Summary for ontology term: sus scrofa

Number of annotations with term: 95

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.010526
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__TuricibacterTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTGATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTCGACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.010526
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTTTTAAGTGAGATGTGAAATACTCGGGCTTAACCTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAAGGGAATTCCTAG0.010526
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGAGGGCAAGTCAGATGTGAAATCCACGGGCTCAACTCGTGAACTGCATTTGAAACTACTCTTCTTGAGTATCGGAGAGGCAATCGGAATTCCTAG0.010526
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Aeromonadales;f__SuccinivibrionaceaeTACGGAGGGTGCAAGCGTTAATCGGAATAACTGGGCGTAAAGGGCATGCAGGCGGTCGGGCAAGTAGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTCTAAACTGTCCGACTAGAGTATTGCAGGGGGAGACGGAATTCCAGG0.010526
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGAGGGCAAGTCAGATGTGAAATCCACGGGCTTAACTCGTGAACTGCATTTGAAACTGTTCTTCTTGAGTATCGGAGAGGCAATCGGAATTCCTAG0.010526
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGAGTAGGCGGGATTGCAAGTCCGTTGTTAAATCTATCGGCTTAACCGGTAGCTGCGGCGGAAACTGTAGTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAGT0.010526
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGACTGGGCGTAAAGGGCGCGTAGGCGGCTTGATAAGTTAGAAGTGAAAGTCCTGCTTTCAAGGTGGGAATTGCTTTTAATACTGTTGAGCTTGAGTGCAGAAGAGGTAAGCGGAATTCCAAG0.010526
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGTGCGTAGGCGGGGGACCAAGTCAGGTGTGAAAACTATCGGCTTAACCGGTAGCCTGCACTTGAAACTGGCCCTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCCGG0.010526
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGAAGAGCAAGTCAGTAGTGAAATCCATGGGCTTAACCCGTGAACTGCTATTGAAACTGTTCTTCTTGAGTGAAGTAGAGGTAGGCGGAATTCCCGG0.010526

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGGATGCAAGTCAGATGTGAAATCTATGGGCTCAACCCATAAACTGCATTTGAAACTGTATCTCTTGAGTGCTGGAGAGGTAGATGGAATTCCTTG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGACGGCAAGTCAGAAGTGAAAATTATGGGCTCAACTCATAACCTGCTTTTGAAACTGTTGTTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGACTGCAAGTTGGATGTGAAATGTCGCGGCTTAACCGCGGAGCTGCATCCAAAACTGTAGTTCTTGAGTGGAGTAGAGGTAGGCGGAATTCCGAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTGTGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTGCGGCTCGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGAATGGTAAGTCAGCGGTCAAATGTCCGTGCCCAACGCGGTCCTGCCGTTGATACTGCCGTTCTTGAATACACACAAGGGAGATGGAATTCGTTGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATGCAAGTCGGGAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCGAAACTGTATCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.500000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGATTATTAAGTCAGCGGTGAAAGCGTGTGGCTCAACCATACAGTTGCCGTTGATACTGGTAGTCTTGAGTGTAAACGAGGTAGGCGGAATGTGATG0.500000
d__BacteriaCACGTAGGGGGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCACGCAGGCGGTCAGGCAAGTCTGATGTAAAAATTCAGGGCTCAACCCTGTCATGCGTTGGAAACTGTCTGACTTGAGTACAGGAGGGGATATTGGAATTCCAGGT0.500000
d__BacteriaTACGTAGGGGGCGAGCGTTGTTCGGAATCATTGGGCGTAAAGGGTGCGCAGGTGGCTTGGCAAGTCTGGCGTGAAAGTGCGGGGCTCAACTCCGTGATGCGCTGGAAACTGCCTGGCTTGAGTACAGCAGGGGGCGTCGGAATTCCAGGT0.500000
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCTGTTAAGTCTGGAGTGAAAGTCCTGCTTTCAAGGTGGGAATTGCTTTGGATACTGATGGGCTGGAGTGCAGGAGAGGAAAGCGGAATTACCGG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGCCGCGGCTCAACCGTGGCACTGCAGCGCGAACTGGTTTTCTTGAGTGCGCGCGACGCAGGCGGAATTCGTGG0.409836
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGTCTTATAAGCGTGACGTGAAATGCAGCGGCTCAACCGTATGATGTGCGTCGCGAACTGTGAGACTTGAGTGTATTCGATGTCAGCGGAATTTGTG0.406504
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGCTTTTAAGCGTGTTGTGAAATGCCGCGGCTCAACCGTGGCACTGCAGCGCGAACTGGAGGCCTTGAGTGCGCGGGAGGTAGGCGGAATTCGTGG0.380165
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGCCTGGTAAGCGTGTTGTGAAATGTCGTTGCTCAACAACGTCACTGCAGCGCGAACTGCCGGGCTTGAGTGTGCGGAAAGCGGGCGGAATTTGTGG0.369748
d__Bacteria;p__"Bacteroidetes"TACGGGGGATGCGAGCGTTATCCGGATTCATTGGGTTTAAAGGGTGCGTAGGCGGCTTTGCAAGTCAGCGGTGAAAGGCCCGGGCTCAACCCGGAAAGTGCCGTTGATACTGTGAGGCTGGAATGCGGATGCTGTGGGAGGAATGAGTGG0.338983
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACTGTCAAGTCAGTTGTGAAATCCGCGGGCTCAACCTGCGGCCTGCAGTTGAAACTGGCGGTCTTGAGTCCGTTCAGGGATGCTGGAATTCATGG0.336134
