Summary for ontology term: surface

Number of annotations with term: 14

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__RhizobialesTACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGACTCTTAAGTCAGGGGTGAAATCCCGGGGCTCAACCTCGGAACTGCCTTTGATACTGTGAGTCTCGAGACCGGAAGAGGTGAGTGGAATTCCTAG0.076923
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp1TGGGGAATTTTGCGCAATGGGGGAAACCCTGACGCAGCAACGCCGCGTGGAGGATGAAGCCCCTTGGGGTGTAAACTCCTTTCGATCGGGAAGATAATGACGGTACCGATATAAGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.076923
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__CytophagalesTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTATTAAGTCAGTGGTGAAAGACGATAGCTCAACTATCGAGGTGCCATTGATACTGATGAACTTGAGTGCACACGAGGTAAGCGGAATGGACGG0.076923
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__BurkholderialesTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGCGGGAAGAAGGCCTTCGGGTTGTAAACCGCTTTTGTCAGGGAAGAAAAGCTCCGGGCTAATACCTTGGAGTCATGACGGTACCTGAAGAATAAGCACCGGC0.076923
d__BacteriaTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCGCCTAAGTCAGTTGTGAAATACCCCGGCTCAACCGGGGGGGTGCGATTGATACTGGGCGGCTCGAGTAACAGCGAGGTTGGCGGAATTGACGG0.076923
d__Bacteria;p__"Actinobacteria";c__ActinobacteriaTGGGGAATCTTGCACAATGGGCGAAAGCCTGATGCAGCAACGCCGCGTGAGGGACGAAGGCTTTCTGAGTTGTAAACCTCTTTCAGCAGGGACGATTGTGACGGTACCTGCAGAAGAAGCCCCGGCCAACTACGTGCCAGCAGCCGCGGT0.076923
d__Bacteria;p__"Gemmatimonadetes";c__Gemmatimonadetes;o__Gemmatimonadales;f__Gemmatimonadaceae;g__GemmatimonasTACGGAGGGTGCGAGCGTTGTCCGGAATCACTGGGCGTAAAGGGCGCGTAGGCGGTCTGCTAAGCGTGTGGTGAAAGCTCGGGGCTCAACCCCGAGTCTGCCATGCGAACTGGTGGACTTGAGCACTGTAGAGGCAGGTGGAATTCCGGG0.076923
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Pseudonocardiaceae;g__PseudonocardiaTGGGGAATATTGCGCAATGGGCGGAAGCCTGACGCAGCGACGCCGCGTGGGGGATGACGGCCTTCGGGTTGTAAACCTCTTTCGACCTTGACGAAGCCTTCGGGTGACGGTAGGGGTAGAAGAAGCACCGGCCAACTACGTGCCAGCAGC0.076923
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__Acetobacteraceae;g__StellaTACGAAGGGGGCTAGCGTTGTTCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGCGCATCAAGTCGGGCGTGAAAGCCCCGGGCTCAACCTGGGAACGGCGTCCGGGACTGATGTGCTGGAGTTCGGGAGAGGAGAGTGGAATTCCCAG0.076923
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp6;g__Gp6TACGGGGGGGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGTTCGTAGGTGGCCAACTAAGTCAGACGTGAAATCCCTCAGCTCAACTGGGGAACTGCGTCTGATACTGGTTGGCTTGAGTGCAGGAGAGGAACGCGGAATTCCAGG0.076923

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp4TACGTAGGGAGCAAGCGTTGTTCGGATTTACTGGGCGTAAAGGGCGCGTAGGCGGCGCGACAAGTCACTTGTGAAATCTCCGGGCTTAACTCGGAACGGCCAAGTGAAACTGTCATGCTAGAGTGCAGAAGGGGCAATCGGAATTCTTGG0.333333
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__EnhydrobacterTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGCCTTTTGGTTGTAAAGCACTTTAAGCAGGGAGGAGAGGCTAATGGTTAATACCCATTAGATTAGACGTTACCTGCAGAATAAGCACCGGC0.333333
