Summary for ontology term: stem

Number of annotations with term: 33

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Rhizobiaceae;g__ShinellaTACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGGTATTTAAGTCAGGGGTGAAATCCCGGAGCTCAACTCCGGAACTGCCTTTGATACTGGGTACCTAGAGTATGGAAGAGGTAAGTGGAATTCCGAG0.021978
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__SphingomonadaceaeTACGGAGGGAGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCTATTCAAGTCAGAGGTGAAAGCCCGGAGCTCAACTTCGGAACTGCCTTTGAAACTAGATAGCTAGAATCCTGGAGAGGTGAGTGGAATTCCGAG0.021978
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__Acetobacteraceae;g__AcidisomaTACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGCGGCCAAAGTCAGGCGTGAAATTCCTGGGCTCAACCTGGGGGCTGCGCTTGATACTTGGTTGCTTGAGTGGGGAAGAGGGTCGTGGAATTCCCAG0.021978
d__BacteriaTACGTGAAAGACTAGTGTTATTCATCTTTAATCGGTATAAAGGGTACCTAGATTGAATACCAAGCCATAAAAGGTACTAGTATTCTAGAGTTTTATGTGAGAATATACGAATTATCAGAGGAGAGTTCAAATTTTATTATACTGGTAGGA0.021978
TACGTAAGAGACTAGTGTTATTCATCTTAATTAGGTTTAAAGGGTACTTAGACGGTCAACACAACATGAAAATGTTAATATCAGACTAGAGTTTTATATAAGGGGACAGAACCTGAGGTGAAGAGATAAAATTCTGTCATACCAAGGGGA0.021978
TACGTAAGAGACTAGTGTTATTCATCTTAATTAGGTTTAAAGGGTCTTTAGACAGTCAAAATAGCTTGTAAAATGTAACTATTTGACTAGAGTTTAATGGAGGAAGGCAGAACTTATAGAGGAGAGATTAAATTCTGTGATACTATGGGG0.021978
TACGTAAGAGACTAGTGTTATTCATCACAATTAGGTTTAAAGGGTACCTAGACGGTCAAAATAGCATAAAAAATGTAACTACTTGACTAGAGTTTTATGTAAGAGGGCAGAATCTGCGGTGGAGAGATAAAATTTTATGATACCAAAGGG0.021978
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__ComamonadaceaeTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTAATGTAAGACAGAGGTGAAATCCCCGGGCTCAACCTGGGAACTGCCTTTGTGACTGCATTGCTGGAGTGCGGCAGAGGGGGATGGAATTCCGCG0.021978
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__Chitinophagaceae;g__TaibaiellaTACGGAGGGTGCAAGCGTTATCCGGATTTACTGGGTTTAAAGGGTGTGTAGGCGGGCTTTTAAGTCTGGGGTGAAATCCCGAAGCTCAACTTCGGAACTGCCTTGGATACTATTAGTCTTGAATTATGTTGAGGTTGGCGGAATATAACA0.021978
TTCCAGCTCCAATAGCGTATGTGTAAGTTGCTGCAGTTAAAAAGCTCGTAGTTGAACCTAAAGCGTGGCAGGCCGGTCCACTTTTTTGTGCGTACTTGGTTCTGCCTGCTTTATTGCCTGGACGTCTAGCTGCGTTTAATCGCGTGGCTA0.021978