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTCGTTTAAGCGTGTTGTGAAATGCCGCGGCTCAACCGTGGCACTGCAGCGCGAACTGGATGACTTGAGTTCGCGGGAGGTAGGCGGAATTCGTGG0.333333
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__PhascolarctobacteriumTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTTTTTTAAGTCCGGAGTGAAAATGCGGGGCTCAACCCCGTATGGCTCTGGATACTGGAAGACTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT0.330935
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTCATTGGGTTTAAAGGGTGCGTAGGTGGCTTGTTAAGTCAGCGGTGAAAGTCAGTGGCTCAACCATTGAATTGCCGTTGAAACTGGCGAGCTTGAGTACGTACGGGGCAGGCGGAATGCGTGG0.324786
d__Bacteria;p__"Bacteroidetes"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGCTATTAAGTCAGCTGTGAAATCCGGCGGCTCAACCGTCGGCCTGCAGTTGATACTGGTGGTCTTGAGTGCGCGCAGGGGCGTTGGAATTCATGG0.324786

Annotations:

common ontology terms
term enrichment score
TermScore
sus scrofa0.952710
pig0.937171
farm0.259013
tonsil0.211921
state of michigan0.205128
province of alberta0.204380
male organism0.176471
age 6 weeks0.156425
ascending colon0.147541
ileum0.136646
caecum0.129032
pregnancy0.125000
female organism0.113924
salmonella enterica subsp. enterica serovar typhimurium0.112150
salmonellosis0.100840
belgium0.100629
wild boar0.097561
age 2 months0.096000
canada0.095522
jiangxi province0.091603
commonwealth of pennsylvania0.091429
duroc pig0.077670
jinhua city prefecture0.077670
jinhua pig0.077670
adult organism0.077295
nanchang city prefecture0.074766
age 140 days0.074766
tibet autonomous region0.072072
male0.070588
cecal content0.065041
united kingdom0.061281
early pregnancy0.059406
late pregnancy0.059406
state of vermont0.059406
age 6-10 weeks0.059406
age 12-19 weeks0.059406
age 1-3 weeks0.059406
suckling0.059406
preweaned0.059406
age 2-4 weeks0.059406
weaned0.059406
age 4-7 weeks0.059406
corn and soybean diet0.059406
research facility0.057079
state of alabama0.056075
left colon0.056075
right colon0.054545
age 4 weeks0.053097
LOWER IN caecum0.052980
jejunum0.051724
feces0.048980
colon0.047619
duodenum0.044776
italy0.043716
LOWER IN salmonella enterica subsp. enterica serovar typhimurium0.040404
tylosin phosphate0.040404
LOWER IN tylosin phosphate0.040404
age 8 hours0.040404
sus scrofa domesticus0.040404
province of quebec0.039604
age 1 month0.039604
state of iowa0.039604
age 9 weeks0.039604
nipple0.039604
LOWER IN salmonellosis0.038835
LOWER IN left colon0.038835
china0.038814
state of tennessee0.038095
LOWER IN right colon0.038095
united states of america0.036738
LOWER IN jejunum0.036697
gastrointestinal system0.036697
LOWER IN pig0.036036
LOWER IN ileum0.035398
wild0.034682
vagina0.034188
LOWER IN duodenum0.033058
zoological garden0.032000
female0.030928
antibiotic0.030534
LOWER IN antibiotic0.030534
diet0.024845
skin0.024540
LOWER IN multiple pregnancies0.020619
first pregnancy0.020619
LOWER IN first pregnancy0.020619
multiple pregnancies0.020619
LOWER IN tibetan pig0.020619
LOWER IN tibetan swine0.020619
tibetan pig0.020619
tibetan swine0.020619
LOWER IN state of vermont0.020619
LOWER IN late pregnancy0.020619
LOWER IN early pregnancy0.020619
LOWER IN sucram0.020619
sucram0.020619
LOWER IN age 12-19 weeks0.020619
LOWER IN age 6-10 weeks0.020619
LOWER IN age 1-3 weeks0.020619
farm 10.020619
Fraction of dbbact annotations with this term covered by the query
TermScore
pig0.937500
sus scrofa0.937500
wild boar0.666667
LOWER IN salmonella enterica subsp. enterica serovar typhimurium0.500000
salmonella enterica subsp. enterica serovar typhimurium0.500000
early pregnancy0.500000
late pregnancy0.500000
LOWER IN multiple pregnancies0.500000
first pregnancy0.500000
LOWER IN first pregnancy0.500000
multiple pregnancies0.500000
tylosin phosphate0.500000
LOWER IN tylosin phosphate0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
tibetan pig0.500000
tibetan swine0.500000
state of vermont0.500000
LOWER IN state of vermont0.500000
duroc pig0.500000
LOWER IN late pregnancy0.500000
LOWER IN early pregnancy0.500000
LOWER IN sucram0.500000
sucram0.500000
age 6-10 weeks0.500000
LOWER IN age 12-19 weeks0.500000
age 12-19 weeks0.500000
LOWER IN age 6-10 weeks0.500000
age 1-3 weeks0.500000
LOWER IN age 1-3 weeks0.500000
age 8 hours0.500000
sus scrofa domesticus0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
farm 10.500000
LOWER IN farm 20.500000
