Summary for ontology term: state of new york

Number of annotations with term: 114

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.008772
d__Bacteria;p__Firmicutes;c__Bacilli;o__BacillalesTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.008772
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.008772
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGGTGTGAAAACTCAAGGCTCAACCTTGAGCTTGCATCGGGTACGGGCAGACTAGAGTGCGGTAGGGGTGACTGGAATTCCTGG0.008772
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__AllobaculumTACGTAGGTGGCAAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGCAGGCGGCATATCAAGTCTGAAGTGAAAGGTACGGGCTCAACCTGTACAGGCTTTGGAAACTGGTATGCTCGAGGACAGGAGAGGGCGGTGGAACTCCACGT0.008772
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.008772
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGAAGAATAAGTCTGATGTGAAAGCCCTCGGCTTAACCGAGGAACTGCATCGGAAACTGTTTTTCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.008772
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGCAGCAAGTCTGATGTGAAAGGCAGGGGCTTAACCCCTGGACTGCATTGGAAACTGCTGTGCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.008772
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGAACGCAGGCGGTCTTTTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGTAGTGCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.008772
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__CollinsellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGCAGGCCGGGGGTCGAAGCGGGGGGCTCAACCCCCCGAAGCCCCCGGAACCTCCGCGGCTTGGGTCCGGTAGGGGAGGGTGGAACACCCGG0.008772

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACCATGGGCTCAACCCATGGCCTGCATTTGAAACTGTAGTTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCAGTCTTGAGTGCAGTAGAGGTGGGCGGAATTCGTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__RuminococcusTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAGTGCAAGTCAGGTGTGAAAACTATGGGCTCAACCCATAGACTGCACTTGAAACTGCATTTCTTGAGTGAAGTAGAGGTAAGCGGAATTCCTGG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__OlsenellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCAGTTAGGTCGGGAGTCAAATTTCGGGGCTCAACCCCGTCTCGCTCCCGATACCGGCTGGCTTGAGTGTGGTAGGGGAAGGCGGAATTCCCGGT0.500000
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__AkkermansiaTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCGCGGGCTCAACCCGCGGACGGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG0.500000
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGTTTAATAAGTCAGTGGTGAAAACTGAGGGCTCAACCCTCAGCCTGCCACTGATACTGTTAGACTTGAGTATGGAAGAGGAGAATGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGAAAGATAAGTCTGATGTGAAAGCCCCCGGCTTAACCGAGGAATTGCATCGGAAACTGTGTTTCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGGAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Xanthomonadales;f__XanthomonadaceaeTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCCATACCGCGTGGGTGAAGAAGGCCTTCGGGTTGTAAAGCCCTTTTGTTGGGAAAGAAATCCAGCCGGCTAATACCTGGTTGGGATGACGGTACCCAAAGAATAAGCACCGGC0.194286
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTTAATCGGGACGAATGGTTCTTGTGCGAATAGTGCGAGGATTTGACGGTACCGGAATAGAAAGCCACGG0.188341
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGGGGCAACCCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGAGAAGAACGAGTGTGAGAGTGGAAAGTTCACACTGTGACGGTAACTTACCAGAAAGGGACGG0.181818
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Comamonadaceae;g__DelftiaTGGGGAATTTTGGACAATGGGCGAAAGCCTGATCCAGCAATGCCGCGTGCAGGATGAAGGCCTTCGGGTTGTAAACTGCTTTTGTACGGAACGAAAAAGCTCCTTCTAATACAGGGGGCCCATGACGGTACCGTAAGAATAAGCACCGGC0.180556
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTGTTAGCAGGGAAGAAGAGAGATTGACGGTACCTGCAGAGAAAGCGCCGGCTAACTACGTGCCAGCAGCCG0.180328
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGACGGAAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTATGGGTTGTAAACTGCTTTTGTATGGGGATAAAGTTAGGGACGTGTCCCTATTTGCAGGTACCATACGAATAAGGACCGGCTAATT0.176000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTCGCTCATGGTCAAGCCGCAACTGTGGGTTGTGGTGAGGGTAGTGGGTAAAGAAGCGCCGGCTAACTAC0.171429
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__ParvimonasTGGGGAATATTGCACAATGGGGGGAACCCTGATGCAGCGACGCCGCGTGAGCGAAGAAGGTTTTCGAATCGTAAAGCTCTGTCCTATGAGAAGATAATGACGGTATCATAGGAGGAAGCCCCGGCTAAATACGTGCCAGCAGCCGCGGTA0.168539