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Neisseriales;f__NeisseriaceaeTGGGGAATTTTGGACAATGGGGGAAACCCTGATCCAGCCATGCCGCGTGTATGAAGAAGGCCTTAGGGTTGTAAAGTACTTTTGTTAGGGAAGAAAAGCTAGTTTTTAATAAAAATTAGTGATGACGGTACCTAAAGAATAAGCACCGGC0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Propionibacteriaceae;g__PropionibacteriumTGGGGAATATTGCACAATGGGCGGAAGCCTGATGCAGCAACGCCGCGTGCGGGATGACGGCCTTCGGGTTGTAAACCGCTTTCGCCTGTGACGAAGCGTGAGTGACGGTAATGGGTAAAGAAGCACCGGCTAACTACGTGCCAGCAGCCG0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGGGGGATGACGGCCTTCGGGTTGTAAACTCCTTTCGCTAGGGACGAAGCTTTTTGTGACGGTACCTAGATAAGAAGCACCGGCTAACTACGTGCCAGCAGCC0.333333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATCGTAAAACTCTGTTATTAGGGAAGAACAAATGTGTAAGTAACTATGCACGTCTTGACGGTACCTAATCAGAAAGCCACGGC0.333333
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCGGGGAGGAAGGGAGTAAAGTTAATACCTTTGCTCATTGACGTTACCCGCAGAAGAAGCACCGGC0.333333
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Comamonadaceae;g__DelftiaTGGGGAATTTTGGACAATGGGCGAAAGCCTGATCCAGCAATGCCGCGTGCAGGATGAAGGCCTTCGGGTTGTAAACTGCTTTTGTACGGAACGAAAAAGCTTCTCCTAATACGAGAGGCCCATGACGGTACCGTAAGAATAAGCACCGGC0.333333
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Comamonadaceae;g__PelomonasTGGGGAATTTTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGCGGGAAGAAGGCCTTCGGGTTGTAAACCGCTTTTGTCAGGGAAGAAAAGGTTCTGGCTAATACCTGGGACTCATGACGGTACCTGAAGAATAAGCACCGGC0.333333
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Bradyrhizobiaceae;g__BradyrhizobiumTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCCATGCCGCGTGAGTGATGAAGGCCCTAGGGTTGTAAAGCTCTTTTGTGCGGGAAGATAATGACGGTACCGCAAGAATAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTACAGAGGTCCCAAGCGTTGTTCGGATTCATTGGGCGTAAAGGGTGCGTAGGTGGCATGGTAAGTCGGGTGTGAAATCCCGGGGCTCAACCCCGGAACTGCACTCGATACTACCGTGCTTGAGTACTAGAGAGGAGACTGGAATTTACGG0.352941
d__BacteriaTACGGAGGGGGCCAGCGTTGTTCGGAATCATTGGGCGTAAAGGGCGCCTAGGTGGCCAAGCAAGTCGGACGTGAAAGCCCCCGGCTCAACCGGGGAATTGCATCCGAAACTGCTAGGCTTGAGTCCTGGAGAGGGTAGCGGAATTCCCAG0.352941
d__Bacteria;p__"Proteobacteria";c__DeltaproteobacteriaTACGGAGGGTGCAAACGTTGCTCGGAATCATTGGGCGTAAAGCGCACGTAGGCGGCGCGAAAAGTCAGGTGTGAAAGCCCTCGGCTTAACCGAGGAAGTGCACTTGAAACTTTCGGGCTTGAGTACAGAAGAGGGTCTCGGAATTCCCGG0.352941
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Sphingomonadales;f__SphingomonadaceaeTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGCTTTGTAAGTTAGAGGTGAAAGCCCGGAGCTCAACTCCGGAACTGCCCTTAAAACTGCATCGCTAGAATTGTGGAGAGGTGAGTGGAATTCCGAG0.352941
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Nocardioidaceae;g__NocardioidesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTCTGTCGCGTCGGGAGTGAAAACACCGGGCTTAACTCGGTGCTTGCTTTCGATACGGGTGGACTGGAGGCATGCAGGGGAGAACGGAATTCCTGG0.333333
d__BacteriaTACAGAGAGTGCAAACGTTGTTCGGAATTACTGGGCTTAAAGCGCACGTAGGCGGCGCCGCAAGTGAGGGGTGAAAGCCCACGGCTTACCCGTGGAATTGCCTTTCAGACTGCGGTGCTAGAGTGTGGTAGGGGAGAGCGGAACTCCTGG0.333333
