Summary for ontology term: state of oregon

Number of annotations with term: 28

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__PeptostreptococcaceaeTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTTAAGTCAGAAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTTTTGAAACTGGAGGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.160000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGAAGAGCAAGTCTGATGTGAAAACCCGGGGCTTAACCCCGGGCCTGCATTGGAAACTGTTTTTCTGGAGTACTGGAAGGGCAGGCGGAATTCCTGG0.160000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTCCTTTAAGCGTGTTGTGAAATACTGCCGCTCAACGGCAGAGGTGCAGCGCGAACTGGAGGACTTGAGTGCGCGGAAGGCAGGCGGAATTCGTCG0.160000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.120000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGCAGACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTATGTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.120000
d__BacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTTGTTTTGTAAGTCAGAGGTGTAATCCCACGGCTTAACCGTGGAACTGCCTTTGATACTGCATAACTTGGATCCGGGAGAGGACAGCGGAATTCCAGG0.120000
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTCTTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGAGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.120000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGGCAAGTTGGAAGTGAAAACCATGGGCTCAACCCATGAATTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGATGGAATTCCCGG0.120000
d__BacteriaCACGTAAGTTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGTTATCTAAGCTTGGTGTGAAAGGCAGGGGCTTAACTCCTGGACTGCATTGAGAACTGGATGACTAGAGTTACTGAAGTGGAATCAGAATTCCAGG0.120000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGAAAAATAAGTCTAATGTGAAAGCCCTCGGCTTAACCGAGGAACTGCATCGGAAACTGTTTTTCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.120000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGAGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTTTTTCTAGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.800000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGCGCGCCAAGTCAGCGGTCAAAGTTCCGGGCTCAACCCGGTGTCGCCGTTGAAACTGGCGTGCTCGAGTGCGTGCGAGGAAGGCGGAATGCGTTGT0.800000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGGGTAAGCGTGTTGTGAAATGCAGTTGCTCAACATCTGCACTGCAGCGCGAACTGTTCTCCTTGAGTGCGCAGGAAGTAGGCGGAATTCGTCG0.800000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGTGTAGGTGGCCATGCAAGTCAGAAGTGAAAATCCGGGGCTCAACCCCGGAACTGCTTTTGAAACTGTGAGGCTAGAGTGCAGGAGGGGTGAGTGGAATTCCTAG0.600000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Ruminococcus2TACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGTGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAATCTAGAGTACCGGAGAGGTAAGCGGAATTCCTAG0.600000
d__BacteriaTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGTGCGCAGGCGGATTGTTAAGTTCGAGGTGAAAGCGTTGGGCTCAACCCAATATAGCCTTAAATACTGGCAATCTAGAGTGCAGAAGAGGGTAATGGAATTCCATGT0.600000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGCATGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAGCCTGCTTTCAAAACTGCGTGTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.600000
d__Bacteria;p__"Bacteroidetes"TACGGGGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCAAGGTAAGTCAGCGGTGAAAGACCAGGGCTCAACTCTGGAAGTGCCGTTGATACTGTCTGGCTAGAATGATTCCGCCGTGGGAGGAATGAGTAG0.600000
d__BacteriaTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGGGTGCGTAGGCGGCCTTTTAAGTTTGTGGTGAAAGCGTGGGGCTCAACCCCATACAGCCATAGATACTGGGAGGCTAGAGTACTGGAGAGGGTAGTGGAATTCCATGT0.600000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCAGGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGATTGCATTGGAAACTGTCCAGCTCGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.600000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__ArchaeaCACCGGCAGCCCAAGTGGTAGCCACGATTATTGGGTCTAAAGCGTCCGTAGCCGGCCAGGTAAGTTCTTTGGGAAATTTAACCGCTCAACGGTTAAGCTTTCAGGGAATACTGCTTGGCTTGGGACCGGGAGAGGTCAGAGGTACTTCAA0.270270
TTCCAGCTCCAATAGCGTATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCGGGTGGGTTGCAATGGTCCGGTTCGCTGTGTACTGTTGCGGCCTTCCTTTCTGCCGGGGACGGGCTCTTGGGCTTCATTGTCTGGGATCC0.258065
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__ChitinophagaceaeTACGGAGGGTGCAAGCGTTATCCGGATTTACTGGGTTTAAAGGGTGCGTAGGTGGGTAGGAAAGTCAGTGGTGAAATCTTCAAGCTTAACTTGGAAACTGCCATTGATACTTTTTATCTTGAATATCCCGGAGGTAAGCGGAATATGTCA0.250000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__AcetobacteraceaeTACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGCTTACTAAGTTAGGTGTGAAATTCCTGGGCTTAACCTGGGGACTGCCCTTAATACAGGTAGGCTAGAGTGAGGAAGAGGGTTGTGGAATTCCCAG0.250000
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__Cytophagales;f__Cytophagaceae;g__HymenobacterTACGGAGGGTGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTTTTTAAGTCCGGGGTGAAAGCCCGTTGCTCAACAACGGAACTGCCCCGGAAACTGGAGAGCTTGAGTACAGACGAGGGCGGCGGAATGGACGG0.250000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTCATTAAGTCAGTGGTGAAAGGTACCCGCTTAACGGGGACACTGCCATTGATACTGATGAGCTGGAGTACAGATGAAGTGGGCGGAATGTGTCA0.235294
d__BacteriaTACGTAGGAGGCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTGCAGGTGGTTTGGTAAGTTGGGTATGAAATCTCCTGGCTTAACTAGGAGAGGTTGCTCAAAACTACCAGACTAGAGGACGGTAGAGGAAGGTGGAATTCCCGG0.228571
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__ChitinophagaceaeTACGGAGGGTGCAAGCGTTATCCGGATTTACTGGGTTTAAAGGGTGCGTAGGTGGGCAGGTAAGTCAGTGGTGAAATCTTCAAGCTTAACTTGGAAACTGCCATTGATACTATTTGTCTTGAATATCCCGGAGGTAAGCGGAATATGTCA0.228571
CACCGGCAGCCCAAGTGGTAGCCACGTTTATTGGGTCTAAAGCGTTCGTAGCCGGCTTGGTAAGTTCCTTGGTAAATTTAGCCGCTTAACGGTTAAGCTTTCAGGGAATACTGCTTGGCTTGGGACTGGGAGAGGTCAGAGGTACTCCAG0.228571
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTCCTTTAAGCGTGTTGTGAAATACTGCCGCTCAACGGCAGAGGTGCAGCGCGAACTGGAGGACTTGAGTGCGCGGAAGGCAGGCGGAATTCGTCG0.228571

