Summary for ontology term: subgingival plaque

Number of annotations with term: 97

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Synergistetes";c__Synergistia;o__Synergistales;f__Synergistaceae;g__FretibacteriumTACGTAGGGGGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCACGCAGGCTGTGATTCAAGTCAGCTGTAAAAGGATGCGGCTTAACCGTGTTTAGCAGTTGAAACTGGATGACTGGAGTGCTGGAGAGGCAAGTGGAATTCCCAGT0.032258
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCACGAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGTGGTTATGTAAGTCTGATGTGAAAATGCAGGGCTCAACTCTGTATTGCGTTGGAAACTGTGTAACTAGAGTACTGGAGAGGTAAGCGGAACTACAAGT0.032258
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGAGTACGTAGGCGGTTTGGCAAGCGTAAGGTTTAAGGCAACAGCTCAACTGTTGTTCGCCTTGTGAACTGTCAAACTTGAGTGCGGGAGAGGAAAGCGGAATTCCTGGT0.032258
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTGGGGGATATTGCACAATGGGGGGAACCCTGATGCAGCGACGCCGCGTGAGTGAAGAAGTATTTCGGTATGTAAAGCTCTATCAGCAGGGAAGATAATGACAGTACCTGAATAAGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.021505
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__FilifactorTACGTAGGGGGCAAGCGTTATCCGGAATAACTGGGCGTAAAGGGTGCGCAGGTGGTTTAACAAGTTAGTGGTGAAAGGCATAGGCTCAACCAATGTAAGCCATTAAAACTGTTTAACTTGAGTGCAGGAGAGGAAAGTGGAATTCCTAGT0.021505
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCACGTAAGGGGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGTATGTAGGCGGTTAGGTAAGCCTGGTGTGAAATCTACGAGCTCAACTCGTAAACTGCATTGGGTACTGCTTGACTTGAATCACGGAGGGGAAACCGGAATTCCAAG0.021505
d__Bacteria;p__"Proteobacteria";c__BetaproteobacteriaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTGTGTAAGTCAGAGGTGAAATCCCCGGGCTCAACCTGGGAACTGCCTTTGAGACTGTGCAACTAGAGGATGGCAGAGGGGGGTAGAATTCCACG0.021505
d__BacteriaTACGTAGGGTGCAAGCGTTATCCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGCCTGACAAGTCAGAAGTTTAATCCATTGGCTTAACCAATGTCAGCTTTTGAAACTGTTTGGCTTGAATACAGGAGGGGCAAGTGGAATTCCTAGT0.021505
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCACGAGCGTTATCCGGATTTATTGGGCGTAAAGTGCGTCTAGGTGGTTATGTAAGTCTGATGTGAAAATGCAGGGCTCAACTCTGTATTGCGTTGGAAACTGTGTAACTAGAGTACTGGAGAGGTAAGCGGAACTACAAGT0.021505
d__BacteriaCACGTAAGGGGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGTTGCGTAAGCCTGGTGTGAAATACTCAAGCTTAACTTGAGAACTGCATTGGGTACTGCGCAGCTTGAATTACGGAAGGGAAACTGGAATTCCAAG0.021505

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGATTTCGGTTCGTAAAGCTCTGTTGTTAGGGAAGAATGATTGTGTAGTAACTATACACAGTAGAGACGGTACCTAACCAGAAAGCCACGGC0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTGTTAGCAGGGAAGAAGAGAGATTGACGGTACCTGCAGAGAAAGCGCCGGCTAACTACGTGCCAGCAGCCG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__ParvimonasTACGTATGGGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTACGTAGGCGGCCTTTTAAGTCAGGTGTGAAAGCGTGAGGCTTAACCTCATTAAGCACTTGAAACTGGAAGGCTTGAGTGAAGGAGAGGAAAGTGGAATTCCTAGT0.333333
d__BacteriaTACGGAAGGGGCGAGCGTTGTTCGGAATCATTGGGCGTAAAGGGTGCGCAGGCGGTTTGGTAAGTCTGATGTAAAAGCCCGCAGCTTAACTGCGGAACTGCATTGGAAACTGCTGAGCTAGAGTAGATGAGGGGAAACTGGAATTTCTAG0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACCGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCTGG0.333333
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTCCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.333333
d__Bacteria;p__SR1;g__SR1_genera_incertae_sedisTACGTAGGTCTCAAGCGTTATCCGGATTTACTGGGCGTAAAGTGTCCGTAGTCTGATCTGTAAGTCTGTTTTCAAATCCTACGACTCAATCGTAGAAAGGGAGTGGATACTGCAGATCTAGAAGTATCTAGGGGTTAGTGGAATTTCCGG0.333333
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGCTAAATAAGTCTGATGTGAAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGTATAGCTAGAGTACTGGAGAGGTAAGCGGAACTACAAGT0.333333