farm 20.500000
LOWER IN farm 10.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
LOWER IN weaned0.500000
LOWER IN corn and soybean diet0.500000
LOWER IN age 4-7 weeks0.500000
LOWER IN preweaned0.500000
LOWER IN suckling0.500000
LOWER IN age 2-4 weeks0.500000
weaned0.500000
age 4-7 weeks0.500000
corn and soybean diet0.500000
ascending colon0.333333
province of alberta0.333333
LOWER IN ascending colon0.333333
province of quebec0.333333
age 1 month0.333333
LOWER IN wild boar0.333333
state of iowa0.333333
age 9 weeks0.333333
nanchang city prefecture0.333333
age 140 days0.333333
standard feed0.333333
LOWER IN standard feed0.333333
nipple0.333333
tonsil0.285714
LOWER IN salmonellosis0.250000
salmonellosis0.250000
tibet autonomous region0.250000
state of alabama0.250000
LOWER IN state of alabama0.250000
LOWER IN left colon0.250000
left colon0.250000
male organism0.200000
state of tennessee0.200000
age 2 months0.200000
intestinal contents0.200000
LOWER IN intestinal contents0.200000
LOWER IN right colon0.200000
right colon0.200000
state of michigan0.200000
farm0.189189
age 6 weeks0.166667
ileum0.166667
LOWER IN age 4 weeks0.166667
age 4 weeks0.166667
jiangxi province0.166667
pregnancy0.153846
female organism0.142857
cecal content0.142857
LOWER IN jejunum0.142857
jejunum0.142857
gastrointestinal system0.142857
belgium0.125000
LOWER IN pig0.125000
LOWER IN ileum0.111111
commonwealth of pennsylvania0.100000
LOWER IN male organism0.100000
caecum0.095238
vagina0.090909
LOWER IN duodenum0.076923
duodenum0.076923
Fraction of annotations for the query sequences containing the term
TermScore
sus scrofa0.968421
pig0.936842
farm0.410526
feces0.400000
research facility0.378947
united states of america0.378947
state of michigan0.210526
caecum0.200000
china0.189474
canada0.168421
tonsil0.168421
male0.157895
male organism0.157895
age 6 weeks0.147368
province of alberta0.147368
control0.126316
ileum0.115789
united kingdom0.115789
pregnancy0.105263
ascending colon0.094737
female organism0.094737
commonwealth of pennsylvania0.084211
adult organism0.084211
belgium0.084211
salmonellosis0.063158
salmonella enterica subsp. enterica serovar typhimurium0.063158
adult0.063158
age 2 months0.063158
jiangxi province0.063158
colon0.052632
wild boar0.052632
LOWER IN control0.042105
LOWER IN caecum0.042105
cecal content0.042105
tibet autonomous region0.042105
nanchang city prefecture0.042105
age 140 days0.042105
duroc pig0.042105
italy0.042105
jinhua city prefecture0.042105
jinhua pig0.042105
early pregnancy0.031579
late pregnancy0.031579
female0.031579
state of alabama0.031579
wild0.031579
state of vermont0.031579
right colon0.031579
left colon0.031579
duodenum0.031579
jejunum0.031579
age 6-10 weeks0.031579
age 12-19 weeks0.031579
age 1-3 weeks0.031579
age 4 weeks0.031579
suckling0.031579
preweaned0.031579
age 2-4 weeks0.031579
weaned0.031579
age 4-7 weeks0.031579
corn and soybean diet0.031579
LOWER IN salmonellosis0.021053
LOWER IN salmonella enterica subsp. enterica serovar typhimurium0.021053
LOWER IN ileum0.021053
province of quebec0.021053
zoological garden0.021053
state of tennessee0.021053
age 1 month0.021053
tylosin phosphate0.021053
antibiotic0.021053
LOWER IN tylosin phosphate0.021053
LOWER IN antibiotic0.021053
LOWER IN pig0.021053
state of iowa0.021053
age 9 weeks0.021053
LOWER IN duodenum0.021053
LOWER IN jejunum0.021053
LOWER IN right colon0.021053
LOWER IN left colon0.021053
diet0.021053
gastrointestinal system0.021053
vagina0.021053
skin0.021053
nipple0.021053
age 8 hours0.021053
sus scrofa domesticus0.021053
LOWER IN ascending colon0.010526
LOWER IN multiple pregnancies0.010526
first pregnancy0.010526
LOWER IN first pregnancy0.010526
multiple pregnancies0.010526
LOWER IN colon0.010526
LOWER IN tibetan pig0.010526
LOWER IN tibetan swine0.010526
tibetan pig0.010526
tibetan swine0.010526
LOWER IN sus scrofa0.010526
LOWER IN state of vermont0.010526
LOWER IN farm0.010526
LOWER IN state of alabama0.010526
Exp. ID User ID Description Date Region Flag Sequences
256amnonhigher in illeum compared to other gi tract locations in pigs ( high in ileum compared to duodenum jejunum caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 1
700amnon high in tylosin phosphate antibiotic compared to control in colon age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 6
