTGGGGTGTGAAAGCGGGTGGCTTAACTGCCCAAGGTCATCCCATACGGCGGTGCTGGAGCCATCCAGAGGTCGGTGGAATTGCCGG0.326531
d__BacteriaTACGGGGGGTGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGCTTGATCAGTCGGACTTTTAAGAGCGGGGCTCAACCCCGTGGTGGGTTCGGGACGGTCGAGCTGGGGCGCGGTCGAGGGGGATGGAATGCCGGGT0.326087

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
state of michigan0.888889
LOWER IN second trimester0.500000
turin township0.500000
second trimester0.500000
17-29-years-old human0.500000
age 6-10 weeks0.500000
LOWER IN age 12-19 weeks0.500000
age 12-19 weeks0.500000
LOWER IN age 6-10 weeks0.500000
age 1-3 weeks0.500000
LOWER IN age 1-3 weeks0.500000
age 8 hours0.500000
continuous corn0.500000
kalamazoo loam0.500000
mesic type hapludalf0.500000
kellogg biological station0.500000
depth 50-100m0.500000
restored prairie0.500000
miscanthus0.500000
panicum virgatum0.500000
LOWER IN depth 50-100m0.500000
gestational diabetes0.333333
nipple0.333333
LOWER IN age 4 weeks0.333333
LOWER IN oropharynx0.333333
bronchus0.333333
corn0.333333
ph 5.90.333333
depth (soil) 25-50cm0.333333
LOWER IN depth (soil) 10-25cm0.333333
LOWER IN depth (soil) 25-50cm0.333333
tonsil0.285714
third trimester0.250000
LOWER IN buccal mucosa0.250000
trachea0.250000
depth (soil) 10-25cm0.250000
LOWER IN depth (soil) 0-10cm0.250000
buccal mucosa0.200000
oropharynx0.200000
ph 6.50.200000
age 4 weeks0.166667
clostridium difficile intestinal infectious disease0.166667
LOWER IN mouth mucosa0.142857
sus scrofa0.125000
pig0.125000
diarrhea0.111111
mouth mucosa0.100000
lung0.100000
depth (soil) 0-10cm0.076923
vagina0.071429
pregnancy0.066667
human adult stage0.052632
farm0.047619
italy0.038462
skin0.025641
adult0.024272
united states of america0.021277
homo sapiens0.018519
female0.014286
feces0.010417
soil0.009901
Fraction of annotations for the query sequences containing the term
TermScore
state of michigan0.937500
united states of america0.875000
soil0.500000
kalamazoo loam0.500000
mesic type hapludalf0.500000
kellogg biological station0.500000
restored prairie0.275000
homo sapiens0.250000
farm0.250000
sus scrofa0.250000
pig0.250000
adult0.237500
tonsil0.200000
panicum virgatum0.200000
corn0.175000
miscanthus0.175000
depth (soil) 25-50cm0.150000
feces0.137500
depth 50-100m0.137500
gestational diabetes0.125000
depth (soil) 10-25cm0.125000
depth (soil) 0-10cm0.112500
continuous corn0.100000
female0.062500
pregnancy0.062500
italy0.062500
turin township0.062500
human adult stage0.062500
third trimester0.037500
age 6-10 weeks0.037500
age 12-19 weeks0.037500
age 1-3 weeks0.037500
age 4 weeks0.037500
mouth mucosa0.037500
buccal mucosa0.037500
oropharynx0.037500
bronchus0.037500
lung0.037500
trachea0.037500
second trimester0.025000
17-29-years-old human0.025000
vagina0.025000
nipple0.025000
skin0.025000
age 8 hours0.025000
ph 5.90.025000
ph 6.50.025000
clostridium difficile intestinal infectious disease0.025000
diarrhea0.025000
LOWER IN depth (soil) 10-25cm0.025000
LOWER IN depth (soil) 25-50cm0.025000
LOWER IN second trimester0.012500
LOWER IN age 12-19 weeks0.012500
LOWER IN age 6-10 weeks0.012500
LOWER IN age 4 weeks0.012500
LOWER IN age 1-3 weeks0.012500
LOWER IN oropharynx0.012500
LOWER IN mouth mucosa0.012500
LOWER IN buccal mucosa0.012500
contamination0.012500
LOWER IN depth (soil) 0-10cm0.012500
LOWER IN depth 50-100m0.012500
Number of experiments associating the term to the sequence
TermScore
state of michigan8.000000
homo sapiens6.000000
united states of america6.000000
adult5.000000
feces4.000000
farm2.000000
tonsil2.000000
sus scrofa2.000000
pig2.000000
third trimester1.000000
LOWER IN second trimester1.000000
female1.000000
pregnancy1.000000
italy1.000000
gestational diabetes1.000000
turin township1.000000
human adult stage1.000000
second trimester1.000000
17-29-years-old human1.000000
age 6-10 weeks1.000000
LOWER IN age 12-19 weeks1.000000
age 12-19 weeks1.000000
LOWER IN age 6-10 weeks1.000000
vagina1.000000
nipple1.000000
skin1.000000
age 1-3 weeks1.000000
LOWER IN age 4 weeks1.000000
age 4 weeks1.000000
LOWER IN age 1-3 weeks1.000000
age 8 hours1.000000
mouth mucosa1.000000
buccal mucosa1.000000
LOWER IN oropharynx1.000000
oropharynx1.000000
LOWER IN mouth mucosa1.000000
LOWER IN buccal mucosa1.000000
bronchus1.000000
lung1.000000
trachea1.000000
contamination1.000000
soil1.000000
depth (soil) 0-10cm1.000000
corn1.000000
ph 5.91.000000
continuous corn1.000000
kalamazoo loam1.000000
mesic type hapludalf1.000000
kellogg biological station1.000000
depth (soil) 10-25cm1.000000
depth (soil) 25-50cm1.000000
depth 50-100m1.000000
ph 6.51.000000
restored prairie1.000000
miscanthus1.000000
panicum virgatum1.000000
clostridium difficile intestinal infectious disease1.000000
diarrhea1.000000
LOWER IN depth (soil) 10-25cm1.000000
LOWER IN depth (soil) 0-10cm1.000000
LOWER IN depth (soil) 25-50cm1.000000
LOWER IN depth 50-100m1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
