Summary for ontology term: state of minnesota

Number of annotations with term: 93

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Cyanobacteria/ChloroplastTACAGAGGATGCAAGCGTTATCCGGAATCACTGGGCATAAAGCGTCTGTAGGTTGCTTAGCAAGTCTGTTGTTAAAGATCAGGGCCTAACCCTGGGAAAGCAATGGAAACTACTAGGCTTGAGTATGGTAGAGGTAGAGGGAATTCCTGG0.523077
d__BacteriaTACATAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGTCGTTAATTACGTCGGGTGTGAAAATCTGGGGCTCAACCCCAGACCTGCACTCGATACGGGTTAGCTAGAGTTTGGTAGGGGAGACTGGAATTCCTGG0.523077
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Burkholderiaceae;g__PolynucleobacterTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTATACAAGACAGGCGTGAAATCCCCGGGCTTAACCTGGGAATGGCGCCTGTGACTGTATAGCTAGAGTGTGTCAGAGGGGGGTAGAATTCCACG0.468085
d__Bacteria;p__Cyanobacteria/ChloroplastGACGGAGGATGCAAGTGTTATCCGGAATCACTGGGCGTAAAGCGTCTGTAGGTGTTTTAATAAGTCTGTTGTTAAAGCTTGAGGCTTAACCTCAAAAAAGCAATAGAAACTATTATGAATTGAGTGTGGTAGGGGTAGAGGGAATTTCCA0.460317
d__BacteriaTACATAGGGTGCAAGCGTTATTCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGTTCGATTAGTCGGGTGTTAAACCCCCAGGCTCAACCTGGGGCAGCCATCCGAAACTGTCGTGACTAGAGTTTGGTAGGGGATCACGGAATTCCTG0.442623
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__BurkholderialesTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTCTTGTAAGACAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTTGTGACTGCAAGGCTAGAGTGCGGCAGAGGGGGATGGAATTCCGCG0.413223
d__Bacteria;p__"Proteobacteria";c__BetaproteobacteriaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTCGAAACTGCAAGGCTAGAGTGTGTCAGAGGGGGGTAGAATTCCACG0.402439
d__Bacteria;p__"Actinobacteria";c__ActinobacteriaTACATAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGTGGTTTGTTGCGTCGGGTGTGAAATTCAGGGGCTCAACCCCTGACCTGCACTCGATACGGGCAGACTGGAGTTTGGTAGGGGAGACTGGAATTCCTGG0.400000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Methylococcales;f__Methylococcaceae;g__MethylobacterTACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGTTCGTTAAGTCAGATGTGAAAGCCCTGGGCTCAACCTGGGAACTGCATTTGAAACTGGCGGACTAGAGTTTAGTAGAGGGGAGTGGAATTTCAGG0.389262
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__ChitinophagaceaeTACGGAGGGTGCAAGCGTTATCCGGATTCACTGGGTTTAAAGGGTGCGTAGGCGGGTAGGTAAGTCAGTGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCATTGATACTATTTATCTTGAATATTGTGGAGGTAAGCGGAATATGTCA0.387597

Annotations:

common ontology terms
term enrichment score
TermScore
state of minnesota0.614158
bog lake0.507937
freshwater lake0.405063
epilimnion0.340426
hypolimnion0.340426
ph 4.5-50.340426
state of wisconsin0.336842
polymictic lake0.279070
dimictic lake0.279070
meromictic lake0.205128
como zoo0.176991
LOWER IN hypolimnion0.146789
LOWER IN epilimnion0.146789
quarry0.146789
"crystal bog" lake0.114286
"forestry bog" lake0.114286
"north sparkling bog" lake0.114286
ph 5-5.50.114286
"west sparkling bog" lake0.114286
"trout bog" lake0.114286
"south sparkling bog" lake0.114286
"hells kitchen" lake0.114286
"mary lake"0.114286
manganika lake0.114286
hypereutrophic lake0.114286
sulfidic bottom water0.114286
ph 5.5-60.108108
ph 4-4.50.102564
lake water0.102564
rock0.101911
zoological garden0.082305
mcquade lake0.079208
duluth complex0.079208
greenschist0.079208
lake sediment0.076190
sulfide0.076190
lake0.075472
ph 70.070796
united states of america0.062724
wildlife sactuary0.060606
wolf0.057143
ph 4-50.055172
dog0.048077
fresh water0.044944
canis lupus familiaris0.044843
pithecia pithecia0.041237
white-faced saki0.041237
ateles geoffroyi0.041237
black-handed spider monkey0.041237
saguinus imperator0.041237
emperor tamarin0.041237
domestic0.041237
LOWER IN depth 2.5cm0.041237
depth 2.5cm0.041237
catfish0.041237
bioreactor0.041237
pongo abelii0.040404
sumatran orangutan0.040404
LOWER IN lake sediment0.040404
depth0.040404
LOWER IN depth0.040404
ictalurus punctatus0.040404
channel catfish0.040404
fish feed0.040404
LOWER IN lake water0.039604
depth (soil) 15cm0.039604
LOWER IN depth (soil) 15cm0.039604
wastewater treatment plant0.038835
clostridium difficile intestinal infectious disease0.038095
gorilla gorilla0.038095
sediment0.036199
canis lupus0.035088