d__Bacteria;p__"Gemmatimonadetes";c__Gemmatimonadetes;o__Gemmatimonadales;f__Gemmatimonadaceae;g__GemmatimonasTACGGAGGGTGCGAGCGTTGTCCGGAATCATTGGGCGTAAAGGGCGCGTAGGTGGCCCGGCAAGCGTGCGGTGAAAGCTCGGGGCTCAACCCCGAGTCGGCCGTGCGAACTGCTGGGCTCGAGCACTGTAGAGGCAGGCGGAATTCCGGG0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCGGCTGTGAAATCTCGGGGCTCAACCCCGAGCCTGCAGTCGATACGGGCAGACTAGAGTGCTGTAGGGGAGACTGGAATTCCTGG0.333333
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGAGCGCGTAGGCGGAACGATAAGCGGGGCCGGAAAGCCCCCGGCTCAACCGGGGAAGGGGCCGCGAACTGTCGTTCTTGAGGGGGAGAGAGGAGAGCGGAATTCCTGGT0.285714
d__BacteriaTGGGGAATATTGGGCAATGGACGCAAGTCTGACCCAGCGACGCCGCGTGCGGGATGAAGGCCTTCGGGTTGTAAACCGCTTTCAGCAGGGAAGAAGCGAAAGTGACGGTACCTGCAAAAGAAGCACCGGCTAACTATGTGCCAGCAGCCG0.272727

Annotations:

common ontology terms
term enrichment score
TermScore
surface0.827586
glacier0.470588
denali national park and preserve0.363636
sand0.363636
alaska0.307692
debris0.307692
biofilter0.307692
ice0.307692
state of wisconsin0.266667
depth 0-20cm0.260870
fish farm0.235294
fruit0.222222
neve yaar0.222222
filtered 0.2um0.210526
LOWER IN surface0.210526
cucumis sativus0.200000
cucumber0.181818
top of glacier0.125000
LOWER IN terminus of glacier0.125000
terminus of glacier0.125000
LOWER IN top of glacier0.125000
LOWER IN middle0.125000
LOWER IN bottom0.125000
middle0.125000
bottom0.125000
LOWER IN subsurface0.125000
LOWER IN depth 20-100cm0.125000
subsurface0.125000
depth 20-100cm0.125000
LOWER IN depth 0-20cm0.117647
sweden0.108108
israel0.083333
fresh water0.061538
water0.034188
united states of america0.015968
Fraction of dbbact annotations with this term covered by the query
TermScore
surface0.800000
denali national park and preserve0.500000
top of glacier0.500000
LOWER IN terminus of glacier0.500000
terminus of glacier0.500000
LOWER IN top of glacier0.500000
fruit0.500000
neve yaar0.500000
LOWER IN middle0.500000
LOWER IN bottom0.500000
sand0.500000
middle0.500000
bottom0.500000
LOWER IN subsurface0.500000
LOWER IN depth 20-100cm0.500000
subsurface0.500000
depth 20-100cm0.500000
glacier0.400000
LOWER IN surface0.400000
alaska0.333333
debris0.333333
cucumis sativus0.333333
biofilter0.333333
depth 0-20cm0.333333
ice0.333333
LOWER IN depth 0-20cm0.333333
cucumber0.250000
state of wisconsin0.250000
fish farm0.200000
filtered 0.2um0.166667
sweden0.066667
israel0.058824
fresh water0.034483
water0.018182
united states of america0.008097
Fraction of annotations for the query sequences containing the term
TermScore
surface0.857143
united states of america0.571429
glacier0.571429
denali national park and preserve0.285714
alaska0.285714
debris0.285714
fish farm0.285714
water0.285714
fresh water0.285714
sand0.285714
biofilter0.285714
state of wisconsin0.285714
sweden0.285714
filtered 0.2um0.285714
ice0.285714
depth 0-20cm0.214286
fruit0.142857
cucumis sativus0.142857
israel0.142857