521amnonhigh freq. in weaned pigs (dominant pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 9
700amnon high in caecum compared to colon in control age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 10
700amnon high in tylosin phosphate antibiotic compared to control in colon age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 10
256amnondominant sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 10
388amnondominant pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 11
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 11
424amnondominant sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 12
673amnondominant salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 13
399amnondominant feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 13
785amnondominant state of iowa, ileum, research facility, age 9 weeks, sus scrofa, pig2021-05-16v4No1 / 13
389amnondominant pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 13
673amnondominant control, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 14
759amnondominant state of alabama, united states of america, feces, wild, wild boar, sus scrofa2021-04-04v4No1 / 14
388amnondominant pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 14
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 14
673amnoncommon salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 15
470amnondominant sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 15
816amnondominant late pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 16
666amnondominant pig, sus scrofa domesticus, italy, feces2020-09-25v3No1 / 16
673amnondominant caecum, ascending colon, salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 17
816amnondominant early pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 17
688amnondominant nanchang city prefecture, feces, age 140 days, research facility, duroc pig, china, pig, sus scrofa2028-03-09v4No1 / 17
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 17
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 17
389amnondominant pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 17
700amnondominant belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v3No1 / 18
666amnondominant wild boar, sus scrofa, italy, feces2020-09-25v3No1 / 18
256amnondominant sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 19
521amnonhigh freq. in pre-weaned pigs (dominant pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 20
759amnondominant state of vermont, farm, pig, united states of america, feces, sus scrofa2021-04-04v4No1 / 21
673amnondominant caecum, control, ascending colon, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 22
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 8 hours2018-11-04v4No1 / 22
314amnondominant caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 23
673amnoncommon control, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 25
673amnon high in salmonellosis salmonella enterica subsp. enterica serovar typhimurium compared to control in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 25
700amnon high in control compared to antibiotic tylosin phosphate in colon age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 25
785amnoncommon state of iowa, ileum, research facility, age 9 weeks, sus scrofa, pig2021-05-16v4No1 / 26
673amnon high in salmonellosis salmonella enterica subsp. enterica serovar typhimurium compared to control in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 29
673amnon high in ileum compared to caecum ascending colon in control research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 31
688amnon high in male organism male compared to female female organism in nanchang city prefecture feces age 140 days research facility duroc pig china pig sus scrofa 2028-03-09v4No1 / 39
700amnon high in control compared to tylosin phosphate antibiotic in colon age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 40
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 41
389amnoncommon pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 43
256amnonlower in intestinal contents compared to mucosal scraping in pig caecum ( high in mucosa compared to intestinal contents in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 50
