Summary for ontology term: stem endosphere

Number of annotations with term: 4

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.250000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Caulobacterales;f__Caulobacteraceae;g__CaulobacterTACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGAGCGTAGGCGGACTGTTAAGTTAGAGGTGAAAGCCCAGGGCTCAACCTTGGAATTGCCTTTGATACTGGCAGTCTTGAGTACGGAAGAGGTATGTGGAACTCCGAG0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.250000
d__BacteriaTACGTAGAAGACTAGTGTTAGTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGTAAATTAAACTCTAAATGAGTACTTTTTTACTAGAGTTTTATGTGAGAAGGAAGAATTTCTGGAGTAGGGATGAAATACTTTGATACCAGAAGGA0.250000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTATTAAGTCTGGTGTAAAAGGCAGTGGCTCAACCATTGTATGCATTGGAAACTGGTAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGT0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTATGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.250000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Burkholderiaceae;g__CupriavidusTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGACAGGCGTGAAATCCCCGGGCTTAACCTGGGAATTGCGCTTGTGACTGCAAGGCTAGAGTGCGTCAGAGGGGGGTAGAATTCCACG0.250000
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp1;g__TerriglobusTACGAGGGGGGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCGCGTAGGCGGTTTGGCAAGTTTGGTGTGAAATCTTCGGGCTCAACTCGAAGTCTGCACCGAAAACTGCCGGGCTTGAGTATGGGAGAGGTGAGTGGAATTTCCGG0.250000
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__Cytophagales;f__Cytophagaceae;g__DyadobacterTACGGAGGGTGCGAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGCCTGTTAAGTCAGTGGTGAAATACGGTTGCTCAACAATCGAGGTGCCATTGATACTGACCGGCTTGAAATAATTGGAGGCTGCCGGAATGGATGG0.250000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTCTTAAGTCGGATGTGAAATCCCTGAGCTTAACTTAGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.500000
d__BacteriaTACGTAAGAGACTAGTGTTATTCATCTTAATTAGGTTTAAAGGGTACCTAGACGGTCAATATAGCTTCTAGAATGTTAGTACTTGACTAGAGTTTTATGTAAGAGGGCAGTACTTGAGGAGGAGAGATGAAATTCTATGATACCAAAGGG0.500000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCAAGCGTTAATCGGATTTACTGGGCGTAAAGCGCGCGTAGGTGGCCAATTAAGTCAAATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGTTGGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.500000
d__BacteriaTTCCAGCTCCAATAGCGTATATTAAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGAAGTTTGGTCTCGGACGCTGGGTCTGCTTAATTGCATGTACTTGACGGTCCGAGACTTCCTTCTTGGTGAACGGCCGCCTTCGGGTGGTCCGGAAC0.500000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Oxalobacteraceae;g__HerbaspirillumTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTGTGTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAATTGCATTTGAGACTGCACGGCTAGAGTGTGTCAGAGGGGGGGAGAATTCCACG0.500000
d__BacteriaCAAAGTTGTCCAACGTCTCCCCTTGCTTTTGCATGCTCTCTGTTCTTCACTAAACCTCACCGAACGTGCAGGAATCCCTGCCGGTAGCTATGCAAGTCAACCGCTATCTCCGTCCGGTCTCCGGCCCAGGTTGAAGCCCTAGGTGAGCCC0.500000
TACAAGTGACTAGAAACTCGATGTGTCTCTTTCGGAAATATGAGATAAGGACCGGGACTTTTATTCTCGTAGCGGGGAGGAAGAAGGCTAGCCAAAGAACTCATGAGACGGAGTAGTGAAGGGACAGTAGCTGACAAGATTAAAGCCAAC0.500000
d__BacteriaGACGAGGGGGGCAAGTGTTGAAAGTGAAAGTCACCAAAAAGTAGGCGGTGAATCGGGTTGAAAGTGAAAGTCACCAAAAAGTGGCGGAATGCTCTCGAAACCAATTCACTTGAGTGAGACAGAGGAGAGTGGAATTTCATGTGTAGGGGG0.500000
d__BacteriaGACGGGGGGGGCAAGTGTTCTTCGGAATGACTGGGCGTAAAGGGCACGTAGGCGGTGAATCGGGTTGAAAGTGAAAGTCGCCAAAAAGTGGCGGAATGCTCTCGAAACCAATTCACTTGAGTGAGACAGAGGAGAGGGGAATTTCGTGTG0.500000
d__BacteriaTACGGAAGGTGCAAGCGTTATCCGGTTTTATTGGGTTTAAAGGGTGCGTAGGCGGCTTATTAAGTCAGTTGTGAAATCCTAGTGCTTAACGCTAGAACTGCGATTGATACTATTAGGCTTGAGTTAAGAAGAGGTAGGCAGAATTTATGG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTACGTAGAAGACTAGTGTTAGTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGTAAATAACACTTTAATAGAGTACTTATTTACTAGAGTTTTATAAGAGAAGGAAGAACTTCTGGAGTAGTGATAAAATACTTTGATACCAGAGGGA0.500000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__AcetobacteraceaeTACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGTTTATACAGTCAGATGTGAAATTCCTGGGCTCAACCTGGGGACTGCATTTGATACGTATGAACTTGAGTGGAGAAGAGGGTCGTGGAATTTCCAG0.400000
d__BacteriaTACGTAGAAGACTAGTGTTACTCATCTTTAATCGGTTTAAAGGGTACCTAGACAGAAAATCAAGCCTTAGAAACAAAAAAGGTACTAATTTTCTAGAGTTTTATGGAAGAATGTCGAATTACTAGAAGAGAGATAAAATTCATTGATACT0.363636
d__BacteriaTACGTAGAAGACTAGTGTTATTCATCTTTAATCGGTATAAAGGGTACCTAGACAGAATACCAAGCCATAATAGGTACTAGTATTCTAGAGTTTTATGTGAGAATATACGAATTACCAGAGTAGAGTCCAAATTCTGTTATACTGGTAGGA0.333333
d__BacteriaCGCGTGGGAGGAGCAGCGGCACGCGGCGCCGGCTCACTCGTCGGAGTCGTCGTACTGATCCATCATCATAATATGTTCCCACCAAAATAGTGAGAAAGACAAAGGTGACAAGGGTCTTTTTGAAAAGTTGGCATGGACACACCGTCCAAC0.333333
d__BacteriaTGTATTCCGCCTCGGCGGTGGACAAAGCCACACTATTTTGCTTCTTAGATGACCAAGATACTAAGGACCTCCCAAGCAAATGGCATCCTCCGGATGTGCTTTTTCTATTAATTTTGCAACCGGCATAATCCGAATCGGAATAGCCAACTA0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Mycobacteriaceae;g__MycobacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTTGTTCGTGAAAACTCACGGCTTAACTGTGAGCGTGCGGGCGATACGGGCAGACTAGAGTACTGCAGGGGAGACTGGAATTCCTGG0.333333
d__BacteriaTACGTAAAAGACTAGTGTTATTCATCTTTAATAGGTGTAAAGGGTACCTAGACTGAAAATTAAGCCATATTGAGAACTAGTTTTCTAGAGTTTTATGTAGGAATATACGAATTACCAGAGAAGAGTTCACATTCTATAATACTGGTAGGA0.333333
d__Bacteria;p__"Proteobacteria"TACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGATGGTTGCGTAAGTCAGATGTGAAAGCCCCGGGCTCAACCTGGGAATTGCATTTGAGACTGCGTAGCTAGGGTGCGGTAGAGGGAAGCGGAATTTCCGG0.333333
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__RhodospirillalesTACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGCGCAGTAAGTTGGGCGTGAAAGCCCCGGGCTCAACCTGGGAATTGCGCTTGATACTGCTGTGCTAGAGTTCGGGAGAGGTGAGTGGAATTCCCAG0.333333

