Summary for ontology term: sus scrofa

Number of annotations with term: 95

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.010526
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__TuricibacterTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTGATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTCGACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.010526
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTTTTAAGTGAGATGTGAAATACTCGGGCTTAACCTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAAGGGAATTCCTAG0.010526
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGAGGGCAAGTCAGATGTGAAATCCACGGGCTCAACTCGTGAACTGCATTTGAAACTACTCTTCTTGAGTATCGGAGAGGCAATCGGAATTCCTAG0.010526
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Aeromonadales;f__SuccinivibrionaceaeTACGGAGGGTGCAAGCGTTAATCGGAATAACTGGGCGTAAAGGGCATGCAGGCGGTCGGGCAAGTAGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTCTAAACTGTCCGACTAGAGTATTGCAGGGGGAGACGGAATTCCAGG0.010526
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGAGGGCAAGTCAGATGTGAAATCCACGGGCTTAACTCGTGAACTGCATTTGAAACTGTTCTTCTTGAGTATCGGAGAGGCAATCGGAATTCCTAG0.010526
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGAGTAGGCGGGATTGCAAGTCCGTTGTTAAATCTATCGGCTTAACCGGTAGCTGCGGCGGAAACTGTAGTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAGT0.010526
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGCTTGATAAGTTAGAAGTGAAAGTCCTGCTTTCAAGGTGGGAATTGCTTTTAATACTGTTGAGCTTGAGTGCAGAAGAGGTAAGCGGAATTCCAAG0.010526
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGTGCGTAGGCGGGGGACCAAGTCAGGTGTGAAAACTATCGGCTTAACCGGTAGCCTGCACTTGAAACTGGCCCTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCCGG0.010526
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGAAGAGCAAGTCAGTAGTGAAATCCATGGGCTTAACCCGTGAACTGCTATTGAAACTGTTCTTCTTGAGTGAAGTAGAGGTAGGCGGAATTCCCGG0.010526

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGGATGCAAGTCAGATGTGAAATCTATGGGCTCAACCCATAAACTGCATTTGAAACTGTATCTCTTGAGTGCTGGAGAGGTAGATGGAATTCCTTG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGACGGCAAGTCAGAAGTGAAAATTATGGGCTCAACTCATAACCTGCTTTTGAAACTGTTGTTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGACTGCAAGTTGGATGTGAAATGTCGCGGCTTAACCGCGGAGCTGCATCCAAAACTGTAGTTCTTGAGTGGAGTAGAGGTAGGCGGAATTCCGAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTGTGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTGCGGCTCGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGAATGGTAAGTCAGCGGTCAAATGTCCGTGCCCAACGCGGTCCTGCCGTTGATACTGCCGTTCTTGAATACACACAAGGGAGATGGAATTCGTTGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATGCAAGTCGGGAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCGAAACTGTATCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.500000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGATTATTAAGTCAGCGGTGAAAGCGTGTGGCTCAACCATACAGTTGCCGTTGATACTGGTAGTCTTGAGTGTAAACGAGGTAGGCGGAATGTGATG0.500000
d__BacteriaCACGTAGGGGGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCACGCAGGCGGTCAGGCAAGTCTGATGTAAAAATTCAGGGCTCAACCCTGTCATGCGTTGGAAACTGTCTGACTTGAGTACAGGAGGGGATATTGGAATTCCAGGT0.500000
d__BacteriaTACGTAGGGGGCGAGCGTTGTTCGGAATCATTGGGCGTAAAGGGTGCGCAGGTGGCTTGGCAAGTCTGGCGTGAAAGTGCGGGGCTCAACTCCGTGATGCGCTGGAAACTGCCTGGCTTGAGTACAGCAGGGGGCGTCGGAATTCCAGGT0.500000
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGTTAAGTCTGGAGTGAAAGTCCTGCTTTCAAGGTGGGAATTGCTTTGGATACTGATGGGCTGGAGTGCAGGAGAGGAAAGCGGAATTACCGG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGCCGCGGCTCAACCGTGGCACTGCAGCGCGAACTGGTTTTCTTGAGTGCGCGCGACGCAGGCGGAATTCGTGG0.409836
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGTCTTATAAGCGTGACGTGAAATGCAGCGGCTCAACCGTATGATGTGCGTCGCGAACTGTGAGACTTGAGTGTATTCGATGTCAGCGGAATTTGTG0.406504
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGCTTTTAAGCGTGTTGTGAAATGCCGCGGCTCAACCGTGGCACTGCAGCGCGAACTGGAGGCCTTGAGTGCGCGGGAGGTAGGCGGAATTCGTGG0.380165
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGCCTGGTAAGCGTGTTGTGAAATGTCGTTGCTCAACAACGTCACTGCAGCGCGAACTGCCGGGCTTGAGTGTGCGGAAAGCGGGCGGAATTTGTGG0.369748
d__Bacteria;p__"Bacteroidetes"TACGGGGGATGCGAGCGTTATCCGGATTCATTGGGTTTAAAGGGTGCGTAGGCGGCTTTGCAAGTCAGCGGTGAAAGGCCCGGGCTCAACCCGGAAAGTGCCGTTGATACTGTGAGGCTGGAATGCGGATGCTGTGGGAGGAATGAGTGG0.338983
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACTGTCAAGTCAGTTGTGAAATCCGCGGGCTCAACCTGCGGCCTGCAGTTGAAACTGGCGGTCTTGAGTCCGTTCAGGGATGCTGGAATTCATGG0.336134
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTCGTTTAAGCGTGTTGTGAAATGCCGCGGCTCAACCGTGGCACTGCAGCGCGAACTGGATGACTTGAGTTCGCGGGAGGTAGGCGGAATTCGTGG0.333333
