Summary for ontology term: state of michigan

Number of annotations with term: 80

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGAGTTACTGGGCGTAAAGCGCCCGCAGGCGGTGAGGTACGTTTTGCGTGACAGCTGCTGGCTTAACGAGCAGAGGATGCGAAAGACGGCCTGACTTGAGGGCCAGAGAGGGACCTGGAATTCCGGG0.431034
d__BacteriaTACGTAGGGGGCAAGCGTTATCCAGATTTACTGGGCGTAAAGCGCGTGTAGGCGGCTGGTTAGGTGTGATGTGAAATCTTCCGGCTCAACCGGAAAACTGCATTGCAAACCGGCCTGGCTAGAGTGCAGGAGAGGGAAGCGGAATTCCAG0.341463
d__Bacteria;p__"Proteobacteria"TACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGTTCGTTAAGTTCGTTGTGAAAGCCCCGGGCTCAACCTGGGAATGGCAATGGAAACTGGCGGGCTGGAGTATGGCAGAGGGGGGTGGAATTCCGCG0.336134
d__BacteriaTACGTAGGGGGCGAGCGTTATCCAGATTTACTGGGCGTAAAGCGCGTGTAGGCGGCTGGTTAAGTGTGATGTGAAATCTTCGGGCTCAACCCGAAAACTGCATTGCAAACTGGCCTGGCTAGAGTGCAGGAGAGGGAAGCGGAATTCCAG0.323810
d__BacteriaTACGGGGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGTTTGTAGGTGGTCTGTTAAGTCAGACGTGAAATCCCTCAGCTTAACTGGGGAACTGCGTCTGAGACTGATGGACTTGAGGGCAGGAGAGGAACGCGGAATTCCAGG0.321429
d__BacteriaTACGTAGGAGGCGAGCGTTGTCCGGAGTTACTGGGCGTAAAGGGTGCGCAGGCGGCGTTCCGCGTGGCGAGATGAAATCTCCTGGCTTACCTGGGAGGGTGGTCGCCAGACGGGAGCGCTTGAGGGTCGGAGAGGGGCGTGGAATTCCGG0.321429
d__BacteriaTACGTAGGGAGCGAGCGTTGTCCGAAGTTACTGGGCGTAAAGCGCGCGTAGGCGGGTTTGAAAGTCGGAGGTGAAAGGCTGGGGCTCAACCCCATGCAGTGCCTCCGATACTTCAAGTCTTGAGTGCGGTAGGGAGAAGTGGAATGGCTG0.314050
d__BacteriaTACGTAGGTGGCTAGCGTTGTCCGGATTTACTGGGCGTAAAGGGCTTGTAGGCGGTTCGTTAAGTCCGGTGTGAAATCTCCCGGCTCAACCGGGAGCGGCCATCGGATACTGGCGAGCTAGAGGTGGGCAGAGGAAGGCGGAATTCCCGG0.310680
d__BacteriaGACAGAGGAGCCAAGCGTTGTCCGGATTGACTGGGCGTAAAGGGCACGCAGGCGGCGCCGCGCGTGGGGTGTGAAAGCGGGTGGCTTAACTGCCCAAGGTCATCCCATACGGCGGTGCTGGAGCCATCCAGAGGTCGGTGGAATTGCCGG0.310680
d__BacteriaTACGGGGGGTGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGCTTGATCAGTCGGACTTTTAAGAGCGGGGCTCAACCCCGTGGTGGGTTCGGGACGGTCGAGCTGGGGCGCGGTCGAGGGGGATGGAATGCCGGGT0.309278

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
gestational diabetes1.000000
turin township1.000000
bronchus1.000000
state of michigan0.888889
third trimester0.500000
17-29-years-old human0.500000
age 6-10 weeks0.500000
LOWER IN age 12-19 weeks0.500000
age 12-19 weeks0.500000
LOWER IN age 6-10 weeks0.500000
age 1-3 weeks0.500000
LOWER IN age 1-3 weeks0.500000
age 8 hours0.500000
trachea0.500000
continuous corn0.500000
kalamazoo loam0.500000
mesic type hapludalf0.500000
kellogg biological station0.500000
depth 50-100m0.500000
restored prairie0.500000
miscanthus0.500000
panicum virgatum0.500000
LOWER IN depth 50-100m0.500000
diarrhea0.500000
nipple0.333333
corn0.333333
ph 5.90.333333
depth (soil) 10-25cm0.333333
depth (soil) 25-50cm0.333333
LOWER IN depth (soil) 10-25cm0.333333
LOWER IN depth (soil) 25-50cm0.333333
tonsil0.285714
LOWER IN oropharynx0.250000
oropharynx0.250000
LOWER IN age 4 weeks0.200000
age 4 weeks0.200000
buccal mucosa0.200000
LOWER IN buccal mucosa0.200000
ph 6.50.200000
clostridium difficile intestinal infectious disease0.166667
sus scrofa0.125000
pig0.125000
mouth mucosa0.111111
LOWER IN mouth mucosa0.111111
lung0.100000
vagina0.090909
pregnancy0.083333
depth (soil) 0-10cm0.076923
LOWER IN depth (soil) 0-10cm0.076923
farm0.055556
italy0.050000
human adult stage0.045455
skin0.030303
adult0.028902
united states of america0.024291
homo sapiens0.022140
female0.015873
feces0.012739
soil0.010101
LOWER IN second trimester0.000000
second trimester0.000000
Fraction of annotations for the query sequences containing the term
TermScore
state of michigan0.937500
united states of america0.875000
soil0.500000
kalamazoo loam0.500000
mesic type hapludalf0.500000
kellogg biological station0.500000
restored prairie0.275000
homo sapiens0.250000
farm0.250000
sus scrofa0.250000
pig0.250000
adult0.237500
tonsil0.200000
panicum virgatum0.200000
corn0.175000
miscanthus0.175000
depth (soil) 25-50cm0.150000
feces0.137500
depth 50-100m0.137500
gestational diabetes0.125000
depth (soil) 10-25cm0.125000
depth (soil) 0-10cm0.112500
continuous corn0.100000
female0.062500
pregnancy0.062500
italy0.062500
turin township0.062500
human adult stage0.062500
third trimester0.037500
age 6-10 weeks0.037500
age 12-19 weeks0.037500
age 1-3 weeks0.037500
age 4 weeks0.037500
mouth mucosa0.037500
buccal mucosa0.037500
oropharynx0.037500
bronchus0.037500
lung0.037500
trachea0.037500
second trimester0.025000
17-29-years-old human0.025000
vagina0.025000
nipple0.025000
skin0.025000
age 8 hours0.025000
ph 5.90.025000
ph 6.50.025000
LOWER IN depth (soil) 10-25cm0.025000
LOWER IN depth (soil) 25-50cm0.025000
clostridium difficile intestinal infectious disease0.025000
diarrhea0.025000
LOWER IN second trimester0.012500
LOWER IN age 12-19 weeks0.012500
LOWER IN age 6-10 weeks0.012500
LOWER IN age 4 weeks0.012500
LOWER IN age 1-3 weeks0.012500