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCAAGCGTTAATCGGATTTACTGGGCGTAAAGCGCGCGTAGGTGGCCAATTAAGTCAAATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGTTGGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.300000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__MicrobacteriaceaeTACGTAGGGCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAATCCCGAGGCTCAACCTCGGGTCTGCAGTGGGTACGGGCAGACTAGAGTGCGGTAGGGGAGATTGGAATTCCTGG0.300000
d__BacteriaGACAAGGGAGACGAGTGTTATTCATCTTTAACAGGTATATAGGGTACCTAGACGGTGTACAAAGGCTTAGATAAGTACCTGTTACACTTGAGTTTGATATGTGAGAGGAATATGTCAGAATTATTGGTGGAAAGATGAAATTTGCTAATA0.300000
d__BacteriaGACAAGGGAGACGAGTGTTAGTCATCTTTAACAGGTATATAGGGTACCTAGACGGTGTGCGAAGGCTTAGAAAAGTACCTGCCACACTTGAGTTTGATATGGGAGAGGAAAATGTCAGAATTATTGGAGTACAGATGAAATCGGCTAATA0.300000
d__BacteriaGACAAGGGAGACGAGTGTTAATCATCTTTAACAGGTATATAGGGTACCTAGACGGTGTGCAAAGGCTTATTAAAGTACCTGCCACACTCGAGTTTGATATGTGAGAGGAAGATGTCAGAATTATTGGAGTACGGATGAAATCGGCTAATA0.300000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.200000
d__Bacteria;p__Firmicutes;c__Bacilli;o__BacillalesTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.200000
d__Bacteria;p__Firmicutes;c__Bacilli;o__BacillalesTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTCCTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGGGACTTGAGTGCAGAAGAGGAAAGCGGAATTCCACG0.200000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.200000
d__BacteriaCAAAGTTGTCCAACGTCTCCCCTTGCTTTTGCATGCTCTCTGTTCTTCACTAAACCTCACCGAACGTGCAGGAATCCCTGCCGGTAGCTATGCAAGTCAACCGCTATCTCCGTCCGGTCTCCGGCCCAGGTTGAAGCCCTAGGTGAGCCC0.200000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__RhizobialesTACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGGGTGCGCAGGCGGGTTCATAAGTCAGGGGTGAAATCCCGAGGCTCAACCTCGGAACTGCCTTTGATACTGTGGATCTTGAGTCCGGAAGAGGTGAGTGGAACTGCGAG0.189655
d__BacteriaGACGGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGTTTATTAAGTCTGCTGTTAAAGCACAGGGCTCAACCCTGTAGAGGCGGTAGAAACTGGTAGGCTTGAGTATGGTAGGGGTAGAGGGAATTCCCGA0.178862
TACGAGTAAGACTAGTGTTAGTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGTATTTAGACCACAGTAACATACTGTTCGGTACATTAATACTAGAGTTATAAGGAAAAGGTATATTTAGAGCTATCGGTGTAATTAAGAGATAGAA0.148148
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaTACGAAGGGGGCTAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGGCGAATAAGTCAGGGGTGAAATCCCAAGGCTCAACCTTGGAACTGCCTTTGATACTGTTTGTCTTGAGTTCGAGAGAGGTAAGTGGAACTGCGAG0.144144
d__BacteriaTACGGAGGGTGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGTGGCTTAAGTCTGATTTGAAAGCCGGCGGCTCAACCGTCGGATGTGGTTGGAAACTGGGTTACTTGAATGCGGGAGCGGTAGCTGGAACGGGTCA0.137255
d__Bacteria;p__Cyanobacteria/ChloroplastGACGGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGGTTGTGAAGTCTTCTGTTAAAGATCAGGGCTTAACCCTGTTTAGGCAGTGGAAACTCATAACCTAGAGTACGGTAGGGGCAGAGGGAATTCCCGG0.134454
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaTACGAAGGGGGCTAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGACTGATAAGTCAGGGGTGAAATCCCAAGGCTCAACCTTGGAACTGCCTTTGATACTGTTTGTCTTGAGTTCGAGAGAGGTAAGTGGAACTGCGAG0.126126
TACGAGTAAGACTAGTGTTAGTCATCTTCATTAGGTTTAAAGGGTACCTAGACGGTATTTAGACCACAGTATAACACTGTTAGGTACATTAATACTAGAGTTATAAGGAAAAGGTATATTTAGAGCTATCGGTGTAATTAAGAGATAGAA0.122449
d__BacteriaGACGGGGGGGGCAAGTGTTATTCGGAATGACTGGGCGTAAAGGGCACGTAGGCGGTGAAAAGGGTGGAAAGGAAAAGTCGCCAAAACACTGGCGGGGGGCTTTCTGTACCGTTTCACTTGAGTGAGATAGGGGAGAGTGGAATTTCGTGT0.122449
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Methylobacteriaceae;g__MethylobacteriumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGCCATTTAAGTCGGGGGTGAAAGCCTGTGGCTCAACCACAGAATTGCCTTCGATACTGGATGGCTTGAGTTCGGTAGAGGTTGGTGGAACTGCGAG0.121622