821sheryoDominant in soil of restored prairie at 0-10cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth (soil) 0-10cm, ph 6.5, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v41 / 2approvedNo
821sheryoDominant in soil of continuous corn field at 0-10cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth (soil) 0-10cm, corn, ph 5.9, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v41 / 3approvedNo
821sheryoDominant in soil of miscanthus field at 0-10cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth (soil) 0-10cm, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v41 / 3approvedNo
821sheryoDominant in soil of continuous corn field at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm)2021-07-28v41 / 4approvedNo
821sheryoDominant in soil of continuous corn field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-07-28v41 / 4approvedNo
821sheryoDominant in soil of restored prairie at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm, restored prairie)2021-07-28v41 / 4approvedNo
821sheryoDominant in soil of miscanthus field at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm, restored prairie)2021-08-02v41 / 4approvedNo
821sheryoDominant in soil of miscanthus field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-02v41 / 4approvedNo
821sheryoDominant in soil of switchgrass field at 0-10cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth (soil) 0-10cm, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v41 / 4approvedNo
821sheryoDominant in soil of switchgrass field at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm, restored prairie)2021-08-02v41 / 4approvedNo
731amnonhigher in oropharingeal otic fluid drainage compared to buccal mucosa ( high in oropharynx compared to mouth mucosa buccal mucosa in homo sapiens united states of america adult state of michigan )2021-01-09v41 / 5approvedNo
87amnonhigher in controls compared to lung and oral (contamination)2017-03-07v41 / 5approvedNo
821sheryoDominant in soil of restored prairie at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm, restored prairie)2021-07-28v41 / 5approvedNo
821sheryoDominant in soil of continuous corn field at 50-100cm depth, Michigan USA (dominant united states of america, soil, state of michigan, corn, depth 50-100m, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v41 / 6approvedNo
821sheryoDominant in soil of switchgrass field at 50-100cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-03v41 / 6approvedNo
821sheryoDominant in soil of switchgrass field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-03v41 / 7approvedNo
821sheryoDominant in soil of switchgrass field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-03v41 / 7approvedNo
821sheryoDominant in soil of miscanthus field at 50-100cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 50-100m, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-02v41 / 8approvedNo
821sheryoDominant in soil of restored prairie at 50-100cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 50-100m, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v41 / 9approvedNo
388amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v41 / 11approvedNo
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v41 / 11approvedNo
389amnondominant united states of america, farm, vagina, sus scrofa, state of michigan, pig2018-11-04v41 / 13approvedNo
731amnondominant homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v41 / 13approvedNo
388amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v41 / 14approvedNo
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 8 hours2018-11-04v41 / 14approvedNo
94amnoncommon feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v41 / 16approvedNo
867amnondominant feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, human adult stage, second trimester2022-02-09v31 / 17approvedNo
289amnondominant feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v41 / 17approvedNo
389amnondominant united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v41 / 17approvedNo
389amnondominant united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v41 / 17approvedNo
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v41 / 17approvedNo
87amnondominant homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v41 / 17approvedNo
867amnondominant feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, third trimester, human adult stage2022-02-09v31 / 19approvedNo
484amnondominant feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v41 / 20approvedNo
867amnon high in third trimester compared to second trimester in feces homo sapiens female pregnancy adult italy gestational diabetes gestational diabetes turin township human adult stage 2022-02-09v31 / 21approvedNo
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 8 hours2018-11-04v41 / 22approvedNo
731amnondominant in orophringeal otic secretion drainage (dominant homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v41 / 22approvedNo
87amnoncommon homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v41 / 22approvedNo