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTGTTAGCATCGAAGAAGCGAAAGTGACGGTAGGTGCAGAGAAAGCGCCGGCTAACTACGTGCCAGCAGCCG0.166667
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTGGGGAATATTGGACAATGGACCAAGAGTCTGATCCAGCAATTCTGTGTGCACGATGAAGTTTTTCGGAATGTAAAGTGCTTTCAGTTGGGAAGAAAGAAATGACGGTACCAACAGAAGAAGTGACGGCTAAATACGTGCCAGCAGCCGC0.164384

Annotations:

common ontology terms
term enrichment score
TermScore
state of new york0.854701
depth (soil) 0-5cm0.349515
estuary0.269231
coarse-loamy soil0.219178
merlot0.197183
grapevine0.197183
vitis vinifera0.179487
new york city0.163009
long island sound0.161765
ph 60.152381
saline marsh0.149660
state of connecticut0.149660
day 820.149254
sediment surface0.109375
topsoil0.103286
oral wash0.101695
LOWER IN oral wash0.101695
united states of america0.085206
oral cavity0.075000
LOWER IN oral cavity0.075000
rhizosphere0.067568
cornell university0.065574
dorsum of tongue0.065574
phragmites australis0.065574
common reed0.065574
smooth cordgrass0.065574
biochar0.064935
saliva0.063253
spartina alterniflora0.061538
sporobolus alterniflorus0.061538
marine sediment0.060086
buccal mucosa0.059701
adult0.054536
mouth mucosa0.053333
gingiva0.050000
keratinized gingiva0.050000
hard palate0.050000
sporobolus pumilus0.050000
saltmeadow cordgrass0.050000
day 120.050000
LOWER IN day 10.050000
day 10.050000
LOWER IN day 120.050000
hunts point0.050000
soundview0.050000
oyster reef0.050000
homo sapiens0.049205
asian0.048780
caucasian0.047619
european0.047619
external naris0.047619
rattus norvegicus0.047059
palatine tonsil0.046512
supragingival dental plaque0.044444
rat0.043011
supragingival plaque0.041667
sediment0.041420
surface water0.040000
pair of nares0.038462
soil0.035821
leaf0.034483
postmenopausal0.034483
buffalo0.034483
idiopathic pulmonary fibrosis0.033898
new york county0.033898
stover ammendment 0.033898
LOWER IN sporobolus pumilus0.033898
LOWER IN saltmeadow cordgrass0.033898
LOWER IN smooth cordgrass0.033898
LOWER IN phragmites australis0.033898
LOWER IN common reed0.033898
stover ammendment soil0.033898
grape0.033333
african american0.032787
dentition0.032787
LOWER IN spartina alterniflora0.032787
LOWER IN sporobolus alterniflorus0.032787
wild0.032258
subgingival dental plaque0.032258
botanical fruit food product0.031746
bronchoalveolar lavage0.031250
lung0.029851
human late adulthood stage0.029851
female0.028777
subgingival plaque0.028169
sea water0.027397
mouth0.024691
feces0.023753
LOWER IN rhizosphere0.019802
LOWER IN chronic fatigue syndrome0.017241
chronic fatigue syndrome0.017241
LOWER IN gingiva0.017241
LOWER IN keratinized gingiva0.017241
LOWER IN sediment surface0.017241
LOWER IN city of boston0.017241
city of boston0.017241
stover amended soil0.017241
LOWER IN stover amended0.017241
LOWER IN hard palate0.017241
LOWER IN soundview0.017241
Fraction of dbbact annotations with this term covered by the query
TermScore
postmenopausal1.000000
buffalo1.000000
state of new york0.833333
depth (soil) 0-5cm0.666667
idiopathic pulmonary fibrosis0.500000
LOWER IN chronic fatigue syndrome0.500000
new york county0.500000
chronic fatigue syndrome0.500000
merlot0.500000
grapevine0.500000
cornell university0.500000
gingiva0.500000
keratinized gingiva0.500000
hard palate0.500000
dorsum of tongue0.500000
LOWER IN gingiva0.500000
LOWER IN keratinized gingiva0.500000
coarse-loamy soil0.500000
day 820.500000
stover ammendment 0.500000
estuary0.500000
long island sound0.500000
phragmites australis0.500000
common reed0.500000
sporobolus pumilus0.500000
saltmeadow cordgrass0.500000
smooth cordgrass0.500000
LOWER IN sporobolus pumilus0.500000
LOWER IN saltmeadow cordgrass0.500000
LOWER IN smooth cordgrass0.500000
LOWER IN phragmites australis0.500000
LOWER IN common reed0.500000
day 120.500000
LOWER IN day 10.500000
stover ammendment soil0.500000
day 10.500000
LOWER IN day 120.500000
sediment surface0.500000
hunts point0.500000
soundview0.500000
oyster reef0.500000
LOWER IN sediment surface0.500000