d__BacteriaTACGAGGGCCCCAAGCGTTATCCGGAATTACTGGGCGTAAAGCGTCTGTAGGTGGTGTAGTAAGTTTCGTGTGAAACTCCGGGGCTCAACCCCGGATTGTGCGAAAAACTATTACACTTGAGTGTGGGAGAGGCTAGCAGAACGGTATGA0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__CatonellaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCCTTTCAAGTTGAGAGTGGAAGCTCGGGGCTCAACCCCGAGACTGCTCCCAAAACTGTTAGGCTTGAGTATGGGAGAGGCAAGCGGAATTCCTAG0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Synergistetes";c__Synergistia;o__Synergistales;f__Synergistaceae;g__FretibacteriumTACGTAGGGGGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCACGCAGGCTGTGATTCAAGTCAGCTGTAAAAGGATGCGGCTTAACCGTGTTTAGCAGTTGAAACTGGATGACTGGAGTGCTGGAGAGGCAAGTGGAATTCCCAGT0.367347
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCACGTAAGGGGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGTATGTAGGCGGTTAGGTAAGCCTGGTGTGAAATCTACGAGCTCAACTCGTAAACTGCATTGGGTACTGCTTGACTTGAATCACGGAGGGGAAACCGGAATTCCAAG0.327485
d__Bacteria;p__"Synergistetes";c__Synergistia;o__Synergistales;f__Synergistaceae;g__FretibacteriumTACGTAGGGGGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCACGCAGGCTGTGCTTCAAGTCAGCTGTAAAAGGATGCGGCTTAACCGTGTTATGCAGTTGAGACTGAGGTGCTGGAGTACCGGAGAGGCAAGTGGAATTCCCAGT0.315789
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__PorphyromonasTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTTGTTCGGTAAGTCAGCGGTGAAACCTGAGCGCTCAACGTTCAGCCTGCCGTTGAAACTGCCGGGCTTGAGTTCAGTGGCGGCAGGCGGAATTCGTGG0.315068
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTACGTATGTCACGAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGTGGTTATGTAAGTCTGATGTGAAAATGCAGGGCTCAACTCTGTATTGCGTTGGAAACTGTGTAACTAGAGTACTGGAGAGGTAAGCGGAACTACAAGT0.311111
d__Bacteria;p__"Synergistetes";c__Synergistia;o__Synergistales;f__Synergistaceae;g__FretibacteriumTACGTAGGGGGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGCACGCAGGCTGTGCTTCAAGTCAGCTGTAAAAGGATGCGGCTTAACCGTGTTATGCGGCTGAGACTGAGGTGCTGGAGTACCGGAGAGGCAAGTGGAATTCCCAGT0.303030
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__FilifactorTACGTAGGGGGCAAGCGTTATCCGGAATAACTGGGCGTAAAGGGTGCGCAGGTGGTTTAACAAGTTAGTGGTGAAAGGCATAGGCTCAACCAATGTAAGCCATTAAAACTGTTTAACTTGAGTGCAGGAGAGGAAAGTGGAATTCCTAGT0.294872
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCACGTAAGGTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGCAGGCGGGTCGCCAAGCTTGGTAAGAAATACCGGGGCTCAACTCCGGAGCTATATTGAGAACTGGCGAGCTAGAGTTGCCGAAGGGTATCCGGAATTCCGCG0.272109
d__Bacteria;p__"Spirochaetes";c__Spirochaetia;o__Spirochaetales;f__Spirochaetaceae;g__TreponemaCACGTAAGGTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGATAGGCAAGCTTGGTGTGAAATGTTACAGCTTAACTGTGAGACAGCATTGAGAACTGCAGATCTTGAATTACTGAAGGGTAACCAGAATTCCACG0.266667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__TannerellaTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGGCTGTTAAGTCCGCGGTGAAAGTTTGTCGCTTAACGATAAAATTGCCGTTGAAACTGGTAGTCTTGAGTATAGATGAAGTAGGCGGAATGCGTGG0.258503

Annotations:

common ontology terms
term enrichment score
TermScore
subgingival plaque1.059501
subgingival dental plaque0.696570
periodontitis0.589474
dentition0.424528
mouth0.307181
LOWER IN periodontitis0.209913
municipality of beijing0.165517
chronic periodontitis0.162896
puerto rico0.145985
brazil0.128514
adult organism0.126437
macaca mulatta0.119760
chile0.110092
age 4 years0.110092
state of new york0.107383
beagle dog0.104348
dog0.094862
municipality of shanghai0.094488
depth < 3mm0.093458
shallow pocket depth0.093458
age 12-23 years0.093458
homo sapiens0.091026
age 1-7 years0.089286
canis lupus familiaris0.088561
LOWER IN subgingival plaque0.086393
state of illinois0.082759
monkey0.080972
control0.080952
adult0.079744
state of california0.078049
periodontal disease0.076433
LOWER IN subgingival dental plaque0.076190
moscow0.076190
periodontal pocket0.076190