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__PhascolarctobacteriumTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTTTTTTAAGTCCGGAGTGAAAATGCGGGGCTCAACCCCGTATGGCTCTGGATACTGGAAGACTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT0.330935
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTCATTGGGTTTAAAGGGTGCGTAGGTGGCTTGTTAAGTCAGCGGTGAAAGTCAGTGGCTCAACCATTGAATTGCCGTTGAAACTGGCGAGCTTGAGTACGTACGGGGCAGGCGGAATGCGTGG0.324786
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGCTATTAAGTCAGCTGTGAAATCCGGCGGCTCAACCGTCGGCCTGCAGTTGATACTGGTGGTCTTGAGTGCGCGCAGGGGCGTTGGAATTCATGG0.324786

Annotations:

common ontology terms
term enrichment score
TermScore
sus scrofa0.952710
pig0.937171
farm0.263896
province of alberta0.227642
state of michigan0.216216
tonsil0.211921
male organism0.184615
age 6 weeks0.169697
ascending colon0.159292
ileum0.143167
caecum0.142857
pregnancy0.129032
female organism0.117264
salmonella enterica subsp. enterica serovar typhimurium0.112150
salmonellosis0.112150
canada0.108475
age 2 months0.100840
adult organism0.100629
belgium0.100629
wild boar0.097561
commonwealth of pennsylvania0.095808
jiangxi province0.091603
colon0.090909
male0.087591
duroc pig0.077670
age 140 days0.077670
jinhua city prefecture0.077670
jinhua pig0.077670
tibet autonomous region0.074766
nanchang city prefecture0.074766
cecal content0.067227
united kingdom0.063218
research facility0.062424
early pregnancy0.059406
late pregnancy0.059406
state of vermont0.059406
age 6-10 weeks0.059406
age 12-19 weeks0.059406
age 1-3 weeks0.059406
suckling0.059406
preweaned0.059406
age 2-4 weeks0.059406
weaned0.059406
corn and soybean diet0.059406
age 4-7 weeks0.059406
state of alabama0.056075
left colon0.056075
LOWER IN caecum0.055944
right colon0.054545
jejunum0.054545
age 4 weeks0.054545
feces0.053492
duodenum0.046875
italy0.045714
china0.041427
LOWER IN salmonellosis0.040404
LOWER IN salmonella enterica subsp. enterica serovar typhimurium0.040404
tylosin phosphate0.040404
LOWER IN tylosin phosphate0.040404
age 8 hours0.040404
sus scrofa domesticus0.040404
province of quebec0.039604
age 1 month0.039604
state of iowa0.039604
age 9 weeks0.039604
nipple0.039604
LOWER IN left colon0.038835
united states of america0.038433
state of tennessee0.038095
LOWER IN jejunum0.038095
LOWER IN right colon0.038095
gastrointestinal system0.036697
LOWER IN ileum0.036036
LOWER IN pig0.036036
wild0.035928
LOWER IN duodenum0.034188
vagina0.034188
zoological garden0.032000
female0.031662
antibiotic0.031496
LOWER IN antibiotic0.031496
diet0.024845
skin0.024845
LOWER IN ascending colon0.020619
first pregnancy0.020619
LOWER IN multiple pregnancies0.020619
multiple pregnancies0.020619
LOWER IN first pregnancy0.020619
LOWER IN tibetan pig0.020619
LOWER IN tibetan swine0.020619
tibetan pig0.020619
tibetan swine0.020619
LOWER IN state of vermont0.020619
LOWER IN late pregnancy0.020619
LOWER IN early pregnancy0.020619
LOWER IN sucram0.020619
sucram0.020619
LOWER IN age 12-19 weeks0.020619
LOWER IN age 6-10 weeks0.020619
LOWER IN age 1-3 weeks0.020619
Fraction of dbbact annotations with this term covered by the query
TermScore
sus scrofa0.937500
pig0.937500
wild boar0.666667
LOWER IN salmonellosis0.500000
LOWER IN salmonella enterica subsp. enterica serovar typhimurium0.500000
ascending colon0.500000
province of alberta0.500000
salmonella enterica subsp. enterica serovar typhimurium0.500000
salmonellosis0.500000
LOWER IN ascending colon0.500000
early pregnancy0.500000
late pregnancy0.500000
first pregnancy0.500000
LOWER IN multiple pregnancies0.500000
multiple pregnancies0.500000
LOWER IN first pregnancy0.500000
tylosin phosphate0.500000
LOWER IN tylosin phosphate0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
tibetan pig0.500000
tibetan swine0.500000
state of vermont0.500000
LOWER IN state of vermont0.500000
duroc pig0.500000
age 140 days0.500000
LOWER IN late pregnancy0.500000
LOWER IN early pregnancy0.500000
LOWER IN sucram0.500000
sucram0.500000
age 6-10 weeks0.500000
LOWER IN age 12-19 weeks0.500000
age 12-19 weeks0.500000
LOWER IN age 6-10 weeks0.500000
age 1-3 weeks0.500000
LOWER IN age 1-3 weeks0.500000
age 8 hours0.500000
sus scrofa domesticus0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
farm 10.500000
LOWER IN farm 20.500000
farm 20.500000
LOWER IN farm 10.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
LOWER IN weaned0.500000
LOWER IN corn and soybean diet0.500000
LOWER IN age 4-7 weeks0.500000
weaned0.500000
corn and soybean diet0.500000
age 4-7 weeks0.500000
LOWER IN suckling0.500000