LOWER IN city of boston0.500000
city of boston0.500000
stover amended soil0.500000
LOWER IN stover amended0.500000
LOWER IN hard palate0.500000
LOWER IN soundview0.500000
LOWER IN oyster reef0.500000
LOWER IN hunts point0.500000
asian0.333333
LOWER IN asian0.333333
vitis vinifera0.333333
grape0.333333
smoker0.333333
cigarette smoking0.333333
saline marsh0.333333
state of connecticut0.333333
LOWER IN unamended0.333333
unamended0.333333
LOWER IN unamended soil0.333333
unamended soil0.333333
new york city0.285714
caucasian0.250000
european0.250000
african american0.250000
LOWER IN caucasian0.250000
LOWER IN european0.250000
external naris0.250000
nicotine dependence0.250000
LOWER IN non-smoker0.250000
LOWER IN external naris0.250000
spartina alterniflora0.250000
sporobolus alterniflorus0.250000
LOWER IN spartina alterniflora0.250000
LOWER IN sporobolus alterniflorus0.250000
palatine tonsil0.200000
buccal mucosa0.200000
LOWER IN palatine tonsil0.200000
LOWER IN buccal mucosa0.200000
subgingival dental plaque0.200000
botanical fruit food product0.166667
ph 60.166667
bronchoalveolar lavage0.142857
supragingival dental plaque0.142857
oral wash0.142857
LOWER IN oral wash0.142857
LOWER IN new york city0.142857
LOWER IN supragingival dental plaque0.142857
biochar0.125000
LOWER IN biochar0.125000
LOWER IN low bmi0.111111
low bmi0.111111
mouth mucosa0.111111
topsoil0.111111
LOWER IN commonwealth of massachusetts0.111111
commonwealth of massachusetts0.111111
LOWER IN mouth mucosa0.111111
lung0.100000
supragingival plaque0.100000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.982456
state of new york0.877193
homo sapiens0.517544
adult0.482456
depth (soil) 0-5cm0.236842
estuary0.184211
feces0.175439
soil0.157895
ph 60.140351
coarse-loamy soil0.140351
rhizosphere0.131579
vitis vinifera0.122807
merlot0.122807
grapevine0.122807
new york city0.114035
saline marsh0.096491
topsoil0.096491
state of connecticut0.096491
long island sound0.096491
day 820.087719
oral cavity0.078947
oral wash0.078947
LOWER IN oral cavity0.078947
LOWER IN oral wash0.078947
saliva0.061404
sediment0.061404
marine sediment0.061404
sediment surface0.061404
biochar0.043860
cornell university0.035088
mouth mucosa0.035088
buccal mucosa0.035088
dorsum of tongue0.035088
phragmites australis0.035088
common reed0.035088
spartina alterniflora0.035088
sporobolus alterniflorus0.035088
smooth cordgrass0.035088
rattus norvegicus0.035088
rat0.035088
caucasian0.026316
european0.026316
asian0.026316
female0.026316
root0.026316
leaf0.026316
pair of nares0.026316
external naris0.026316
gingiva0.026316
keratinized gingiva0.026316
palatine tonsil0.026316
dentition0.026316
supragingival plaque0.026316
supragingival dental plaque0.026316
hard palate0.026316
sporobolus pumilus0.026316
saltmeadow cordgrass0.026316
day 120.026316
LOWER IN day 10.026316
day 10.026316
LOWER IN day 120.026316
hunts point0.026316
soundview0.026316
oyster reef0.026316
surface water0.026316
sea water0.026316
wild0.026316
african american0.017544
lung0.017544
bronchoalveolar lavage0.017544
idiopathic pulmonary fibrosis0.017544
new york county0.017544
grape0.017544
botanical fruit food product0.017544
LOWER IN rhizosphere0.017544
LOWER IN root0.017544
mouth0.017544
stover ammendment 0.017544
LOWER IN sporobolus pumilus0.017544
LOWER IN saltmeadow cordgrass0.017544
LOWER IN spartina alterniflora0.017544
LOWER IN sporobolus alterniflorus0.017544
LOWER IN smooth cordgrass0.017544
LOWER IN phragmites australis0.017544
LOWER IN common reed0.017544
stover ammendment soil0.017544
subgingival plaque0.017544
subgingival dental plaque0.017544
postmenopausal0.017544
buffalo0.017544
human late adulthood stage0.017544
body mass index0.008772
high bmi0.008772
LOWER IN low bmi0.008772
low bmi0.008772
LOWER IN body mass index0.008772
LOWER IN high bmi0.008772
control0.008772
LOWER IN chronic fatigue syndrome0.008772
chronic fatigue syndrome0.008772
Exp. ID User ID Description Date Region Flag Sequences
101amnondominant united states of america, vitis vinifera, state of new york, merlot, grapevine, root2017-04-03v4No1 / 1