glasgow0.076190
city of dresden0.076190
LOWER IN control0.075581
germany0.071111
san diego0.070796
type 2 diabetes mellitus0.070796
female organism0.066298
deep pocket depth0.058252
depth > 3mm0.058252
oral lichen planus0.058252
gingival erosive oral lichen planus0.058252
acute pericementitis0.058252
russia0.056738
cigarette smoking0.056604
non-smoker0.055046
state of nebraska0.055046
united states of america0.049573
saliva0.041667
LOWER IN saliva0.041667
united kingdom0.041451
gingival groove0.040404
sea otter0.040404
enhydra lutris nereis0.040404
induced periodontitis0.039604
LOWER IN induced periodontitis0.039604
buffalo0.039604
postmenopausal0.039604
human adult stage0.037618
child0.034247
LOWER IN dentition0.033333
human late adulthood stage0.033058
south korea0.032000
wild0.026846
research facility0.022972
china0.020431
LOWER IN before therapy0.020408
non-surgical periodontal therapy0.020408
LOWER IN non-surgical periodontal therapy0.020408
before therapy0.020408
LOWER IN depth &gt; 3mm0.020202
LOWER IN deep pocket depth0.020202
LOWER IN shallow pocket depth0.020202
LOWER IN depth &lt; 3mm0.020202
LOWER IN age 12-23 years0.020202
LOWER IN oral lichen planus0.020202
LOWER IN gingival erosive oral lichen planus0.020202
LOWER IN acute pericementitis0.020202
natural tooth0.020202
LOWER IN implant0.020202
LOWER IN age 1-7 years0.020000
LOWER IN chronic periodontitis0.020000
LOWER IN cigarette smoking0.020000
LOWER IN non-smoker0.019802
systemic lupus erythematosus0.019802
LOWER IN systemic lupus erythematosus0.019802
LOWER IN buccal mucosa0.019608
buccal mucosa0.019608
LOWER IN supragingival dental plaque0.019048
supragingival dental plaque0.019048
LOWER IN mouth mucosa0.018692
mouth mucosa0.018692
LOWER IN supragingival plaque0.018519
supragingival plaque0.018519
female0.017467
LOWER IN child0.014706
LOWER IN adult0.007067
Fraction of dbbact annotations with this term covered by the query
TermScore
subgingival dental plaque1.500000
subgingival plaque1.200000
gingival groove1.000000
sea otter1.000000
enhydra lutris nereis1.000000
LOWER IN before therapy1.000000
non-surgical periodontal therapy1.000000
LOWER IN non-surgical periodontal therapy1.000000
before therapy1.000000
periodontitis0.923077
LOWER IN periodontitis0.692308
chronic periodontitis0.666667
chile0.500000
age 4 years0.500000
LOWER IN subgingival dental plaque0.500000
moscow0.500000
depth < 3mm0.500000
LOWER IN depth &gt; 3mm0.500000
LOWER IN deep pocket depth0.500000
shallow pocket depth0.500000
deep pocket depth0.500000
depth > 3mm0.500000
LOWER IN shallow pocket depth0.500000
LOWER IN depth &lt; 3mm0.500000
age 12-23 years0.500000
LOWER IN age 12-23 years0.500000
LOWER IN oral lichen planus0.500000
LOWER IN gingival erosive oral lichen planus0.500000
oral lichen planus0.500000
gingival erosive oral lichen planus0.500000
induced periodontitis0.500000
LOWER IN induced periodontitis0.500000
acute pericementitis0.500000
LOWER IN acute pericementitis0.500000
periodontal pocket0.500000
glasgow0.500000
natural tooth0.500000
LOWER IN implant0.500000
city of dresden0.500000
buffalo0.500000
postmenopausal0.500000
dentition0.391304
beagle dog0.333333
age 1-7 years0.333333
LOWER IN age 1-7 years0.333333
LOWER IN chronic periodontitis0.333333
cigarette smoking0.333333
LOWER IN cigarette smoking0.333333
mouth0.280000
LOWER IN subgingival plaque0.266667
municipality of beijing0.250000
puerto rico0.250000
LOWER IN non-smoker0.250000
non-smoker0.250000
san diego0.250000
state of nebraska0.250000
type 2 diabetes mellitus0.250000
systemic lupus erythematosus0.250000
LOWER IN systemic lupus erythematosus0.250000
LOWER IN buccal mucosa0.200000