LOWER IN lake0.034783
water0.028369
LOWER IN fresh water0.026490
LOWER IN sediment0.025478
digestive system0.023669
saline lake0.021277
deep lake0.021277
shark bay0.021277
microbial mat0.021053
microbial biomat0.021053
LOWER IN wildlife sactuary0.021053
dog food diet0.021053
LOWER IN raw meat diet0.021053
raw meat diet0.021053
LOWER IN dog food diet0.021053
LOWER IN wolf0.020619
LOWER IN water0.019704
feces0.018295
australia0.017241
LOWER IN dog0.017241
LOWER IN canis lupus0.016807
LOWER IN canis lupus familiaris0.016807
research facility0.011747
homo sapiens0.006299
microbialite forming mat0.000000
Fraction of dbbact annotations with this term covered by the query
TermScore
saline lake1.000000
deep lake1.000000
shark bay1.000000
state of minnesota0.875000
microbial mat0.500000
microbial biomat0.500000
epilimnion0.500000
polymictic lake0.500000
bog lake0.500000
"crystal bog" lake0.500000
hypolimnion0.500000
LOWER IN hypolimnion0.500000
LOWER IN epilimnion0.500000
"forestry bog" lake0.500000
ph 4.5-50.500000
dimictic lake0.500000
"north sparkling bog" lake0.500000
ph 5-5.50.500000
"west sparkling bog" lake0.500000
"trout bog" lake0.500000
"south sparkling bog" lake0.500000
meromictic lake0.500000
"hells kitchen" lake0.500000
"mary lake"0.500000
pithecia pithecia0.500000
white-faced saki0.500000
como zoo0.500000
ateles geoffroyi0.500000
black-handed spider monkey0.500000
mcquade lake0.500000
manganika lake0.500000
hypereutrophic lake0.500000
sulfidic bottom water0.500000
saguinus imperator0.500000
emperor tamarin0.500000
domestic0.500000
wildlife sactuary0.500000
LOWER IN wildlife sactuary0.500000
dog food diet0.500000
LOWER IN raw meat diet0.500000
raw meat diet0.500000
LOWER IN dog food diet0.500000
quarry0.500000
duluth complex0.500000
LOWER IN depth 2.5cm0.500000
depth 2.5cm0.500000
greenschist0.500000
catfish0.500000
bioreactor0.500000
freshwater lake0.333333
ph 5.5-60.333333
pongo abelii0.333333
sumatran orangutan0.333333
LOWER IN lake sediment0.333333
lake sediment0.333333
sulfide0.333333
depth0.333333
LOWER IN depth0.333333
ictalurus punctatus0.333333
channel catfish0.333333
fish feed0.333333
state of wisconsin0.250000
ph 4-4.50.250000
lake water0.250000
LOWER IN lake water0.250000
wolf0.250000
LOWER IN wolf0.250000
depth (soil) 15cm0.250000
LOWER IN depth (soil) 15cm0.250000
ph 70.200000
wastewater treatment plant0.200000
clostridium difficile intestinal infectious disease0.166667
gorilla gorilla0.166667
rock0.125000
lake0.090909
LOWER IN lake0.090909
ph 4-50.076923
zoological garden0.066667
australia0.043478
dog0.043478
LOWER IN dog0.043478
canis lupus familiaris0.038462
canis lupus0.038462
LOWER IN canis lupus0.038462
LOWER IN canis lupus familiaris0.038462
fresh water0.034483
LOWER IN fresh water0.034483
united states of america0.032389
LOWER IN sediment0.031250
sediment0.031250
digestive system0.026316
water0.018182
LOWER IN water0.018182
feces0.009554
research facility0.006803
homo sapiens0.003690
microbialite forming mat0.000000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.989247
state of wisconsin0.516129
bog lake0.516129
freshwater lake0.516129
state of minnesota0.473118
epilimnion0.258065
hypolimnion0.258065
ph 4.5-50.258065
feces0.215054
polymictic lake0.193548
dimictic lake0.193548
meromictic lake0.129032
zoological garden0.107527
como zoo0.107527
LOWER IN hypolimnion0.086022
LOWER IN epilimnion0.086022
quarry0.086022
rock0.086022
ph 4-4.50.064516
"crystal bog" lake0.064516
"forestry bog" lake0.064516
"north sparkling bog" lake0.064516
ph 5-5.50.064516
"west sparkling bog" lake0.064516
"trout bog" lake0.064516
"south sparkling bog" lake0.064516
"hells kitchen" lake0.064516
ph 5.5-60.064516
"mary lake"0.064516
lake0.064516
water0.064516
fresh water0.064516
lake water0.064516
manganika lake0.064516
hypereutrophic lake0.064516
sulfidic bottom water0.064516
canis lupus familiaris0.053763
dog0.053763
mcquade lake0.043011
lake sediment0.043011
sediment0.043011
sulfide0.043011
duluth complex0.043011
ph 4-50.043011
ph 70.043011
greenschist0.043011