LOWER IN oropharynx0.012500
LOWER IN mouth mucosa0.012500
LOWER IN buccal mucosa0.012500
contamination0.012500
LOWER IN depth (soil) 0-10cm0.012500
LOWER IN depth 50-100m0.012500
Exp. ID User ID Description Date Region Flag Sequences
821sheryoDominant in soil of restored prairie at 0-10cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth (soil) 0-10cm, ph 6.5, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 2
821sheryoDominant in soil of continuous corn field at 0-10cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth (soil) 0-10cm, corn, ph 5.9, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 3
821sheryoDominant in soil of miscanthus field at 0-10cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth (soil) 0-10cm, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v4No1 / 3
821sheryoDominant in soil of continuous corn field at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm)2021-07-28v4No1 / 4
821sheryoDominant in soil of continuous corn field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-07-28v4No1 / 4
821sheryoDominant in soil of restored prairie at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm, restored prairie)2021-07-28v4No1 / 4
821sheryoDominant in soil of miscanthus field at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm, restored prairie)2021-08-02v4No1 / 4
821sheryoDominant in soil of miscanthus field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-02v4No1 / 4
821sheryoDominant in soil of switchgrass field at 0-10cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth (soil) 0-10cm, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v4No1 / 4
821sheryoDominant in soil of switchgrass field at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm, restored prairie)2021-08-02v4No1 / 4
731amnonhigher in oropharingeal otic fluid drainage compared to buccal mucosa ( high in oropharynx compared to mouth mucosa buccal mucosa in homo sapiens united states of america adult state of michigan )2021-01-09v4No1 / 5
87amnonhigher in controls compared to lung and oral (contamination)2017-03-07v4No1 / 5
821sheryoDominant in soil of restored prairie at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm, restored prairie)2021-07-28v4No1 / 5
821sheryoDominant in soil of continuous corn field at 50-100cm depth, Michigan USA (dominant united states of america, soil, state of michigan, corn, depth 50-100m, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 6
821sheryoDominant in soil of switchgrass field at 50-100cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-03v4No1 / 6
821sheryoDominant in soil of switchgrass field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-03v4No1 / 7
821sheryoDominant in soil of switchgrass field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-03v4No1 / 7
821sheryoDominant in soil of miscanthus field at 50-100cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 50-100m, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-02v4No1 / 8
821sheryoDominant in soil of restored prairie at 50-100cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 50-100m, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 9
388amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 11
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 11
389amnondominant united states of america, farm, vagina, sus scrofa, state of michigan, pig2018-11-04v4No1 / 13
731amnondominant homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v4No1 / 13
388amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 14
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 8 hours2018-11-04v4No1 / 14
94amnoncommon feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 16
867amnondominant feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, human adult stage, second trimester2022-02-09v3No1 / 17
289amnondominant feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 17
389amnondominant united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 17
389amnondominant united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 17
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v4No1 / 17
87amnondominant homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 17
867amnondominant feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, third trimester, human adult stage2022-02-09v3No1 / 19
484amnondominant feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 20
867amnon high in third trimester compared to second trimester in feces homo sapiens female pregnancy adult italy gestational diabetes gestational diabetes turin township human adult stage 2022-02-09v3No1 / 21
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 8 hours2018-11-04v4No1 / 22