municipality of shanghai0.200000
buccal mucosa0.200000
state of new york0.153846
adult organism0.142857
macaca mulatta0.142857
state of illinois0.125000
LOWER IN supragingival dental plaque0.125000
supragingival dental plaque0.125000
brazil0.105263
LOWER IN mouth mucosa0.100000
mouth mucosa0.100000
periodontal disease0.100000
LOWER IN supragingival plaque0.090909
supragingival plaque0.090909
russia0.090909
LOWER IN dentition0.086957
human late adulthood stage0.083333
dog0.076923
state of california0.074074
south korea0.071429
female organism0.071429
canis lupus familiaris0.068966
monkey0.066667
saliva0.063830
LOWER IN saliva0.063830
germany0.062500
LOWER IN control0.052632
control0.052632
homo sapiens0.048443
adult0.043011
united kingdom0.041667
wild0.038462
united states of america0.027027
human adult stage0.027027
child0.025641
LOWER IN child0.025641
female0.015152
research facility0.012346
china0.010811
LOWER IN adult0.005376
Fraction of annotations for the query sequences containing the term
TermScore
subgingival plaque0.948454
homo sapiens0.752577
adult0.546392
dentition0.463918
subgingival dental plaque0.453608
periodontitis0.432990
mouth0.340206
united states of america0.298969
china0.185567
control0.175258
research facility0.164948
brazil0.164948
LOWER IN control0.134021
dog0.123711
canis lupus familiaris0.123711
LOWER IN periodontitis0.123711
municipality of beijing0.123711
adult organism0.113402
monkey0.103093
macaca mulatta0.103093
puerto rico0.103093
chronic periodontitis0.092784
state of california0.082474
germany0.082474
state of new york0.082474
chile0.061856
age 4 years0.061856
female organism0.061856
beagle dog0.061856
state of illinois0.061856
municipality of shanghai0.061856
periodontal disease0.061856
human adult stage0.061856
LOWER IN subgingival plaque0.051546
depth < 3mm0.051546
shallow pocket depth0.051546
age 12-23 years0.051546
child0.051546
age 1-7 years0.051546
LOWER IN subgingival dental plaque0.041237
russia0.041237
moscow0.041237
san diego0.041237
periodontal pocket0.041237
united kingdom0.041237
glasgow0.041237
city of dresden0.041237
type 2 diabetes mellitus0.041237
saliva0.030928
LOWER IN saliva0.030928
deep pocket depth0.030928
depth > 3mm0.030928
oral lichen planus0.030928
gingival erosive oral lichen planus0.030928
acute pericementitis0.030928
cigarette smoking0.030928
non-smoker0.030928
state of nebraska0.030928
south korea0.020619
LOWER IN dentition0.020619
gingival groove0.020619
sea otter0.020619
enhydra lutris nereis0.020619
wild0.020619
induced periodontitis0.020619
LOWER IN induced periodontitis0.020619
buffalo0.020619
postmenopausal0.020619
human late adulthood stage0.020619
female0.020619
LOWER IN supragingival plaque0.010309
LOWER IN supragingival dental plaque0.010309
supragingival plaque0.010309
supragingival dental plaque0.010309
LOWER IN depth &gt; 3mm0.010309
LOWER IN deep pocket depth0.010309
LOWER IN shallow pocket depth0.010309
LOWER IN depth &lt; 3mm0.010309
LOWER IN buccal mucosa0.010309
LOWER IN mouth mucosa0.010309
LOWER IN adult0.010309
LOWER IN age 12-23 years0.010309
LOWER IN child0.010309
LOWER IN age 1-7 years0.010309
LOWER IN oral lichen planus0.010309
LOWER IN gingival erosive oral lichen planus0.010309
mouth mucosa0.010309
buccal mucosa0.010309
LOWER IN acute pericementitis0.010309
LOWER IN chronic periodontitis0.010309
LOWER IN non-smoker0.010309
LOWER IN cigarette smoking0.010309
LOWER IN before therapy0.010309
non-surgical periodontal therapy0.010309
LOWER IN non-surgical periodontal therapy0.010309
before therapy0.010309
natural tooth0.010309
LOWER IN implant0.010309
systemic lupus erythematosus0.010309