Annotations:

common ontology terms
term enrichment score
TermScore
state of oregon0.845070
rhesus macaque0.363636
carbonate0.300000
lithified carbonate blocks0.300000
hydrate ridge0.300000
age 9 weeks0.232558
stratovolcano0.222222
macaca mulatta0.210526
snow field0.181818
active methane seep0.176471
low activity methane seep0.176471
depth (water) 500-1000m0.171429
glacier0.166667
oil seep0.162162
LOWER IN state of oregon0.153846
age 4 weeks0.139535
age 8 months0.125000
age 21 days0.117647
age 1 month0.117647
monkey0.114286
snow0.111111
zebra fish0.105263
sediment0.102564
juvenile organism0.100000
danio rerio0.100000
ocean0.096774
3-month-old human stage0.095238
c57bl/60.093023
captive0.093023
fish0.068966
pacific ocean0.067416
LOWER IN low activity methane seep0.066667
LOWER IN active methane seep0.066667
LOWER IN zinc deficiency0.066667
LOWER IN low zinc diet0.066667
zinc deficiency0.066667
low zinc diet0.066667
LOWER IN oil seep0.064516
LOWER IN age 9 weeks0.064516
state of california0.060606
LOWER IN state of california0.060606
LOWER IN age 4 weeks0.060606
female0.058309
intestine0.051282
research facility0.039560
mouse0.033058
united states of america0.031735
mus musculus0.030075
feces0.012598
adult0.010695
control0.009390
LOWER IN control0.009390
Fraction of dbbact annotations with this term covered by the query
TermScore
state of oregon0.833333
active methane seep0.500000
LOWER IN low activity methane seep0.500000
carbonate0.500000
lithified carbonate blocks0.500000
hydrate ridge0.500000
low activity methane seep0.500000
LOWER IN active methane seep0.500000
rhesus macaque0.500000
age 8 months0.500000
stratovolcano0.500000
LOWER IN zinc deficiency0.500000
LOWER IN low zinc diet0.500000
zinc deficiency0.500000
low zinc diet0.500000
age 9 weeks0.333333
oil seep0.333333
LOWER IN oil seep0.333333
age 21 days0.333333
age 1 month0.333333
LOWER IN age 9 weeks0.333333
snow field0.250000
snow0.250000
age 4 weeks0.200000
zebra fish0.200000
glacier0.200000
LOWER IN age 4 weeks0.200000
juvenile organism0.166667
danio rerio0.166667
LOWER IN state of oregon0.166667
macaca mulatta0.166667
depth (water) 500-1000m0.142857
3-month-old human stage0.142857
monkey0.071429
fish0.066667
ocean0.062500
sediment0.062500
c57bl/60.055556
captive0.055556
pacific ocean0.040000
intestine0.040000
state of california0.038462
LOWER IN state of california0.038462
female0.031746
research facility0.020408
mouse0.017544
united states of america0.016194
mus musculus0.015873
feces0.006369
adult0.005780
control0.005405
LOWER IN control0.005405
Fraction of annotations for the query sequences containing the term
TermScore
state of oregon0.857143
united states of america0.785714
research facility0.642857
feces0.571429
female0.357143
mus musculus0.285714
c57bl/60.285714
mouse0.285714
sediment0.285714
macaca mulatta0.285714
monkey0.285714
captive0.285714
rhesus macaque0.285714
ocean0.214286
pacific ocean0.214286
carbonate0.214286
lithified carbonate blocks0.214286
hydrate ridge0.214286
depth (water) 500-1000m0.214286
age 9 weeks0.178571
state of california0.142857
LOWER IN state of oregon0.142857
LOWER IN state of california0.142857
glacier0.142857
snow field0.142857
stratovolcano0.142857
age 4 weeks0.107143
oil seep0.107143
active methane seep0.107143
low activity methane seep0.107143
intestine0.071429
juvenile organism0.071429
danio rerio0.071429
zebra fish0.071429
fish0.071429
age 21 days0.071429
age 1 month0.071429
age 8 months0.071429
3-month-old human stage0.071429
snow0.071429
adult0.071429
LOWER IN low activity methane seep0.035714
LOWER IN oil seep0.035714
LOWER IN active methane seep0.035714
LOWER IN age 9 weeks0.035714
LOWER IN age 4 weeks0.035714
control0.035714
LOWER IN zinc deficiency0.035714
LOWER IN low zinc diet0.035714
zinc deficiency0.035714
low zinc diet0.035714