research facility0.043011
canis lupus0.032258
wolf0.032258
wildlife sactuary0.032258
homo sapiens0.021505
clostridium difficile intestinal infectious disease0.021505
pithecia pithecia0.021505
white-faced saki0.021505
ateles geoffroyi0.021505
black-handed spider monkey0.021505
pongo abelii0.021505
sumatran orangutan0.021505
gorilla gorilla0.021505
LOWER IN lake sediment0.021505
LOWER IN sediment0.021505
LOWER IN lake0.021505
LOWER IN water0.021505
LOWER IN fresh water0.021505
LOWER IN lake water0.021505
saguinus imperator0.021505
emperor tamarin0.021505
domestic0.021505
depth0.021505
depth (soil) 15cm0.021505
LOWER IN depth 2.5cm0.021505
depth 2.5cm0.021505
LOWER IN depth0.021505
LOWER IN depth (soil) 15cm0.021505
digestive system0.021505
ictalurus punctatus0.021505
catfish0.021505
channel catfish0.021505
fish feed0.021505
wastewater treatment plant0.021505
bioreactor0.021505
microbial mat0.010753
australia0.010753
saline lake0.010753
deep lake0.010753
shark bay0.010753
microbial biomat0.010753
microbialite forming mat0.010753
LOWER IN canis lupus0.010753
LOWER IN wolf0.010753
LOWER IN wildlife sactuary0.010753
LOWER IN canis lupus familiaris0.010753
LOWER IN dog0.010753
dog food diet0.010753
LOWER IN raw meat diet0.010753
raw meat diet0.010753
LOWER IN dog food diet0.010753
Exp. ID User ID Description Date Region Flag Sequences
907amnondominant united states of america, wastewater treatment plant, bioreactor, state of minnesota2022-05-19v4No1 / 1
205amnonhigh freq. in Ely Greenstone rock piles (dominant united states of america, quarry, rock, state of minnesota, ph 7, greenschist)2017-10-03v4No1 / 5
255amnondominant digestive system, united states of america, research facility, ictalurus punctatus, state of minnesota, catfish, channel catfish2017-11-24v4No1 / 5
255amnoncommon digestive system, united states of america, research facility, ictalurus punctatus, state of minnesota, catfish, channel catfish2017-11-24v4No1 / 8
255amnoncommon in fish feed (dominant united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 10
718amnondominant united states of america, state of wisconsin, meromictic lake, epilimnion, bog lake, freshwater lake, ph 5.5-6, "mary lake"2028-05-23v4No1 / 12
718amnondominant united states of america, state of wisconsin, meromictic lake, hypolimnion, bog lake, freshwater lake, "hells kitchen" lake2028-05-23v4No1 / 13
625amnondominant feces, united states of america, zoological garden, gorilla gorilla, state of minnesota, como zoo2020-05-16v4No1 / 13
508amnondominant united states of america, lake sediment, sediment, state of minnesota, manganika lake, hypereutrophic lake, sulfidic bottom water2019-03-17v4No1 / 13
185amnoncommon in patients with c. diff infection before treatment (common feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
718amnondominant united states of america, state of wisconsin, epilimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "trout bog" lake2028-05-23v4No1 / 14
718amnondominant united states of america, state of wisconsin, meromictic lake, hypolimnion, bog lake, freshwater lake, ph 5.5-6, "mary lake"2028-05-23v4No1 / 14
508amnondominant united states of america, lake, water, fresh water, state of minnesota, mcquade lake, lake water2019-03-17v4No1 / 14
508amnondominant united states of america, lake, water, fresh water, state of minnesota, lake water, manganika lake, hypereutrophic lake, sulfidic bottom water2019-03-17v4No1 / 15
718amnondominant united states of america, state of wisconsin, epilimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "south sparkling bog" lake2028-05-23v4No1 / 16
625amnondominant feces, united states of america, zoological garden, state of minnesota, pongo abelii, sumatran orangutan, como zoo2020-05-16v4No1 / 16
718amnondominant united states of america, state of wisconsin, hypolimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "trout bog" lake2028-05-23v4No1 / 17
718amnondominant united states of america, state of wisconsin, hypolimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "north sparkling bog" lake2028-05-23v4No1 / 18