LOWER IN systemic lupus erythematosus0.010309
Exp. ID User ID Description Date Region Flag Sequences
104amnon high in control compared to periodontitis in homo sapiens russia moscow subgingival plaque dentition mouth 2017-04-05v4No1 / 3
725amnon high in control compared to periodontitis acute pericementitis in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 3
260amnonhigher in natiral tooth compared to dental implant ( high in natural tooth compared to implant in homo sapiens dentition subgingival plaque united states of america state of nebraska mouth )2017-12-05v4No1 / 4
104amnon high in periodontitis compared to control in homo sapiens russia moscow subgingival plaque dentition mouth 2017-04-05v4No1 / 5
836amnon high in oral lichen planus gingival erosive oral lichen planus compared to control in homo sapiens subgingival dental plaque subgingival plaque china adult municipality of shanghai periodontitis chronic periodontitis 2021-09-11v3No1 / 5
96amnon high in control compared to systemic lupus erythematosus in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 5
725amnon high in control compared to periodontitis chronic periodontitis in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 6
703amnon high in dentition subgingival plaque subgingival dental plaque compared to saliva in city of dresden germany type 2 diabetes mellitus adult homo sapiens 2028-04-02v3No1 / 6
378amnon high in periodontitis compared to control in homo sapiens brazil subgingival plaque dentition adult mouth 2018-09-14v4No1 / 7
930amnon high in non-smoker compared to cigarette smoking in periodontal disease periodontitis human adult stage subgingival dental plaque subgingival plaque state of new york adult united states of america homo sapiens 2022-08-25v3No1 / 7
998amnon high in non-surgical periodontal therapy compared to before therapy in periodontitis united kingdom glasgow adult subgingival plaque subgingival dental plaque homo sapiens 2022-12-30v3No1 / 9
378amnon high in control compared to periodontitis in homo sapiens brazil subgingival plaque dentition adult mouth 2018-09-14v4No1 / 10
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 11
96amnon high in systemic lupus erythematosus compared to control in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 11
930amnon high in cigarette smoking compared to non-smoker in periodontal disease periodontitis human adult stage subgingival dental plaque subgingival plaque state of new york adult united states of america homo sapiens 2022-08-25v3No1 / 13
930amnondominant human adult stage, cigarette smoking, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 13
106amnon high in control compared to periodontitis in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v4No1 / 14
725amnondominant acute pericementitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 14
930amnondominant human adult stage, non-smoker, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 14
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 15
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in subgingival plaque dentition monkey macaca mulatta research facility puerto rico child age 1-7 years )2019-08-01v4No1 / 15
106amnondominant homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 16
725amnondominant chronic periodontitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 16
162amnon high in control compared to periodontitis in homo sapiens united states of america san diego dentition subgingival plaque periodontal pocket mouth 2017-07-13v4No1 / 16
984amnondominant wild, state of california, united states of america, enhydra lutris nereis, sea otter, subgingival dental plaque, subgingival plaque, gingival groove2022-12-26v4No1 / 17