LOWER IN preweaned0.500000
LOWER IN age 2-4 weeks0.500000
province of quebec0.333333
age 1 month0.333333
LOWER IN colon0.333333
colon0.333333
tibet autonomous region0.333333
LOWER IN wild boar0.333333
state of iowa0.333333
age 9 weeks0.333333
nanchang city prefecture0.333333
standard feed0.333333
LOWER IN standard feed0.333333
nipple0.333333
tonsil0.285714
age 2 months0.250000
state of alabama0.250000
LOWER IN state of alabama0.250000
LOWER IN left colon0.250000
left colon0.250000
male organism0.222222
state of michigan0.222222
age 6 weeks0.200000
state of tennessee0.200000
intestinal contents0.200000
LOWER IN intestinal contents0.200000
LOWER IN jejunum0.200000
LOWER IN right colon0.200000
right colon0.200000
jejunum0.200000
LOWER IN age 4 weeks0.200000
age 4 weeks0.200000
farm0.194444
ileum0.187500
pregnancy0.166667
cecal content0.166667
jiangxi province0.166667
female organism0.153846
gastrointestinal system0.142857
LOWER IN ileum0.125000
adult organism0.125000
belgium0.125000
LOWER IN pig0.125000
caecum0.111111
commonwealth of pennsylvania0.111111
LOWER IN male organism0.111111
Fraction of annotations for the query sequences containing the term
TermScore
sus scrofa0.968421
pig0.936842
farm0.410526
feces0.400000
research facility0.378947
united states of america0.378947
state of michigan0.210526
caecum0.200000
china0.189474
canada0.168421
tonsil0.168421
male0.157895
male organism0.157895
age 6 weeks0.147368
province of alberta0.147368
control0.126316
ileum0.115789
united kingdom0.115789
pregnancy0.105263
ascending colon0.094737
female organism0.094737
commonwealth of pennsylvania0.084211
adult organism0.084211
belgium0.084211
salmonella enterica subsp. enterica serovar typhimurium0.063158
salmonellosis0.063158
adult0.063158
age 2 months0.063158
jiangxi province0.063158
colon0.052632
wild boar0.052632
LOWER IN control0.042105
LOWER IN caecum0.042105
tibet autonomous region0.042105
cecal content0.042105
nanchang city prefecture0.042105
duroc pig0.042105
age 140 days0.042105
italy0.042105
jinhua city prefecture0.042105
jinhua pig0.042105
early pregnancy0.031579
late pregnancy0.031579
female0.031579
state of alabama0.031579
wild0.031579
state of vermont0.031579
left colon0.031579
right colon0.031579
duodenum0.031579
jejunum0.031579
age 6-10 weeks0.031579
age 12-19 weeks0.031579
age 1-3 weeks0.031579
age 4 weeks0.031579
suckling0.031579
preweaned0.031579
age 2-4 weeks0.031579
weaned0.031579
corn and soybean diet0.031579
age 4-7 weeks0.031579
LOWER IN salmonellosis0.021053
LOWER IN salmonella enterica subsp. enterica serovar typhimurium0.021053
LOWER IN ileum0.021053
province of quebec0.021053
state of tennessee0.021053
zoological garden0.021053
age 1 month0.021053
antibiotic0.021053
tylosin phosphate0.021053
LOWER IN antibiotic0.021053
LOWER IN tylosin phosphate0.021053
LOWER IN pig0.021053
state of iowa0.021053
age 9 weeks0.021053
LOWER IN duodenum0.021053
LOWER IN jejunum0.021053
LOWER IN left colon0.021053
LOWER IN right colon0.021053
diet0.021053
gastrointestinal system0.021053
vagina0.021053
nipple0.021053
skin0.021053
age 8 hours0.021053
sus scrofa domesticus0.021053
LOWER IN ascending colon0.010526
first pregnancy0.010526
LOWER IN multiple pregnancies0.010526
multiple pregnancies0.010526
LOWER IN first pregnancy0.010526
LOWER IN colon0.010526
LOWER IN tibetan pig0.010526
LOWER IN tibetan swine0.010526
tibetan pig0.010526
tibetan swine0.010526
LOWER IN sus scrofa0.010526
LOWER IN farm0.010526
LOWER IN state of vermont0.010526
LOWER IN state of alabama0.010526
Exp. ID User ID Description Date Region Flag Sequences
256amnonhigher in illeum compared to other gi tract locations in pigs ( high in ileum compared to caecum duodenum jejunum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 1
700amnon high in antibiotic tylosin phosphate compared to control in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 6
521amnonhigh freq. in weaned pigs (dominant feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 9
700amnon high in caecum compared to colon in control research facility sus scrofa belgium pig age 2 months 2028-04-01v3No1 / 10
700amnon high in antibiotic tylosin phosphate compared to control in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 10
256amnondominant duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 10
388amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 11
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 11
424amnondominant feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 12