718amnondominant united states of america, state of wisconsin, hypolimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "south sparkling bog" lake2028-05-23v4No1 / 18
625amnondominant feces, united states of america, zoological garden, state of minnesota, pithecia pithecia, white-faced saki, como zoo2020-05-16v4No1 / 18
625amnondominant feces, united states of america, zoological garden, state of minnesota, saguinus imperator, como zoo, emperor tamarin2020-05-16v4No1 / 18
205amnonhigh freq. in rock piles from duluth complex (dominant united states of america, quarry, rock, state of minnesota, sulfide, duluth complex, ph 4-5)2017-10-03v4No1 / 18
759amnondominant feces, united states of america, state of minnesota, canis lupus, wolf, wildlife sactuary2021-04-04v4No1 / 20
718amnondominant united states of america, state of wisconsin, epilimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "north sparkling bog" lake2028-05-23v4No1 / 21
185amnonhigh freq. in patients with c. diff infection before treatment (dominant feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
718amnondominant united states of america, state of wisconsin, epilimnion, polymictic lake, bog lake, freshwater lake, ph 4-4.5, "crystal bog" lake2028-05-23v4No1 / 22
718amnondominant united states of america, state of wisconsin, hypolimnion, polymictic lake, bog lake, freshwater lake, "forestry bog" lake, ph 4.5-52028-05-23v4No1 / 22
625amnondominant feces, united states of america, zoological garden, state of minnesota, ateles geoffroyi, como zoo, black-handed spider monkey2020-05-16v4No1 / 22
759amnondominant feces, united states of america, canis lupus familiaris, state of minnesota, dog, domestic2021-04-04v4No1 / 22
718amnondominant united states of america, state of wisconsin, meromictic lake, epilimnion, bog lake, freshwater lake, "hells kitchen" lake2028-05-23v4No1 / 23
718amnondominant united states of america, state of wisconsin, epilimnion, polymictic lake, bog lake, freshwater lake, "forestry bog" lake, ph 4.5-52028-05-23v4No1 / 24
718amnondominant united states of america, state of wisconsin, hypolimnion, polymictic lake, bog lake, freshwater lake, ph 4-4.5, "crystal bog" lake2028-05-23v4No1 / 25
718amnondominant united states of america, state of wisconsin, epilimnion, polymictic lake, bog lake, freshwater lake, ph 5-5.5, "west sparkling bog" lake2028-05-23v4No1 / 25
718amnondominant united states of america, state of wisconsin, hypolimnion, polymictic lake, bog lake, freshwater lake, ph 5-5.5, "west sparkling bog" lake2028-05-23v4No1 / 25
759amnon high in dog food diet compared to raw meat diet in feces united states of america canis lupus familiaris state of minnesota dog 2021-04-06v4No1 / 35
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin polymictic lake bog lake freshwater lake "forestry bog" lake ph 4.5-5 2028-05-23v4No1 / 47
759amnoncommon feces, united states of america, canis lupus familiaris, state of minnesota, dog, domestic2021-04-04v4No1 / 57
759amnoncommon feces, united states of america, state of minnesota, canis lupus, wolf, wildlife sactuary2021-04-04v4No1 / 58
759amnon high in raw meat diet compared to dog food diet in feces united states of america canis lupus familiaris state of minnesota dog 2021-04-06v4No1 / 74
759amnon high in canis lupus wolf wildlife sactuary compared to canis lupus familiaris dog in feces united states of america state of minnesota 2021-04-06v4No1 / 78
718amnoncommon united states of america, state of wisconsin, hypolimnion, polymictic lake, bog lake, freshwater lake, "forestry bog" lake, ph 4.5-52028-05-23v4No1 / 85
508amnon high in lake water fresh water lake water compared to lake sediment sediment in united states of america state of minnesota manganika lake hypereutrophic lake sulfidic bottom water 2019-03-17v4No1 / 91
718amnoncommon united states of america, state of wisconsin, epilimnion, polymictic lake, bog lake, freshwater lake, "forestry bog" lake, ph 4.5-52028-05-23v4No1 / 95