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico child age 1-7 years )2019-08-01v4No1 / 17
272amnonhigh freq. in subgingival plaque in south korea (dominant homo sapiens, subgingival plaque, dentition, mouth, south korea)2018-01-10v4No1 / 18
874amnondominant human late adulthood stage, buffalo, postmenopausal, subgingival dental plaque, subgingival plaque, state of new york, female, united states of america, homo sapiens2022-03-04v3No1 / 18
955amnondominant chile, dog, canis lupus familiaris, subgingival dental plaque, subgingival plaque, adult organism, periodontitis, periodontitis2022-12-17v4No1 / 19
542amnondominant subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, age 12-23 years, adult2019-08-01v4No1 / 19
542amnondominant subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, child, age 1-7 years2019-08-01v4No1 / 19
836amnondominant homo sapiens, subgingival dental plaque, subgingival plaque, china, adult, municipality of shanghai, periodontitis, chronic periodontitis, gingival erosive oral lichen planus, oral lichen planus2021-09-11v3No1 / 19
725amnondominant control, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 19
826amnondominant age 4 years, subgingival dental plaque, adult organism, female organism, dog, subgingival plaque, beagle dog, state of illinois, canis lupus familiaris, dentition, research facility, united states of america2021-08-22v4No1 / 20
836amnondominant homo sapiens, subgingival dental plaque, subgingival plaque, china, adult, municipality of shanghai, periodontitis, chronic periodontitis2021-09-11v3No1 / 20
162amnonhigh freq. in periodontal pocket in humans (dominant homo sapiens, united states of america, san diego, dentition, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 20
998amnondominant homo sapiens, subgingival dental plaque, subgingival plaque, adult, glasgow, united kingdom, periodontitis2022-12-30v3No1 / 20
278amnondominant homo sapiens, united states of america, state of california, adult, subgingival plaque2018-01-23v4No1 / 21
106amnon high in periodontitis compared to control in homo sapiens dentition germany subgingival plaque mouth 2017-04-05v4No1 / 21
703amnondominant dentition, subgingival plaque, subgingival dental plaque, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v3No1 / 21
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 22
96amnondominant homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 22
542amnon high in child age 1-7 years compared to adult age 12-23 years in subgingival plaque dentition monkey macaca mulatta research facility puerto rico 2019-08-01v4No1 / 23
378amnondominant homo sapiens, brazil, subgingival plaque, dentition, adult, depth > 3mm, deep pocket depth, periodontitis, mouth2018-09-14v4No1 / 24
260amnondominant homo sapiens, dentition, subgingival plaque, united states of america, state of nebraska, mouth2017-12-05v4No1 / 24
96amnon high in control compared to periodontitis in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 24
955amnondominant subgingival dental plaque, subgingival plaque, chile, dog, canis lupus familiaris2022-12-17v4No1 / 26
104amnondominant homo sapiens, russia, moscow, subgingival plaque, dentition, mouth2017-04-05v4No1 / 27
378amnon high in depth < 3mm shallow pocket depth compared to depth > 3mm deep pocket depth in homo sapiens brazil subgingival plaque dentition adult periodontitis mouth 2018-09-13v4No1 / 28
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 33
955amnon high in control compared to periodontitis periodontitis in chile dog canis lupus familiaris subgingival dental plaque subgingival plaque adult organism 2022-12-17v4No1 / 35