700amnon high in colon compared to caecum in control age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 59
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 4 weeks2018-11-04v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 80
816amnon high in early pregnancy compared to late pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig 2021-07-04v4No1 / 83
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 88
673amnoncommon caecum, ascending colon, salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 99
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 103
673amnon high in control compared to salmonellosis salmonella enterica subsp. enterica serovar typhimurium in caecum ascending colon research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 104
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 136
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 2 compared to farm 1 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 136
673amnoncommon caecum, control, ascending colon, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 154
314amnon high in tibetan pig tibetan swine compared to sus scrofa pig in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 157
700amnoncommon belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v3No1 / 164
389amnon high in age 4 weeks compared to age 1-3 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 168
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 171
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 189
388amnon high in age 6-10 weeks compared to age 12-19 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 210
666amnoncommon pig, sus scrofa domesticus, italy, feces2020-09-25v3No1 / 223
256amnonlower in control diet compared to diet enriched with sucram in pig gut ( high in diet sucram compared to standard feed in sus scrofa pig gastrointestinal system united kingdom )2017-11-26v4No1 / 227
673amnon high in caecum ascending colon compared to ileum in control research facility age 6 weeks male male organism province of alberta canada pig sus scrofa 2020-09-28v4No1 / 228
388amnon high in age 12-19 weeks compared to age 6-10 weeks in pig sus scrofa tonsil farm united states of america state of michigan 2018-11-03v4No1 / 231
688amnon high in female female organism compared to male organism male in nanchang city prefecture feces age 140 days research facility duroc pig china pig sus scrofa 2028-03-09v4No1 / 239
759amnon high in state of vermont farm pig compared to state of alabama wild wild boar in united states of america feces sus scrofa 2021-04-04v4No1 / 258
759amnon high in state of alabama wild wild boar compared to state of vermont farm pig in united states of america feces sus scrofa 2021-04-04v4No1 / 268
688amnoncommon nanchang city prefecture, feces, age 140 days, research facility, duroc pig, china, pig, sus scrofa2028-03-09v4No1 / 278
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
666amnoncommon wild boar, sus scrofa, italy, feces2020-09-25v3No1 / 305
816amnon high in late pregnancy compared to early pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig 2021-07-04v4No1 / 312
816amnoncommon early pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 313
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
759amnoncommon state of vermont, farm, pig, united states of america, feces, sus scrofa2021-04-04v4No1 / 328
816amnoncommon late pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 340
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 347
759amnoncommon state of alabama, united states of america, feces, wild, wild boar, sus scrofa2021-04-04v4No1 / 362
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig )2021-07-04v4No1 / 374
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
521amnonlower in pre-weaned pigs compared to weaned older timepoints ( high in weaned age 4-7 weeks corn and soybean diet compared to preweaned suckling age 2-4 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 681
256amnonlower in small intestine compared to colon in pigs ( high in caecum right colon left colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in commonwealth of pennsylvania pregnancy feces adult organism research facility united states of america female organism sus scrofa pig )2021-07-04v4No1 / 780

Problems / suggestions? Please email info AT dbbact DOT org