806amnon high in nicotine dependence smoker cigarette smoking compared to non-smoker in homo sapiens united states of america mouth mucosa adult state of new york buccal mucosa 2021-06-19v3No1 / 1
784amnondominant united states of america, estuary, saline marsh, rhizosphere, topsoil, state of connecticut, long island sound, phragmites australis, common reed, depth (soil) 0-5cm2021-05-16v4No1 / 1
600sheryoDominant in unammended soil after 82 days (dominant united states of america, soil, state of new york, ph 6, coarse-loamy soil, day 82, depth (soil) 0-5cm)2020-03-27v4No1 / 1
101amnondominant united states of america, leaf, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 2
101amnondominant united states of america, vitis vinifera, state of new york, merlot, grapevine, grape, botanical fruit food product2017-04-03v4No1 / 2
600sheryodecearses after 12 days of unammendment in soil ( high in day 1 compared to day 12 in united states of america soil state of new york ph 6 coarse-loamy soil depth (soil) 0-5cm )2020-03-27v4No1 / 2
600sheryoDominant in biochar ammended soil after 82 days (dominant united states of america, soil, state of new york, ph 6, biochar, coarse-loamy soil, day 82, depth (soil) 0-5cm)2020-03-27v4No1 / 3
784amnondominant united states of america, estuary, saline marsh, rhizosphere, spartina alterniflora, topsoil, state of connecticut, long island sound, sporobolus alterniflorus, smooth cordgrass, depth (soil) 0-5cm2021-05-16v4No1 / 3
806amnon high in mouth mucosa buccal mucosa compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 3
600sheryoDominant in stover ammended soil after 82 days (dominant united states of america, soil, state of new york, ph 6, coarse-loamy soil, day 82, stover ammendment , depth (soil) 0-5cm)2020-03-27v4No1 / 4
806amnon high in hard palate compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 5
806amnon high in oral cavity oral wash compared to saliva in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 7
722amnondominant united states of america, estuary, sediment, marine sediment, state of new york, new york city, sediment surface, hunts point2021-01-02v4No1 / 8
722amnondominant united states of america, estuary, sediment, marine sediment, state of new york, new york city, sediment surface, soundview, oyster reef2021-01-02v4No1 / 8
101amnoncommon united states of america, leaf, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 9
806amnon high in dentition supragingival plaque supragingival dental plaque compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 10
806amnon high in palatine tonsil compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 11
806amnondominant homo sapiens, united states of america, adult, state of new york, gingiva, keratinized gingiva2021-06-19v3No1 / 12
806amnon high in saliva compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 12
806amnondominant homo sapiens, united states of america, oral cavity, adult, state of new york, oral wash, mouth2021-06-19v3No1 / 13
469amnondominant homo sapiens, united states of america, lung, bronchoalveolar lavage, adult, state of new york, idiopathic pulmonary fibrosis2019-01-14v4No1 / 14
802amnondominant homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 15
806amnondominant homo sapiens, united states of america, dentition, adult, state of new york, supragingival plaque, supragingival dental plaque2021-06-19v3No1 / 15
806amnondominant homo sapiens, united states of america, adult, state of new york, dorsum of tongue2021-06-19v3No1 / 15
493amnondominant homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 16
759amnondominant feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 17
806amnon high in dorsum of tongue compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 17
650amnondominant feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 18
12amnon high in chronic fatigue syndrome compared to control in feces homo sapiens new york county 2016-11-02v4No1 / 18
806amnondominant homo sapiens, united states of america, pair of nares, adult, state of new york, external naris2021-06-19v3No1 / 18