836amnon high in control compared to oral lichen planus gingival erosive oral lichen planus in chronic periodontitis periodontitis municipality of shanghai adult china subgingival plaque subgingival dental plaque homo sapiens 2021-09-11v3No1 / 39
378amnon high in deep pocket depth depth > 3mm compared to shallow pocket depth depth < 3mm in homo sapiens brazil subgingival plaque dentition adult periodontitis mouth 2018-09-13v4No1 / 40
542amnoncommon subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, child, age 1-7 years2019-08-01v4No1 / 41
725amnon high in periodontitis acute pericementitis compared to control in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 43
725amnon high in periodontitis chronic periodontitis compared to control in subgingival plaque subgingival dental plaque adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 44
703amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in city of dresden germany type 2 diabetes mellitus adult homo sapiens 2028-04-02v3No1 / 44
96amnon high in periodontitis compared to control in homo sapiens subgingival plaque brazil mouth 2017-03-29v4No1 / 48
984amnoncommon gingival groove, subgingival plaque, subgingival dental plaque, sea otter, enhydra lutris nereis, united states of america, state of california, wild2022-12-26v4No1 / 50
278amnon high in periodontitis compared to control in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 52
162amnon high in periodontitis compared to control in homo sapiens united states of america san diego dentition subgingival plaque periodontal pocket mouth 2017-07-13v4No1 / 53
260amnoncommon homo sapiens, dentition, subgingival plaque, united states of america, state of nebraska, mouth2017-12-05v4No1 / 59
930amnoncommon non-smoker, human adult stage, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 64
272amnoncommon in subgingival plaque in south korea (common homo sapiens, subgingival plaque, dentition, mouth, south korea)2018-01-10v4No1 / 65
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, periodontal pocket, subgingival plaque, mouth)2017-07-13v4No1 / 67
874amnoncommon buffalo, state of new york, united states of america, postmenopausal, human late adulthood stage, female, subgingival plaque, subgingival dental plaque, homo sapiens2022-03-04v3No1 / 67
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, control, mouth2018-09-14v4No1 / 69
725amnon high in mouth mucosa buccal mucosa compared to subgingival plaque subgingival dental plaque in adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 75
930amnoncommon cigarette smoking, human adult stage, periodontal disease, subgingival dental plaque, subgingival plaque, state of new york, adult, periodontitis, united states of america, homo sapiens2022-08-25v3No1 / 77
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, depth > 3mm, deep pocket depth, periodontitis, mouth2018-09-14v4No1 / 80
955amnoncommon chile, dog, canis lupus familiaris, subgingival dental plaque, subgingival plaque, adult organism2022-12-17v4No1 / 82
826amnon high in supragingival plaque supragingival dental plaque compared to subgingival plaque subgingival dental plaque in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris dentition research facility united states of america 2021-08-22v4No1 / 82
378amnoncommon homo sapiens, brazil, subgingival plaque, dentition, adult, shallow pocket depth, depth < 3mm, periodontitis, mouth2018-09-14v4No1 / 84
998amnon high in before therapy compared to non-surgical periodontal therapy in homo sapiens subgingival dental plaque subgingival plaque adult glasgow united kingdom periodontitis 2022-12-30v3No1 / 85