Annotations:

common ontology terms
term enrichment score
TermScore
stem endosphere0.705882
campinas0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
stem0.413793
saccharum0.400000
sugarcane0.400000
LOWER IN upper stem0.333333
endosphere0.333333
upper stem0.333333
LOWER IN stem endosphere0.285714
leaf endosphere0.250000
greenhouse0.250000
LOWER IN leaf endosphere0.250000
brazil0.190476
LOWER IN stem0.181818
leaf0.080000
LOWER IN leaf0.080000
Fraction of dbbact annotations with this term covered by the query
TermScore
stem endosphere0.666667
LOWER IN upper stem0.500000
campinas0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
upper stem0.500000
LOWER IN stem endosphere0.333333
saccharum0.333333
sugarcane0.333333
stem0.285714
leaf endosphere0.250000
endosphere0.250000
LOWER IN leaf endosphere0.250000
greenhouse0.166667
LOWER IN stem0.142857
brazil0.105263
leaf0.047619
LOWER IN leaf0.047619
Fraction of annotations for the query sequences containing the term
TermScore
brazil1.000000
stem0.750000
stem endosphere0.750000
endosphere0.500000
saccharum0.500000
sugarcane0.500000
campinas0.500000
greenhouse0.500000
minas gerais state0.500000
campos rupestres0.500000
barbacenia macrantha0.500000
LOWER IN upper stem0.250000
LOWER IN stem endosphere0.250000
LOWER IN stem0.250000
leaf endosphere0.250000
leaf0.250000
LOWER IN leaf endosphere0.250000
LOWER IN leaf0.250000
upper stem0.250000

Problems / suggestions? Please email info AT dbbact DOT org