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin polymictic lake bog lake freshwater lake ph 4-4.5 "crystal bog" lake 2028-05-23v4No1 / 104
718amnoncommon united states of america, state of wisconsin, epilimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "north sparkling bog" lake2028-05-23v4No1 / 112
718amnoncommon united states of america, state of wisconsin, hypolimnion, polymictic lake, bog lake, freshwater lake, ph 5-5.5, "west sparkling bog" lake2028-05-23v4No1 / 112
718amnoncommon united states of america, state of wisconsin, hypolimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "north sparkling bog" lake2028-05-23v4No1 / 120
205amnonhigher in depth 15cm compared to 2.5cm in rock piles in duluth complex ( high in depth depth (soil) 15cm compared to depth 2.5cm in united states of america quarry rock state of minnesota sulfide duluth complex ph 4-5 )2017-10-03v4No1 / 120
718amnon high in hypolimnion compared to epilimnion in united states of america state of wisconsin polymictic lake bog lake freshwater lake "forestry bog" lake ph 4.5-5 2028-05-23v4No1 / 121
718amnoncommon united states of america, state of wisconsin, epilimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "trout bog" lake2028-05-23v4No1 / 121
718amnoncommon united states of america, state of wisconsin, hypolimnion, polymictic lake, bog lake, freshwater lake, ph 4-4.5, "crystal bog" lake2028-05-23v4No1 / 131
625amnoncommon feces, united states of america, zoological garden, state of minnesota, saguinus imperator, como zoo, emperor tamarin2020-05-16v4No1 / 132
718amnoncommon united states of america, state of wisconsin, epilimnion, polymictic lake, bog lake, freshwater lake, ph 5-5.5, "west sparkling bog" lake2028-05-23v4No1 / 140
718amnoncommon united states of america, state of wisconsin, epilimnion, polymictic lake, bog lake, freshwater lake, ph 4-4.5, "crystal bog" lake2028-05-23v4No1 / 141
255amnoncommon in fish feed (common united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 141
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in feces united states of america state of minnesota 2021-04-06v4No1 / 148
718amnoncommon united states of america, state of wisconsin, epilimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "south sparkling bog" lake2028-05-23v4No1 / 167
718amnoncommon united states of america, state of wisconsin, meromictic lake, epilimnion, bog lake, freshwater lake, "hells kitchen" lake2028-05-23v4No1 / 179
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pithecia pithecia, white-faced saki, como zoo2020-05-16v4No1 / 179
718amnoncommon united states of america, state of wisconsin, hypolimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "trout bog" lake2028-05-23v4No1 / 196
508amnoncommon united states of america, lake, water, fresh water, state of minnesota, lake water, manganika lake, hypereutrophic lake, sulfidic bottom water2019-03-17v4No1 / 196
718amnoncommon united states of america, state of wisconsin, meromictic lake, epilimnion, bog lake, freshwater lake, ph 5.5-6, "mary lake"2028-05-23v4No1 / 204
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin polymictic lake bog lake freshwater lake ph 5-5.5 "west sparkling bog" lake 2028-05-23v4No1 / 205
205amnoncommon in rock piles from duluth complex (common united states of america, quarry, rock, state of minnesota, sulfide, duluth complex, ph 4-5)2017-10-03v4No1 / 205
718amnoncommon united states of america, state of wisconsin, hypolimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "south sparkling bog" lake2028-05-23v4No1 / 211
508amnon high in lake water fresh water lake water compared to lake sediment sediment in united states of america state of minnesota mcquade lake 2019-03-17v4No1 / 214
886amnoncommon microbial mat, australia, saline lake, deep lake, shark bay, microbial biomat, microbialite forming mat2022-03-27v1No1 / 233
205amnoncommon in Ely Greenstone rock piles (common united states of america, quarry, rock, state of minnesota, ph 7, greenschist)2017-10-03v4No1 / 255