703amnoncommon dentition, subgingival plaque, subgingival dental plaque, city of dresden, germany, type 2 diabetes mellitus, adult, homo sapiens2028-04-02v3No1 / 89
836amnoncommon oral lichen planus, gingival erosive oral lichen planus, chronic periodontitis, periodontitis, municipality of shanghai, adult, china, subgingival plaque, subgingival dental plaque, homo sapiens2021-09-11v3No1 / 93
826amnon high in dentition subgingival plaque subgingival dental plaque compared to saliva in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris research facility united states of america 2021-08-22v4No1 / 95
998amnoncommon periodontitis, united kingdom, glasgow, adult, subgingival plaque, subgingival dental plaque, homo sapiens2022-12-30v3No1 / 95
278amnoncommon homo sapiens, united states of america, state of california, adult, subgingival plaque2018-01-23v4No1 / 96
278amnon high in control compared to periodontitis in homo sapiens united states of america state of california adult subgingival plaque 2018-01-23v4No1 / 107
955amnon high in periodontitis periodontitis compared to control in adult organism subgingival plaque subgingival dental plaque canis lupus familiaris dog chile 2022-12-17v4No1 / 120
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 146
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america state of california adult 2018-01-23v4No1 / 149
826amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris research facility united states of america 2021-08-22v4No1 / 150
826amnon high in subgingival plaque subgingival dental plaque compared to supragingival plaque supragingival dental plaque in age 4 years adult organism female organism dog beagle dog state of illinois canis lupus familiaris dentition research facility united states of america 2021-08-22v4No1 / 154
836amnoncommon chronic periodontitis, periodontitis, municipality of shanghai, adult, china, subgingival plaque, subgingival dental plaque, homo sapiens2021-09-11v3No1 / 155
725amnoncommon control, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 156
96amnoncommon homo sapiens, subgingival plaque, brazil, mouth2017-03-29v4No1 / 158
955amnoncommon periodontitis, periodontitis, adult organism, subgingival plaque, subgingival dental plaque, canis lupus familiaris, dog, chile2022-12-17v4No1 / 164
106amnoncommon homo sapiens, dentition, germany, subgingival plaque, mouth2017-04-05v4No1 / 167
725amnoncommon chronic periodontitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 206
542amnoncommon subgingival plaque, dentition, monkey, macaca mulatta, research facility, puerto rico, age 12-23 years, adult2019-08-01v4No1 / 208
826amnoncommon dentition, subgingival plaque, subgingival dental plaque, age 4 years, adult organism, female organism, dog, beagle dog, state of illinois, canis lupus familiaris, research facility, united states of america2021-08-22v4No1 / 215
104amnoncommon homo sapiens, russia, moscow, subgingival plaque, dentition, mouth2017-04-05v4No1 / 227
725amnoncommon acute pericementitis, periodontitis, subgingival plaque, subgingival dental plaque, adult, municipality of beijing, china, homo sapiens2021-01-03v3No1 / 240
542amnon high in adult age 12-23 years compared to child age 1-7 years in subgingival plaque dentition monkey macaca mulatta research facility puerto rico 2019-08-01v4No1 / 337
725amnon high in subgingival dental plaque subgingival plaque compared to buccal mucosa mouth mucosa in adult municipality of beijing china homo sapiens 2021-01-03v3No1 / 544

Problems / suggestions? Please email info AT dbbact DOT org