673amnondominant research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 13
399amnondominant feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 13
785amnondominant research facility, ileum, sus scrofa, state of iowa, pig, age 9 weeks2021-05-16v4No1 / 13
389amnondominant united states of america, farm, vagina, sus scrofa, state of michigan, pig2018-11-04v4No1 / 13
673amnondominant control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v4No1 / 14
759amnondominant feces, united states of america, sus scrofa, state of alabama, wild, wild boar2021-04-04v4No1 / 14
388amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 14
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 8 hours2018-11-04v4No1 / 14
673amnoncommon research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 15
470amnondominant feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 15
816amnondominant feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, late pregnancy2021-07-04v4No1 / 16
666amnondominant feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 16
673amnondominant research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 17
816amnondominant feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, early pregnancy2021-07-04v4No1 / 17
688amnondominant feces, research facility, sus scrofa, nanchang city prefecture, pig, china, duroc pig, age 140 days2028-03-09v4No1 / 17
389amnondominant united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 17
389amnondominant united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 17
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v4No1 / 17
700amnondominant feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 18
666amnondominant feces, sus scrofa, italy, wild boar2020-09-25v3No1 / 18
256amnondominant caecum, left colon, right colon, sus scrofa, pig, united kingdom2017-11-26v4No1 / 19
521amnonhigh freq. in pre-weaned pigs (dominant feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 20
759amnondominant feces, united states of america, farm, sus scrofa, pig, state of vermont2021-04-04v4No1 / 21
673amnondominant control, research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta2020-09-28v4No1 / 22
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 8 hours2018-11-04v4No1 / 22
314amnondominant farm, caecum, sus scrofa, tibet autonomous region, pig, cecal content, china2018-04-10v4No1 / 23
673amnoncommon control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v4No1 / 25
673amnon high in salmonella enterica subsp. enterica serovar typhimurium salmonellosis compared to control in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 25
700amnon high in control compared to antibiotic tylosin phosphate in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 25
785amnoncommon research facility, ileum, sus scrofa, state of iowa, pig, age 9 weeks2021-05-16v4No1 / 26
673amnon high in salmonella enterica subsp. enterica serovar typhimurium salmonellosis compared to control in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 29
673amnon high in ileum compared to caecum ascending colon in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 31
688amnon high in male male organism compared to female female organism in feces research facility sus scrofa nanchang city prefecture pig china duroc pig age 140 days 2028-03-09v4No1 / 39
700amnon high in control compared to antibiotic tylosin phosphate in research facility sus scrofa belgium pig age 2 months colon 2028-04-01v3No1 / 40
389amnoncommon united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 41
389amnoncommon united states of america, farm, vagina, sus scrofa, state of michigan, pig2018-11-04v4No1 / 43
256amnonlower in intestinal contents compared to mucosal scraping in pig caecum ( high in mucosa compared to intestinal contents in caecum sus scrofa pig united kingdom )2017-11-26v4No1 / 50
700amnon high in colon compared to caecum in control research facility sus scrofa belgium pig age 2 months 2028-04-01v3No1 / 59
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 71
389amnoncommon united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 72
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v4No1 / 80
816amnon high in early pregnancy compared to late pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism 2021-07-04v4No1 / 83
673amnon high in control compared to salmonella enterica subsp. enterica serovar typhimurium salmonellosis in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 88