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
stem0.857143
stem endosphere0.666667
minas gerais state0.500000
campos rupestres0.500000
vellozia epidendroides0.500000
endosphere0.500000
xylella fastidiosa temecula10.500000
pierce disease0.500000
populus0.500000
populus trichocarpa x deltoides0.500000
LOWER IN populus deltoides0.500000
populus deltoides0.500000
LOWER IN populus trichocarpa x deltoides0.500000
barbacenia macrantha0.500000
grassland0.500000
kobresia humilis0.500000
steppe0.500000
tsuga canadensis0.500000
eastern hemlock0.500000
tsuga dumosa0.500000
himalayan hemlock0.500000
tsuga sieboldii0.500000
southern japanese hemlock0.500000
tsuga chinensis0.500000
chinese hemlock0.500000
stem surface0.500000
upper stem0.500000
exosphere0.500000
campinas0.500000
LOWER IN stem surface0.500000
LOWER IN upper stem0.500000
grape0.333333
vitis vinifera0.333333
saccharum0.333333
sugarcane0.333333
LOWER IN stem endosphere0.333333
LOWER IN stem0.285714
LOWER IN leaf endosphere0.250000
leaf endosphere0.250000
state of tennessee0.200000
mongolia0.200000
LOWER IN leaf surface0.200000
leaf surface0.200000
tibetan plateau0.166667
state of north carolina0.166667
greenhouse0.166667
leaf0.142857
cultivated environment0.125000
brazil0.105263
tree0.100000
LOWER IN leaf0.095238
state of california0.037037
plant0.022727
united states of america0.011583
china0.005405
LOWER IN control0.005263
Fraction of annotations for the query sequences containing the term
TermScore
stem0.909091
united states of america0.575758
brazil0.303030
state of tennessee0.242424
populus0.242424
tree0.242424
cultivated environment0.242424
plant0.242424
state of north carolina0.242424
leaf0.212121
saccharum0.181818
sugarcane0.181818
campinas0.181818
greenhouse0.181818
endosphere0.151515
minas gerais state0.121212
campos rupestres0.121212
grassland0.121212
china0.121212
upper stem0.121212
exosphere0.121212
state of california0.090909
grape0.090909
vitis vinifera0.090909
populus trichocarpa x deltoides0.090909
populus deltoides0.090909
stem endosphere0.090909
LOWER IN stem0.090909
LOWER IN leaf0.090909
stem surface0.090909
vellozia epidendroides0.060606
barbacenia macrantha0.060606
tibetan plateau0.060606
kobresia humilis0.060606
steppe0.060606
mongolia0.060606
tsuga canadensis0.060606
eastern hemlock0.060606
tsuga dumosa0.060606
himalayan hemlock0.060606
tsuga sieboldii0.060606
southern japanese hemlock0.060606
tsuga chinensis0.060606
chinese hemlock0.060606
LOWER IN upper stem0.060606
xylella fastidiosa temecula10.030303
pierce disease0.030303
LOWER IN control0.030303
LOWER IN populus deltoides0.030303
LOWER IN populus trichocarpa x deltoides0.030303
LOWER IN leaf surface0.030303
LOWER IN stem surface0.030303
leaf surface0.030303
LOWER IN leaf endosphere0.030303
LOWER IN stem endosphere0.030303
leaf endosphere0.030303
Exp. ID User ID Description Date Region Flag Sequences
462amnondominant united states of america, state of tennessee, populus, tree, stem, populus deltoides, cultivated environment2019-01-13v4No1 / 3
189amnondominant united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 5
279amnondominant grassland, tibetan plateau, leaf, stem, kobresia humilis, china2018-01-24v4No1 / 6
462amnondominant united states of america, state of tennessee, populus, tree, populus trichocarpa x deltoides, stem, cultivated environment2019-01-13v4No1 / 12
279amnondominant grassland, leaf, stem, steppe, mongolia, china2018-01-24v4No1 / 12
548amnondominant minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 15
432amnondominant united states of america, plant, state of north carolina, stem, tsuga dumosa, himalayan hemlock2018-12-19v4No1 / 15
432amnondominant united states of america, plant, state of north carolina, stem, tsuga chinensis, chinese hemlock2018-12-19v4No1 / 17
615amnondominant stem surface, upper stem, stem, exosphere, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 18
548amnondominant minas gerais state, campos rupestres, brazil, vellozia epidendroides, stem2019-08-17v4No1 / 21
432amnondominant united states of america, plant, state of north carolina, stem, tsuga canadensis, eastern hemlock2018-12-19v4No1 / 23
432amnondominant united states of america, plant, state of north carolina, stem, tsuga sieboldii, southern japanese hemlock2018-12-19v4No1 / 23
462amnoncommon united states of america, state of tennessee, populus, tree, stem, populus deltoides, cultivated environment2019-01-13v4No1 / 29
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america state of california grape vitis vinifera stem endosphere )2017-08-30v4No1 / 31
189amnoncommon united states of america, state of california, grape, vitis vinifera, stem, endosphere2017-08-30v4No1 / 43
462amnoncommon united states of america, state of tennessee, populus, tree, populus trichocarpa x deltoides, stem, cultivated environment2019-01-13v4No1 / 48
279amnoncommon grassland, leaf, stem, steppe, mongolia, china2018-01-24v4No1 / 83
279amnoncommon grassland, tibetan plateau, leaf, stem, kobresia humilis, china2018-01-24v4No1 / 104
615amnon high in leaf endosphere leaf compared to upper stem stem endosphere stem in endosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 118
548amnoncommon minas gerais state, campos rupestres, brazil, barbacenia macrantha, stem, stem endosphere2019-08-17v4No1 / 123
615amnoncommon stem surface, upper stem, stem, exosphere, saccharum, sugarcane, campinas, brazil, greenhouse2020-04-27v4No1 / 129
615amnon high in stem surface upper stem stem compared to leaf surface leaf in exosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 143
615amnon high in stem endosphere upper stem stem compared to leaf endosphere leaf in endosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 153
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree stem cultivated environment 2019-01-13v4No1 / 166
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga sieboldii, southern japanese hemlock2018-12-19v4No1 / 183
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree stem cultivated environment 2019-01-13v4No1 / 249
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga canadensis, eastern hemlock2018-12-19v4No1 / 251
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga chinensis, chinese hemlock2018-12-19v4No1 / 260
432amnoncommon united states of america, plant, state of north carolina, stem, tsuga dumosa, himalayan hemlock2018-12-19v4No1 / 309
615amnon high in leaf surface leaf compared to stem surface upper stem stem in exosphere saccharum sugarcane campinas brazil greenhouse 2020-04-27v4No1 / 321
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, stem2019-08-17v4No1 / 431
462amnon high in stem compared to leaf in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 477
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890

Problems / suggestions? Please email info AT dbbact DOT org