731amnondominant in orophringeal otic secretion drainage (dominant homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v4No1 / 22
87amnoncommon homo sapiens, bronchus, lung, trachea, state of michigan2017-03-07v4No1 / 22
94amnondominant feces, homo sapiens, state of michigan, clostridium difficile intestinal infectious disease, diarrhea2017-03-12v4No1 / 22
389amnoncommon united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 41
731amnonlower in oropharingeal otic fluid drainage compared to buccal mucosa ( high in mouth mucosa buccal mucosa compared to oropharynx in homo sapiens united states of america adult state of michigan )2021-01-09v4No1 / 41
389amnoncommon united states of america, farm, vagina, sus scrofa, state of michigan, pig2018-11-04v4No1 / 43
867amnoncommon feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, human adult stage, second trimester2022-02-09v3No1 / 52
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 71
389amnoncommon united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 72
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 76
731amnoncommon in orophringeal otic secretion drainage (common homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v4No1 / 77
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v4No1 / 80
867amnoncommon feces, homo sapiens, female, pregnancy, adult, italy, gestational diabetes, gestational diabetes, turin township, third trimester, human adult stage2022-02-09v3No1 / 85
731amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v4No1 / 85
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 112
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 114
389amnon high in age 4 weeks compared to age 1-3 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 168
389amnon high in age 1-3 weeks compared to age 4 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 189
388amnon high in age 6-10 weeks compared to age 12-19 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 210
388amnon high in age 12-19 weeks compared to age 6-10 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 231
821sheryoHigher at 50-100cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth 50-100m compared to depth (soil) 25-50cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 543
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v4No1 / 726
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 744
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, depth 50-100m, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 769
821sheryoHigher at 25-50cm depth compared to 50-100cm depth in soil in Michigan USA ( high in depth (soil) 25-50cm compared to depth 50-100m in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 784
821sheryoHigher at 25-50cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 25-50cm compared to depth (soil) 10-25cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 812
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-03v4No1 / 872
821sheryoCommon in soil of miscanthus field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm, restored prairie)2021-08-02v4No1 / 901
821sheryoHigher at 10-25cm depth compared to 0-10cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 0-10cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 930
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-07-28v4No1 / 963
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm, restored prairie)2021-07-28v4No1 / 968
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-03v4No1 / 974
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm, restored prairie)2021-07-28v4No1 / 1241
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth (soil) 0-10cm, ph 6.5, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1291
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm, restored prairie)2021-08-02v4No1 / 1377
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth (soil) 0-10cm, corn, ph 5.9, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 1380
821sheryoHigher at 0-10cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 0-10cm compared to depth (soil) 10-25cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 1383
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm)2021-08-02v4No1 / 1387
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth (soil) 0-10cm, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1447
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm)2021-07-28v4No1 / 1649
821sheryoHigher at 10-25cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 1704
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth (soil) 0-10cm, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-02v4No1 / 2067

Problems / suggestions? Please email info AT dbbact DOT org