Summary for ontology term: stroke

Number of annotations with term: 4

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCGTACTAAGTCTGTAGTAAAAGGCAATGGCTCAACCATTGTAAGCTATGGAAACTGGTATGCTGGAGTGC0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGATTGGCAAGTTGGGAGTGAAATCTATGGGCTCAACCCATAAATTGCTTTCAAAACTGTCAGTCTTGAGTG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__IntestinibacterTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTTAAGTCAGGAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTCTTGAAACTGGAGGACTTGAGTGC0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__HungatellaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTTAAGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGTACTGCTTTGGAAACTGTTTGACTTGAGTG0.250000
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfovibrionales;f__Desulfovibrionaceae;g__BilophilaTACGGAGGGTGCAAGCGTTAATCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGCTTGGTAAGTCAGGGGTGAAATCCCACAGCCCAACTGTGGAACTGCCTTTGATACTGCCAGGCTTGAGTA0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FlavonifractorTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGATTGCAAGTCAGATGTGAAAACTGGGGGCTCAACCTCCAGCCTGCATTTGAAACTGTAGTTCTTGAGTG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTG0.250000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegasphaeraTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGCAGGCGGCGTCGTAAGTCGGTCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGACCGAAACTGCGATGCTAGAGTAT0.250000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ButyricimonasTACGGGGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGCGCGTAGGCGGGACGTCAAGTCAGCGGTAAAAGACTGCAGCTAAACTGTAGCACGCCGTTGAAACTGGCGCCCTGGAGACG0.250000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__AnaerotruncusTACGTAGGGAGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGATGGCAAGTAGAATGTTAAATCCATCGGCTCAACCGGTGGCTGCGTTCTAAACTGCCGTTCTTGAGTGA0.250000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAAGACAGGTCAGATGTGAAATGTCGGGGCTCAACCCCGGAACTGCATTTGAAACCGTTTTTCTTGAGTA0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGACGCAAGTCTGAAGTGAAATACCCGGGCTCAACCCGGGAACTGCTTTGGAAACTGTGTTGCTAGAGTG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGTGTAGGCGGGACGGCAAGTCAGATGTGAAATTTAGGGGCTCAACCCCTGACCTGCATTTGAAACTGCTGTTCTTGAGTG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCACAGCAAGTCTGATGTGAAAGCCCGGGGCCCAACCCCGGAACTGCATTGGAAACTGTTGGGCTTGAGTG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTCAGACAAGTCAGAAGTGAAAGCCCGGGGCTCAACTCCGGGACTGCTTTTGAAACTGCCTGACTAGATTG0.500000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Caulobacterales;f__CaulobacteraceaeTACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGACAGTTAAGTTGGGGGTGAAAGCCCGGGGCTCAACCTCGGAAATGCCTTCAATACTGGCTGTCTTGAGTA0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCAGTCTTGAGTA0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTTTTAAGTCAGCGGTGAAAGTCTGTGGCTCAACCATAGAATTGCCGTTGAAACTGGGGGGCTTGAGTT0.500000
d__BacteriaTACGTAAAAGACTAGTGTTAGTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGTAAATTAAACTTTAAAAGAGTATTTTTTTACTAGAGTTTTATAAAAGAAGGAAGAATTTCTGGAGTAGTG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVbTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGCATGGTAAGCCAGATGTGAAAGCCCGAAGCTTAACTTCGAGGATTGCATTTGGAACTATCAAGCTAGAGT0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Rikenellaceae";g__AlistipesTACGGAGGATTCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATCCCGGGGCTTAACTCCGGAACTGCCTCTAATACTGTTAGACTAGAGAG0.666667
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCGTACTAAGTCTGTAGTAAAAGGCAATGGCTCAACCATTGTAAGCTATGGAAACTGGTATGCTGGAGTGC0.571429
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__IntestinibacterTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTTAAGTCAGGAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTCTTGAAACTGGAGGACTTGAGTGC0.571429
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegasphaeraTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGCAGGCGGCGTCGTAAGTCGGTCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGACCGAAACTGCGATGCTAGAGTAT0.571429
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGATTGGCAAGTTGGGAGTGAAATCTATGGGCTCAACCCATAAATTGCTTTCAAAACTGTCAGTCTTGAGTG0.500000
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfovibrionales;f__Desulfovibrionaceae;g__BilophilaTACGGAGGGTGCAAGCGTTAATCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGCTTGGTAAGTCAGGGGTGAAATCCCACAGCCCAACTGTGGAACTGCCTTTGATACTGCCAGGCTTGAGTA0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FlavonifractorTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGATTGCAAGTCAGATGTGAAAACTGGGGGCTCAACCTCCAGCCTGCATTTGAAACTGTAGTTCTTGAGTG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACAGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCTGTCTTGAGTA0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGAAGGCTAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGGTCATCTAGAGTG0.500000

Annotations:

common ontology terms
term enrichment score
TermScore
stroke0.600000
guangzhou city prefecture0.333333
LOWER IN stroke0.333333
china0.011561
adult0.011494
control0.010582
LOWER IN control0.010582
homo sapiens0.007353
feces0.006349
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN stroke0.500000
stroke0.500000
guangzhou city prefecture0.200000
china0.005814
adult0.005780
control0.005405
LOWER IN control0.005405
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
adult1.000000
guangzhou city prefecture1.000000
china1.000000
stroke0.750000
control0.250000
LOWER IN stroke0.250000
LOWER IN control0.250000

Problems / suggestions? Please email info AT dbbact DOT org