LOWER IN control0.035714
Exp. ID User ID Description Date Region Flag Sequences
486amnondominant ocean, sediment, pacific ocean, state of oregon, carbonate, lithified carbonate blocks, hydrate ridge, low activity methane seep, depth (water) 500-1000m2019-02-19v4No1 / 4
435amnondominant feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 4 weeks2018-12-23v4No1 / 7
435amnondominant feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 9 weeks2018-12-23v4No1 / 7
435amnon high in zinc deficiency low zinc diet compared to control in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse age 9 weeks 2018-12-23v4No1 / 7
435amnon high in control compared to zinc deficiency low zinc diet in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse age 9 weeks 2018-12-23v4No1 / 8
486amnondominant ocean, sediment, oil seep, pacific ocean, state of oregon, carbonate, lithified carbonate blocks, hydrate ridge, active methane seep, depth (water) 500-1000m2019-02-19v4No1 / 9
224amnondominant united states of america, glacier, snow field, stratovolcano, state of oregon, snow2017-10-26v4No1 / 14
435amnoncommon feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 4 weeks2018-12-23v4No1 / 15
437amnondominant united states of america, research facility, intestine, juvenile organism, danio rerio, state of oregon, zebra fish, fish, age 21 days2018-12-26v4No1 / 20
224amnondominant united states of america, glacier, snow field, stratovolcano, sediment, state of oregon2017-10-26v4No1 / 21
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
435amnoncommon feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 9 weeks2018-12-23v4No1 / 30
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 3-month-old human stage 2020-09-27v4No1 / 38
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 3-month-old human stage 2020-09-27v4No1 / 52
437amnoncommon united states of america, research facility, intestine, juvenile organism, danio rerio, state of oregon, zebra fish, fish, age 21 days2018-12-26v4No1 / 54
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 66
435amnonhigher in mice at end of experiment compared to initial sample ( high in age 9 weeks compared to age 4 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 73
224amnoncommon united states of america, glacier, snow field, stratovolcano, sediment, state of oregon2017-10-26v4No1 / 87
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 140
486amnoncommon ocean, sediment, oil seep, pacific ocean, state of oregon, carbonate, lithified carbonate blocks, hydrate ridge, active methane seep, depth (water) 500-1000m2019-02-19v4No1 / 163
224amnoncommon united states of america, glacier, snow field, stratovolcano, state of oregon, snow2017-10-26v4No1 / 204
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 217
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 232
671amnon high in state of california compared to state of oregon in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 355
486amnoncommon ocean, sediment, pacific ocean, state of oregon, carbonate, lithified carbonate blocks, hydrate ridge, low activity methane seep, depth (water) 500-1000m2019-02-19v4No1 / 371
671amnon high in state of oregon compared to state of california in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 534
486amnon high in oil seep active methane seep compared to low activity methane seep in ocean sediment pacific ocean state of oregon carbonate lithified carbonate blocks hydrate ridge depth (water) 500-1000m 2019-02-19v4No1 / 649
486amnon high in low activity methane seep compared to oil seep active methane seep in ocean sediment pacific ocean state of oregon carbonate lithified carbonate blocks hydrate ridge depth (water) 500-1000m 2019-02-19v4No1 / 1791

Problems / suggestions? Please email info AT dbbact DOT org