806amnondominant homo sapiens, united states of america, mouth mucosa, adult, state of new york, buccal mucosa2021-06-19v3No1 / 18
806amnondominant homo sapiens, united states of america, adult, state of new york, hard palate2021-06-19v3No1 / 18
874amnondominant homo sapiens, united states of america, female, state of new york, subgingival plaque, subgingival dental plaque, postmenopausal, buffalo, human late adulthood stage2022-03-04v3No1 / 18
101amnoncommon united states of america, vitis vinifera, state of new york, merlot, grapevine, grape, botanical fruit food product2017-04-03v4No1 / 19
806amnondominant homo sapiens, united states of america, adult, state of new york, palatine tonsil2021-06-19v3No1 / 19
650amnondominant feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 20
722amnondominant united states of america, estuary, surface water, sea water, state of new york, new york city2021-01-02v4No1 / 20
806amnondominant homo sapiens, united states of america, saliva, adult, state of new york2021-06-19v3No1 / 21
650amnondominant feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 22
806amnoncommon homo sapiens, united states of america, adult, state of new york, gingiva, keratinized gingiva2021-06-19v3No1 / 22
469amnoncommon homo sapiens, united states of america, lung, bronchoalveolar lavage, adult, state of new york, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
650amnonpositively correlated with BMI ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america adult state of new york )2020-09-09v4No1 / 26
101amnon high in rhizosphere compared to soil in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 26
802amnondominant feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 26
806amnon high in gingiva keratinized gingiva compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 28
806amnoncommon homo sapiens, united states of america, adult, state of new york, dorsum of tongue2021-06-19v3No1 / 29
600sheryodecearses after 12 days of biochar ammendment in soil ( high in day 1 compared to day 12 in united states of america soil state of new york ph 6 biochar coarse-loamy soil depth (soil) 0-5cm )2020-03-27v4No1 / 30
806amnoncommon homo sapiens, united states of america, adult, state of new york, hard palate2021-06-19v3No1 / 31
101amnoncommon united states of america, leaf, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 32
806amnon high in pair of nares external naris compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 32
12amnon high in control compared to chronic fatigue syndrome in feces homo sapiens new york county 2016-11-02v4No1 / 35
806amnoncommon homo sapiens, united states of america, pair of nares, adult, state of new york, external naris2021-06-19v3No1 / 38
806amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of new york, buccal mucosa2021-06-19v3No1 / 40
806amnoncommon homo sapiens, united states of america, dentition, adult, state of new york, supragingival plaque, supragingival dental plaque2021-06-19v3No1 / 41
806amnoncommon homo sapiens, united states of america, adult, state of new york, palatine tonsil2021-06-19v3No1 / 48
806amnon high in oral cavity oral wash compared to hard palate in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 48
650amnoncommon feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 52
650amnoncommon feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 56
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
806amnon high in oral cavity oral wash compared to mouth mucosa buccal mucosa in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 57
806amnon high in oral cavity oral wash compared to dentition supragingival plaque supragingival dental plaque in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 58
600sheryoincearses after 12 days of unammendment in soil ( high in day 12 compared to day 1 in united states of america soil state of new york ph 6 coarse-loamy soil depth (soil) 0-5cm )2020-03-27v4No1 / 60
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
