Summary for ontology term: subsurface

Number of annotations with term: 4

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__AnaerococcusTGGGGAATTTTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGATTTAGAAGGCCTTCGGGTTGTAAAAATCTTTTGTATAGGAAGAAAATGACAGTACTATACGAATAAGGTCCGGCTAATTACGTGCCAGCAGCCGCGGTAA0.250000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTTTCAGTAGGGAAGAAGCGAAAGTGACGGTACCTGCAGAAGAAGCACCGGCTAACTACGTGCCAGCAGCCG0.250000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Bradyrhizobiaceae;g__BradyrhizobiumTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCCATGCCGCGTGAGTGATGAAGGCCCTAGGGTTGTAAAGCTCTTTTGTGCGGGAAGATAATGACGGTACCGCAAGAATAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTAGGGAATCTTCGGCAATGGACGAAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAACTCTGTTGGTAGAGAAGAACGTTGGTGAGAGTGGAAAGCTCATCAAGTGACGGTAACTACCCAGAAAGGGACGG0.250000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__Rhodobacteraceae;g__ParacoccusTGGGGAATCTTAGACAATGGGGGCAACCCTGATCTAGCCATGCCGCGTGAGTGATGAAGGCCTTAGGGTTGTAAAGCTCTTTCAGCTGGGAAGATAATGACGGTACCAGCAGAAGAAGCCCCGGCTAACTCCGTGCCAGCAGCCGCGGTA0.250000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__SphingomonadaceaeTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCAATGCCGCGTGAGTGATGAAGGCCTTAGGGTTGTAAAGCTCTTTTACCCGGGATGATAATGACAGTACCGGGAGAATAAGCTCCGGCTAACTCCGTGCCAGCAGCCGCGGTA0.250000
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTGGGGAATATTGGACAATGGGGGAAACCCTGATCCAGCGACGCCGCGTGTGTGAAGAAGGCCTGCGGGTTGTAAAGCACTTTTAGTGGGGATGAAATGTGCAGGGCTAACACCTCTGCATTTTGACCTAACCCACAGAAAAAGCACCGGC0.250000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTCTTCGGATCGTAAAACTCTGTTATTAGGGAAGAACAAATGTGTAAGTAACTATGCACGTCTTGACGGTACCTAATCAGAAAGCCACGGC0.250000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Burkholderiaceae;g__RalstoniaTGGGGAATTTTGGACAATGGGCGAAAGCCTGATCCAGCAATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTTGTCCGGAAAGAAATGGCTCTGGTTAATACCTGGGGTCGATGACGGTACCGGAAGAATAAGGACCGGC0.250000
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__ChryseobacteriumTGAGGAATATTGGACAATGGGTTAGCGCCTGATCCAGCCATCCCGCGTGAAGGACGACGGCCCTATGGGTTGTAAACTTCTTTTGTATAGGGATAAACCTACTCTCGTGAGAGTAGCTGAAGGTACTATACGAATAAGCACCGGCTAACT0.250000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTAGGGAATCTTCCACAATGGACGAAAGTCTGATGGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTTAGAGAAGAATGTAGGTAAGAGTAACTGTTTACCTAGTGACGGTATCTAACCAGAAAGCCACGGC0.500000
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp1TGGGGAATTTTGCGCAATGGGGGAAACCCTGACGCAGCAACGCCGCGTGGAGGATGAAGCCCCTTGGGGTGTAAACTCCTTTCGATCGGGAAGATAATGACGGTACCGATATAAGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.500000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Xanthomonadales;f__Xanthomonadaceae;g__RhodanobacterTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCAATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTTATCAGGAACGAAATACTACGGGTTAATAACCTGTGGGGCTGACGGTACCTGAGGAATAAGCACCGGC0.500000
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp3;g__Gp3TGGGGAATCTTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGAGTGATGAAGCCCTTCGGGGTGTAAAGCTCTTTCGGCAGGGACGATAATGACGGTACCTGCAGAAGAAGCTGCGGCTAACTACGTGCCAGCAGCCGCGGTA0.500000
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaTGGGGAATATTGGACAATGGGGGAAACCCTGATCCAGCGATGCCGCGTGAATGAAGAAGGCCTTAGGGTTGTAAAGTTCTTTCACCCACGACGATGATGACGGTAGTGGGAGAAGAAGCCCCGGCTAACTCCGTGCCAGCAGCCGCGGTA0.500000
d__BacteriaATTAGGAATCTTGCGCAATGGGCGAAAGCCTGACGCAGCGACGCCGCGTGAGGGATGACGGCATTCGTGTTGTAAACCTCTTTTGTCGGGGAAGAAGAAAATGACGGTACCCGGCGAATAAGCCCCGGCTAACTACGTGCCAGCAGCCGC0.500000
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__BurkholderialesTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGCGGGAAGAAGGCCTTCGGGTTGTAAACCGCTTTTGTCAGGGAAGAAAAGCTTCGGGTTAATACCTCGGAGTCATGACGGTACCTGAAGAATAAGCACCGGC0.500000
d__BacteriaATTAGGAATCTTGCACAATGGGGGAAACCCTGATGCAGCGACGCCGCGTGGAGGATGACGGCCTTCGGGTTGTAAACTCCTTTTGGCAGGGAAGAAGAATGTGACGGTACCTGTCGAATAAGCCCCGGCTAACTACGTGCCAGCAGCCGC0.500000
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Myxococcales;f__Labilitrichaceae;g__LabilithrixTGGGGAATCTTGCGCAATGGGCGAAAGCCTGACGCAGCGACGCCGCGTGGGTGATGAAGGCCTTCGGGTTGTAAAGCCCTGTGGGGAGAGACGAATAAGTCATGGCTAATATCCATGGTGATGACGGTATCTCCTTAGCAAGCACCGGCT0.500000
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Xanthomonadales;f__XanthomonadaceaeTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGGGTGAAGAAGGCCTTCGGGTTGTAAAGCCCTTTTGTTCGGGAAGAAATCGTACGGGTGAATATCCTGTGCGGATGACGGTACCGGAAGAATAAGCACCGGC0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTGAGGAATATTGGGCAATGTGCGAAAGCGTGACCCAGTGATGATTCAGGAGTGAGAAAAGGACAGCGATAGCGCTGTAAAGCTCTTTTACTAAGGGAGAAGAAGACACGACTTAGAGAAACAAGCACTGGCCAATTCTGTGCCAGCAGCC0.571429
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__ChloroplastTGAGGAATTTTCTGCAATGGGCGAAAGCCTGACAGAGCAATACCGCGTGAGGGATGAAGGCCTACGGGTTGTAAACCTCTTTTCTCAAGGAGGAAGATCTGACGTTACTTGAGGAATAAGCATCGGCTAACCCTGTGCCAGCAGCCGCGG0.545455
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__CytophagalesTAGGGAATATTGGGCAATGGAGGAGACTCTGACCCAGCCATGCCGCGTGCCGGATGAAGGCCTTCTGGGTCGTAAACGGCTTTTTTCCGGGAAGAACCGGTTCTGTGCGCAGGGCTTTGACGGTACCGGGAGAATAAGCACCGGCTAACT0.444444
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__MicrobacteriaceaeTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCAACGCCGCGTGAGGGACGACGGCCTTCGGGTTGTAAACCTCTTTTAGTAGGGAAGAAGCGTAAAAGTGACGGTACCTGCAGAAAAAGCACCGGCTAACTACGTGCCAGCAGC0.444444
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__AcetobacteraceaeTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCAATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAAGCACTTTCGGCGGGGACGATGATGACGGTACCCGCAGAAGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.444444
d__Bacteria;p__candidate division WPS-2;g__WPS-2_genera_incertae_sedisTGAGGAATTTTCCGCAATGGGCGAAAGCCTGACGGAGCGACGCCGCGTGTGGGAAGAAGGCCTTCGGGTCGTAAACCACTGTCGAAGGGGACTATAATGAATGTACCCTTGGAGGAAGCCCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.444444
d__Bacteria;p__Cyanobacteria/Chloroplast;c__CyanobacteriaTGGGGAATTTTCCGCAATGGGCGCAAGCCTGACGGAGCAATACCGCGTGAGGGAGGAAGGCTCTTGGGTCGTAAACCTCTTTTATCAGGGAAGAACACAATGACGGTACCTGATGAATCAGCATCGGCTAACTCTGTGCCAGCAGCCGCG0.444444
d__Bacteria;p__Cyanobacteria/ChloroplastTGAGGAATTTTCTGCAATGGACGAAAGTCTGACAGAGCAATACCGCGTGAGGGATGAAGGCCTACGGGTTGTAAACCTCTTTTCTCAAGGAGGAAGACATGACGTTACTTGAGGAATAAGCATCGGCTAACCCTGTGCCAGCAGCCGCGG0.444444
d__Bacteria;p__"Bacteroidetes"TAAGGAATATTGGTCAATGGGCGCAAGCCTGAACCAGCCATGCCGCGTGCAGGAGGAAGGCCCTACGGGTTGTAAACTGCTTTTATCTGGGGATAAACCTTACTATGCGTAGTAAGCTGAAGGTACCAGATGAATAAGGATCGGCTAACT0.444444
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__SphingomonadaceaeTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCAATGCCGCGTGAGTGAAGAAGGCCTTAGGGTTGTAAAGCTCTTTTACCCGGGAAGATAATGACTGTACCGGGAGAATAAGCCCCGGCTAACTCCGTGCCAGCAGCCGCGGTA0.444444