cucumber0.142857
neve yaar0.142857
LOWER IN surface0.142857
top of glacier0.071429
LOWER IN terminus of glacier0.071429
terminus of glacier0.071429
LOWER IN top of glacier0.071429
LOWER IN middle0.071429
LOWER IN bottom0.071429
middle0.071429
bottom0.071429
LOWER IN subsurface0.071429
LOWER IN depth 20-100cm0.071429
subsurface0.071429
depth 20-100cm0.071429
LOWER IN depth 0-20cm0.071429
Exp. ID User ID Description Date Region Flag Sequences
459amnonhigh freq. in surface in aquaculture biofilter sand (dominant united states of america, surface, fish farm, water, fresh water, sand, biofilter, state of wisconsin)2019-01-12v4No1 / 13
174amnonhigh freq. in debris covered glacier (dominant united states of america, glacier, surface, denali national park and preserve, alaska, debris)2017-07-27v4No1 / 19
662amnondominant in cucumber surface (dominant surface, fruit, cucumis sativus, israel, cucumber, neve yaar)2020-09-22v3No1 / 19
763amnondominant glacier, surface, sweden, depth 0-20cm, filtered 0.2um, ice2021-04-10v3No1 / 19
763amnon high in subsurface depth 20-100cm compared to surface depth 0-20cm in glacier sweden filtered 0.2um ice 2021-04-10v3No1 / 42
763amnon high in surface depth 0-20cm compared to subsurface depth 20-100cm in glacier sweden filtered 0.2um ice 2021-04-10v3No1 / 43
662amnoncommon in cucumber surface (common surface, fruit, cucumis sativus, israel, cucumber, neve yaar)2020-09-22v3No1 / 49
459amnonlower in surface compared to middle and bottom in aquaculture biofilter sand ( high in middle bottom compared to surface in united states of america fish farm water fresh water sand biofilter state of wisconsin )2019-01-12v4No1 / 89
763amnoncommon glacier, surface, sweden, depth 0-20cm, filtered 0.2um, ice2021-04-10v3No1 / 98
174amnoncommon in debris covered glacier (common united states of america, glacier, surface, denali national park and preserve, alaska, debris)2017-07-27v4No1 / 294
174amnonlower farther away from glacier terminus ( high in terminus of glacier compared to top of glacier in united states of america glacier surface denali national park and preserve alaska debris )2017-07-27v4No1 / 310
174amnonhigher farther away from glacier terminus ( high in top of glacier compared to terminus of glacier in united states of america glacier surface denali national park and preserve alaska debris )2017-07-27v4No1 / 369
459amnonhigher in surface compared to middle and bottom in aquaculture biofilter sand ( high in surface compared to middle bottom in united states of america fish farm water fresh water sand biofilter state of wisconsin )2019-01-12v4No1 / 448
459amnoncommon in surface in aquaculture biofilter sand (common united states of america, surface, fish farm, water, fresh water, sand, biofilter, state of wisconsin)2019-01-12v4No1 / 622

Problems / suggestions? Please email info AT dbbact DOT org