94amnondominant feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v41 / 22approvedNo
389amnoncommon united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v41 / 41approvedNo
731amnonlower in oropharingeal otic fluid drainage compared to buccal mucosa ( high in mouth mucosa buccal mucosa compared to oropharynx in homo sapiens united states of america adult state of michigan )2021-01-09v41 / 41approvedNo
389amnoncommon united states of america, farm, vagina, sus scrofa, state of michigan, pig2018-11-04v41 / 43approvedNo
867amnoncommon feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, human adult stage, second trimester2022-02-09v31 / 52approvedNo
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v41 / 71approvedNo
389amnoncommon united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v41 / 72approvedNo
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v41 / 76approvedNo
731amnoncommon in orophringeal otic secretion drainage (common homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v41 / 77approvedNo
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v41 / 80approvedNo
867amnoncommon feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, third trimester, human adult stage2022-02-09v31 / 85approvedNo
731amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v41 / 85approvedNo
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v41 / 109approvedNo
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v41 / 112approvedNo
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v41 / 114approvedNo
389amnon high in age 4 weeks compared to age 1-3 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v41 / 168approvedNo
389amnon high in age 1-3 weeks compared to age 4 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v41 / 189approvedNo
388amnon high in age 6-10 weeks compared to age 12-19 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v41 / 210approvedNo
388amnon high in age 12-19 weeks compared to age 6-10 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v41 / 231approvedNo
821sheryoHigher at 50-100cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth 50-100m compared to depth (soil) 25-50cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v41 / 543approvedNo
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v41 / 726approvedNo
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v41 / 744approvedNo
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, depth 50-100m, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v41 / 769approvedNo
821sheryoHigher at 25-50cm depth compared to 50-100cm depth in soil in Michigan USA ( high in depth (soil) 25-50cm compared to depth 50-100m in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v41 / 784approvedNo
821sheryoHigher at 25-50cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 25-50cm compared to depth (soil) 10-25cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v41 / 812approvedNo
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-03v41 / 872approvedNo
821sheryoCommon in soil of miscanthus field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm, restored prairie)2021-08-02v41 / 901approvedNo
821sheryoHigher at 10-25cm depth compared to 0-10cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 0-10cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v41 / 930approvedNo
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-07-28v41 / 963approvedNo
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm, restored prairie)2021-07-28v41 / 968approvedNo
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-03v41 / 974approvedNo
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-03v41 / 974approvedNo
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm, restored prairie)2021-07-28v41 / 1241approvedNo
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth (soil) 0-10cm, ph 6.5, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v41 / 1291approvedNo
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm, restored prairie)2021-08-02v41 / 1377approvedNo
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth (soil) 0-10cm, corn, ph 5.9, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v41 / 1380approvedNo
821sheryoHigher at 0-10cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 0-10cm compared to depth (soil) 10-25cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v41 / 1383approvedNo
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm)2021-08-02v41 / 1387approvedNo
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth (soil) 0-10cm, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v41 / 1447approvedNo
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm)2021-07-28v41 / 1649approvedNo
821sheryoHigher at 10-25cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v41 / 1704approvedNo
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth (soil) 0-10cm, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-02v41 / 2067approvedNo

Problems / suggestions? Please email info AT dbbact DOT org