874amnoncommon homo sapiens, united states of america, female, state of new york, subgingival plaque, subgingival dental plaque, postmenopausal, buffalo, human late adulthood stage2022-03-04v3No1 / 67
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult state of new york )2020-09-09v4No1 / 75
650amnon high in male compared to female in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 82
802amnoncommon homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 85
806amnoncommon homo sapiens, united states of america, oral cavity, adult, state of new york, oral wash, mouth2021-06-19v3No1 / 86
600sheryoIncearses after 12 days of biochar ammendment in soil ( high in day 12 compared to day 1 in united states of america soil state of new york ph 6 biochar coarse-loamy soil depth (soil) 0-5cm )2020-03-27v4No1 / 86
806amnon high in oral cavity oral wash compared to palatine tonsil in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 87
759amnoncommon feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 94
759amnon high in state of new york new york city wild compared to research facility commonwealth of massachusetts city of boston in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
493amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 104
806amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2021-06-19v3No1 / 106
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
806amnon high in dorsum of tongue compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 126
600sheryolower in biochar ammendment soil ( high in unamended compared to biochar in united states of america soil state of new york ph 6 coarse-loamy soil day 82 depth (soil) 0-5cm )2020-03-27v4No1 / 166
806amnon high in oral cavity oral wash compared to pair of nares external naris in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 178
600sheryoIncearses after 12 days of stover ammendment in soil ( high in day 12 compared to day 1 in united states of america soil state of new york ph 6 coarse-loamy soil stover ammendment soil depth (soil) 0-5cm )2020-03-27v4No1 / 196
784amnoncommon united states of america, estuary, saline marsh, rhizosphere, topsoil, state of connecticut, long island sound, phragmites australis, common reed, depth (soil) 0-5cm2021-05-16v4No1 / 204
759amnon high in research facility commonwealth of massachusetts city of boston compared to state of new york new york city wild in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 217
101amnon high in soil compared to rhizosphere in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 249
600sheryohigher in biochar ammendment soil ( high in biochar compared to unamended in united states of america soil state of new york ph 6 coarse-loamy soil day 82 depth (soil) 0-5cm )2020-03-27v4No1 / 252
784amnon high in phragmites australis common reed compared to sporobolus pumilus saltmeadow cordgrass in united states of america estuary saline marsh rhizosphere topsoil state of connecticut long island sound depth (soil) 0-5cm 2021-05-16v4No1 / 267
784amnon high in sporobolus pumilus saltmeadow cordgrass compared to spartina alterniflora sporobolus alterniflorus smooth cordgrass in united states of america estuary saline marsh rhizosphere topsoil state of connecticut long island sound depth (soil) 0-5cm 2021-05-16v4No1 / 277
806amnon high in oral cavity oral wash compared to gingiva keratinized gingiva in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 288
722amnoncommon united states of america, estuary, surface water, sea water, state of new york, new york city2021-01-02v4No1 / 301
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
784amnon high in spartina alterniflora sporobolus alterniflorus smooth cordgrass compared to sporobolus pumilus saltmeadow cordgrass in united states of america estuary saline marsh rhizosphere topsoil state of connecticut long island sound depth (soil) 0-5cm 2021-05-16v4No1 / 380
784amnoncommon united states of america, estuary, saline marsh, rhizosphere, topsoil, state of connecticut, long island sound, sporobolus pumilus, saltmeadow cordgrass, depth (soil) 0-5cm2021-05-16v4No1 / 382