673amnoncommon research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 99
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in caecum sus scrofa pig united kingdom )2017-11-26v4No1 / 103
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in research facility caecum sus scrofa male canada pig age 6 weeks ascending colon male organism province of alberta 2020-09-28v4No1 / 104
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 112
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 114
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in farm caecum tibet autonomous region cecal content china 2018-04-10v4No1 / 136
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 2 compared to farm 1 in feces farm sus scrofa jinhua city prefecture pig jinhua pig china )2018-12-06v4No1 / 136
673amnoncommon control, research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, province of alberta2020-09-28v4No1 / 154
314amnon high in tibetan pig tibetan swine compared to sus scrofa pig in farm caecum tibet autonomous region cecal content china 2018-04-10v4No1 / 157
700amnoncommon feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 164
389amnon high in age 4 weeks compared to age 1-3 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 168
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in feces farm sus scrofa jinhua city prefecture pig jinhua pig china )2018-12-06v4No1 / 171
389amnon high in age 1-3 weeks compared to age 4 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 189
388amnon high in age 6-10 weeks compared to age 12-19 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 210
666amnoncommon feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 223
256amnonlower in control diet compared to diet enriched with sucram in pig gut ( high in diet sucram compared to standard feed in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 227
673amnon high in caecum ascending colon compared to ileum in control research facility sus scrofa male canada pig age 6 weeks male organism province of alberta 2020-09-28v4No1 / 228
388amnon high in age 12-19 weeks compared to age 6-10 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 231
688amnon high in female female organism compared to male male organism in feces research facility sus scrofa nanchang city prefecture pig china duroc pig age 140 days 2028-03-09v4No1 / 239
759amnon high in farm pig state of vermont compared to state of alabama wild wild boar in feces united states of america sus scrofa 2021-04-04v4No1 / 258
759amnon high in state of alabama wild wild boar compared to farm pig state of vermont in feces united states of america sus scrofa 2021-04-04v4No1 / 268
688amnoncommon feces, research facility, sus scrofa, nanchang city prefecture, pig, china, duroc pig, age 140 days2028-03-09v4No1 / 278
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
666amnoncommon feces, sus scrofa, italy, wild boar2020-09-25v3No1 / 305
816amnon high in late pregnancy compared to early pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism 2021-07-04v4No1 / 312
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, early pregnancy2021-07-04v4No1 / 313
399amnoncommon feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 319
759amnoncommon feces, united states of america, farm, sus scrofa, pig, state of vermont2021-04-04v4No1 / 328
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, late pregnancy2021-07-04v4No1 / 340
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 347
759amnoncommon feces, united states of america, sus scrofa, state of alabama, wild, wild boar2021-04-04v4No1 / 362
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 374
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
314amnoncommon farm, caecum, sus scrofa, tibet autonomous region, pig, cecal content, china2018-04-10v4No1 / 402
424amnoncommon feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 452
470amnoncommon feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 457
256amnoncommon caecum, left colon, right colon, sus scrofa, pig, united kingdom2017-11-26v4No1 / 490
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned corn and soybean diet age 4-7 weeks compared to suckling preweaned age 2-4 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 681
256amnonlower in small intestine compared to colon in pigs ( high in caecum left colon right colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 780

Problems / suggestions? Please email info AT dbbact DOT org