Summary for ontology term: stratovolcano

Number of annotations with term: 4

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
TTCCAGCTCCAATAGCGTATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCGGGTGGGTTGCAATGGTCCGGTTCGCTGTGTACTGTTGCGGCCTTCCTTTCTGCCGGGGACGGGCTCTTGGGCTTCATTGTCTGGGATCC0.727273
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__ChitinophagaceaeTACGGAGGGTGCAAGCGTTATCCGGATTTACTGGGTTTAAAGGGTGCGTAGGTGGGTAGGAAAGTCAGTGGTGAAATCTTCAAGCTTAACTTGGAAACTGCCATTGATACTTTTTATCTTGAATATCCCGGAGGTAAGCGGAATATGTCA0.666667
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__AcetobacteraceaeTACGAAGGGGGCTAGCGTTGCTCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGCTTACTAAGTTAGGTGTGAAATTCCTGGGCTTAACCTGGGGACTGCCCTTAATACAGGTAGGCTAGAGTGAGGAAGAGGGTTGTGGAATTCCCAG0.666667
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__Cytophagales;f__Cytophagaceae;g__HymenobacterTACGGAGGGTGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTTTTTAAGTCCGGGGTGAAAGCCCGTTGCTCAACAACGGAACTGCCCCGGAAACTGGAGAGCTTGAGTACAGACGAGGGCGGCGGAATGGACGG0.666667
TTCCAGCTCCAATAGCGTATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCGGGTGGGTTGCAATGGTCCGGTTCGCTGTGTACTGTTGCGGCCTTCCTTTCTGCCGGGGACGGGCTCTTGGGCTTCACTGTCTGGGATCC0.666667
d__BacteriaTTCCAGCTCCAATAGCGTATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCGGGTGGGTTGTAGTGGTCCGGTTCGCTGTGTACTGCTACGGCCTTCCTTTCTGCCGGGGACGGGCTCTTGGGCTTCATTGTCTGGGATCC0.666667
d__BacteriaTTCCAGCTCCAATAGCGTATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCGGGTGGGTGACCGCGGTCCGCCTCTGGTGTGCACTGCGGGCGCCTATCTTTCTGCCGGGGACGGGCTCCTGGGCTTCACTGTCTGGGACT0.666667
TTCCAGCTCCAATAGCGTATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCGGATGGGTATCAATGGTCCGGTTCGCTGTGTACTGTTGCTGCCTATCTTTCTGCCGGAAATGGGATCTTAGGCTTTACTGTCTGAGACCT0.666667
TTCCAGCTCCAATAGCGTATATTTAAGTTGTTGCAGTTAAAAAGCTCGTAGTTGGATTTCGGATGGGTAGCAATGGTCCGGTTCGCTGTGTACTGTTGCTGCCTATCTTTCTGCCGGAAATGGGATCTTAGGCTTTACTGTCTGAGACCT0.666667
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTCAGTAAGTCAGTGGTGAAAGGTACCCGCTTAACGGGGACACTGCCATTGATACTGTTGAGCTGGAGTACAGATGAAGTGGGCGGAATGTGTCA0.666667

Annotations:

common ontology terms
term enrichment score
TermScore
stratovolcano0.666667
snow field0.400000
glacier0.333333
snow0.333333
state of oregon0.285714
sediment0.058824
united states of america0.008065
Fraction of dbbact annotations with this term covered by the query
TermScore
stratovolcano0.500000
snow field0.250000
snow0.250000
glacier0.200000
state of oregon0.166667
sediment0.031250
united states of america0.004049
Fraction of annotations for the query sequences containing the term
TermScore
united states of america1.000000
glacier1.000000
snow field1.000000
stratovolcano1.000000
state of oregon1.000000
snow0.500000
sediment0.500000

Problems / suggestions? Please email info AT dbbact DOT org