625amnoncommon feces, united states of america, zoological garden, state of minnesota, ateles geoffroyi, como zoo, black-handed spider monkey2020-05-16v4No1 / 256
205amnonlower in depth 15cm compared to 2.5cm in rock piles in duluth complex ( high in depth 2.5cm compared to depth depth (soil) 15cm in united states of america quarry rock state of minnesota sulfide duluth complex ph 4-5 )2017-10-03v4No1 / 265
907amnoncommon united states of america, wastewater treatment plant, bioreactor, state of minnesota2022-05-19v4No1 / 279
718amnon high in hypolimnion compared to epilimnion in united states of america state of wisconsin polymictic lake bog lake freshwater lake ph 5-5.5 "west sparkling bog" lake 2028-05-23v4No1 / 281
718amnon high in hypolimnion compared to epilimnion in united states of america state of wisconsin polymictic lake bog lake freshwater lake ph 4-4.5 "crystal bog" lake 2028-05-23v4No1 / 289
625amnoncommon feces, united states of america, zoological garden, gorilla gorilla, state of minnesota, como zoo2020-05-16v4No1 / 293
508amnoncommon united states of america, lake, water, fresh water, state of minnesota, mcquade lake, lake water2019-03-17v4No1 / 336
718amnon high in hypolimnion compared to epilimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "north sparkling bog" lake 2028-05-23v4No1 / 351
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "south sparkling bog" lake 2028-05-23v4No1 / 382
718amnoncommon united states of america, state of wisconsin, meromictic lake, hypolimnion, bog lake, freshwater lake, "hells kitchen" lake2028-05-23v4No1 / 400
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pongo abelii, sumatran orangutan, como zoo2020-05-16v4No1 / 414
508amnon high in lake sediment sediment compared to lake water fresh water lake water in united states of america state of minnesota manganika lake hypereutrophic lake sulfidic bottom water 2019-03-17v4No1 / 422
508amnon high in lake sediment sediment compared to lake water fresh water lake water in united states of america state of minnesota mcquade lake 2019-03-17v4No1 / 446
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "north sparkling bog" lake 2028-05-23v4No1 / 488
205amnonlower in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth 2.5cm compared to depth depth (soil) 15cm in united states of america quarry rock state of minnesota ph 7 greenschist )2017-10-03v4No1 / 499
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "trout bog" lake 2028-05-23v4No1 / 509
718amnoncommon united states of america, state of wisconsin, meromictic lake, hypolimnion, bog lake, freshwater lake, ph 5.5-6, "mary lake"2028-05-23v4No1 / 559
205amnonhigher in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth depth (soil) 15cm compared to depth 2.5cm in united states of america quarry rock state of minnesota ph 7 greenschist )2017-10-03v4No1 / 562
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin meromictic lake bog lake freshwater lake "hells kitchen" lake 2028-05-23v4No1 / 594
508amnoncommon united states of america, lake sediment, sediment, state of minnesota, manganika lake, hypereutrophic lake, sulfidic bottom water2019-03-17v4No1 / 693
718amnon high in hypolimnion compared to epilimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "south sparkling bog" lake 2028-05-23v4No1 / 812
718amnon high in hypolimnion compared to epilimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "trout bog" lake 2028-05-23v4No1 / 843
718amnon high in hypolimnion compared to epilimnion in united states of america state of wisconsin meromictic lake bog lake freshwater lake "hells kitchen" lake 2028-05-23v4No1 / 1165
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin meromictic lake bog lake freshwater lake ph 5.5-6 "mary lake" 2028-05-23v4No1 / 1195
718amnon high in hypolimnion compared to epilimnion in united states of america state of wisconsin meromictic lake bog lake freshwater lake ph 5.5-6 "mary lake" 2028-05-23v4No1 / 2370

Problems / suggestions? Please email info AT dbbact DOT org