722amnon high in surface water sea water compared to sediment marine sediment sediment surface in united states of america estuary state of new york new york city 2021-01-02v4No1 / 399
722amnon high in soundview oyster reef compared to hunts point in united states of america estuary sediment marine sediment state of new york new york city sediment surface 2021-01-02v4No1 / 469
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
784amnoncommon united states of america, estuary, saline marsh, rhizosphere, spartina alterniflora, topsoil, state of connecticut, long island sound, sporobolus alterniflorus, smooth cordgrass, depth (soil) 0-5cm2021-05-16v4No1 / 511
600sheryohigher in stover ammendment soil ( high in stover amended soil compared to unamended soil in united states of america soil state of new york ph 6 coarse-loamy soil day 82 depth (soil) 0-5cm )2020-03-27v4No1 / 567
784amnon high in sporobolus pumilus saltmeadow cordgrass compared to phragmites australis common reed in united states of america estuary saline marsh rhizosphere topsoil state of connecticut long island sound depth (soil) 0-5cm 2021-05-16v4No1 / 581
722amnon high in hunts point compared to soundview oyster reef in united states of america estuary sediment marine sediment state of new york new york city sediment surface 2021-01-02v4No1 / 696
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in united states of america soil state of new york ph 6 coarse-loamy soil stover ammendment soil depth (soil) 0-5cm )2020-03-27v4No1 / 747
784amnon high in phragmites australis common reed compared to spartina alterniflora sporobolus alterniflorus smooth cordgrass in united states of america estuary saline marsh rhizosphere topsoil state of connecticut long island sound depth (soil) 0-5cm 2021-05-16v4No1 / 918
722amnoncommon united states of america, estuary, sediment, marine sediment, state of new york, new york city, sediment surface, soundview, oyster reef2021-01-02v4No1 / 922
722amnoncommon united states of america, estuary, sediment, marine sediment, state of new york, new york city, sediment surface, hunts point2021-01-02v4No1 / 1001
101amnoncommon united states of america, vitis vinifera, state of new york, merlot, grapevine, root2017-04-03v4No1 / 1106
101amnon high in rhizosphere compared to root in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 1315
600sheryoCommon in biochar ammended soil after 82 days (common united states of america, soil, state of new york, ph 6, biochar, coarse-loamy soil, day 82, depth (soil) 0-5cm)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common united states of america, soil, state of new york, ph 6, coarse-loamy soil, day 82, stover ammendment , depth (soil) 0-5cm)2020-03-27v4No1 / 1327
600sheryoCommon in unammended soil after 82 days (common united states of america, soil, state of new york, ph 6, coarse-loamy soil, day 82, depth (soil) 0-5cm)2020-03-27v4No1 / 1395
784amnon high in spartina alterniflora sporobolus alterniflorus smooth cordgrass compared to phragmites australis common reed in united states of america estuary saline marsh rhizosphere topsoil state of connecticut long island sound depth (soil) 0-5cm 2021-05-16v4No1 / 1421
101amnon high in rhizosphere compared to root in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 1588
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in united states of america soil state of new york ph 6 coarse-loamy soil day 82 depth (soil) 0-5cm )2020-03-27v4No1 / 1612
722amnon high in sediment marine sediment sediment surface compared to surface water sea water in united states of america estuary state of new york new york city 2021-01-02v4No1 / 1736
101amnoncommon united states of america, rhizosphere, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 1980
101amnon high in root compared to rhizosphere in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 2075
101amnoncommon united states of america, soil, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 2537

Problems / suggestions? Please email info AT dbbact DOT org