Annotations:

common ontology terms
term enrichment score
TermScore
subsurface0.600000
depth 20-100cm0.600000
ice0.500000
glacier0.333333
LOWER IN subsurface0.333333
LOWER IN depth 20-100cm0.333333
depth 0-20cm0.285714
LOWER IN depth 0-20cm0.285714
filtered 0.2um0.285714
surface0.222222
LOWER IN surface0.222222
sweden0.125000
Fraction of dbbact annotations with this term covered by the query
TermScore
subsurface0.500000
depth 20-100cm0.500000
LOWER IN subsurface0.500000
LOWER IN depth 20-100cm0.500000
ice0.333333
depth 0-20cm0.333333
LOWER IN depth 0-20cm0.333333
glacier0.200000
surface0.200000
LOWER IN surface0.200000
filtered 0.2um0.166667
sweden0.066667
Fraction of annotations for the query sequences containing the term
TermScore
glacier1.000000
sweden1.000000
filtered 0.2um1.000000
ice1.000000
subsurface0.750000
depth 20-100cm0.750000
surface0.250000
depth 0-20cm0.250000
LOWER IN subsurface0.250000
LOWER IN depth 20-100cm0.250000
LOWER IN surface0.250000
LOWER IN depth 0-20cm0.250000

Problems / suggestions? Please email info AT dbbact DOT org