Summary for ontology term: sweden

Number of annotations with term: 144

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.006993
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.006993
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTGGTCGCGTCTGTCGTGAAATCCTCTGGCTTAACTGGGGGCTTGCGGTGGGTACGGGCCGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.006993
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.006993
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCAACGCCGCGTGAAGGAAGACGGTTTTCGGATTGTAAACTTCTGTTCTTAGTGAAGAATAATGACGGTAGCTAAGGAGCAAGCCACGGCTAACTACGTGCCAGCAGCCGCGGT0.006993
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__OlsenellaTGGGGAATCTTGCGCAATGGGCGGAAGCCTGACGCAGCGACGCCGCGTGCGGGAGGAAGGCCCTCGGGTCGTAAACCGCTTTCAGCAGGGACGAGGCCGCAAGGTGACGGTACCTGCAGAAGAAGCCCCGGCTAACTACGTGCCAGCAGC0.006993
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__HoldemanellaTAGGGAATTTTCGTCAATGGGGGGAACCCTGAACGAGCAATGCCGCGTGAGTGAGGAAGGTCTTCGGATCGTAAAGCTCTGTTGTAAGAGAAAAACGGCACTCATAGGGAATGATGAGTGAGTGATGGTATCTTACCAGAAAGTCACGGC0.006993
d__BacteriaTGAGGGATATTGGGCAATGGGGGAAACCCTGACCCAGCAACGCCGCGTGAGGGATGACGGTTTTCGGATTGTAAACCTCTGTCCTCTGTGAAGATAGTGACGGTAGCAGAGGAGGAAGCTCCGGCTAACTACGTGCCAGCAGCCGCGGTA0.006993
d__BacteriaGGGGGAATATTGGGCAATGGGGGAAACCCTGACCCAGCAACGCCGCGTGAAGGAAGAAGGCCTTCGGGTTGTAAACTTCTGTGACAGGGGACGAAGGAAGTGACGGTACCCTGAGAGGAAGCTCCGGCAAACTACGTGCCAGCAGCCGCG0.006993
d__BacteriaTCGGGAATATTGCGCAATGGAGGAAACTCTGACGCAGTGACGCCGCGTATAGGAAGAAGGTTTTCGGATTGTAAACTATTGTCTGCAGGGAAGAAAAAAGACTGTACCTGCAAAGAAAGCTCCGGCTAACTACGTGCCAGCAGCCGCGGT0.006993

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGATTTCGGTTCGTAAAGCTCTGTTGTTAGGGAAGAATGATTGTGTAGTAACTATACACAGTAGAGACGGTACCTAACCAGAAAGCCACGGC0.333333
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTAGGGAATATTGCTCAATGGGGGAAACCCTGAAGCAGCAACGCCGCGTGGAGGATGACACTTTTCGGAGCGTAAACTCCTTTTGTTAGGGAAGAACAATGACGGTACCTAACGAATAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGT0.333333
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTTAATCGGGACGAAAGGCCTTCTTGCGAATAGTGAGAAGGATTGACGGTACCGGAATAGAAAGCCACGG0.333333
d__Bacteria;p__"Bacteroidetes";c__Sphingobacteriia;o__"Sphingobacteriales";f__Sphingobacteriaceae;g__PedobacterTACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTGTTAAGTCAGAGGTGAAAGACGGTAGCTCAACTATCGCAGTGCCTTTGATACTGATGGGCTTGAATAAACTAGAGGTAGGCGGAATGAGACA0.333333
d__BacteriaGACGGTAAAGACTAGTGTTATTCATCTTTAATAGGTTTAAAGGGTACCTAGACGGTATATCAAGCCCCAAAAGGGAACGGATATTACTAGAGTTTTATGTGAGAGGTTTATTTTAGTACTATCGGAGTAGAGATGAAATTCTTTGATACT0.333333
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegasphaeraTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGAAGACGGCCTTCGGGTTGTAAAGCTCTGTTATACGGGACGAACGGGCGGGATGCTAATACCATCCTGTTGTGACGGTACCGTAAGAGAAAGCCACGG0.333333
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae";g__FusobacteriumTGGGGAATATTGGACAATGGACCAAAAGTCTGATCCAGCAATTCTGTGTGCACGATGAAGTTTTTCGGAATGTAAAGTGCTTTCAGTTGGGACGAAGTAAGTGACGGTACCAACAGAAGAAGCGACGGCTAAATACGTGCCAGCAGCCGC0.333333
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Aeromonadales;f__Succinivibrionaceae;g__SuccinivibrioTAGGGAATATTGCACAATGGAGGAAACTCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGAGGGGAGGAGAATGACGTTACCCTCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTA0.333333
d__BacteriaTGAGGAATATTGGGCAATGGAGGCAACTCTGACCCAGCCATGCCGCGTGAGTGAAGAAGGTTTTCGGATTGTAAAGCTCTTTCGGACAGGAAGATAATGACGGTACTGTCTAAAGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.333333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTGAGGAATATTGGTCAATGGGCGCAGGCCTGAACCAGCCAAGTAGCGTGAAGGATGACTGCCCTATGGGTTGTAAACTTCTTTTATAAAGGAATAAAGTCGGGTATGTATACCCGTTTGCATGTACTTTATGAATAAGGATCGGCTAACT0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__GranulicatellaTAGGGAATCTTCCGCAATGGACGCAAGTCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGATTTCGGTTCGTAAAACTCTGTTGTTAGAGAAGAACAGCGCATAGAGTAACTGTTATGCGTGTGACGGTATCTAACCAGAAAGCCACGGC0.215247
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__SerratiaTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGCGAGGAGGAAGGGTTCAGTGTTAATAGCACTGTTCATTGACGTTACTCGCAGAAGAAGCACCGGC0.195122
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGATTTCGGTTCGTAAAGCTCTGTTGTTAGGGAAGAATGATTGTGTAGTAACTATACACAGTAGAGACGGTACCTAACCAGAAAGCCACGGC0.185053
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae"TGAGGAATATTGGTCAATGGACGGAAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTCTGGGTTGTAAACTGCTTTTAGTTGGGAATAAAAAAGAGGACGTGTCCTCTATTGTATGTACCTTCAGAAAAAGGACCGGCTAATT0.176471
d__BacteriaTACATAGGATGCAAGCGTTATCCGGATTTACTGGGCGTAAAGCGAGCGCAGGCGGATTTACAAGTCTGATGTTAAAGACAACTGCTTAACGGTTGTTTGCATTGGAAACTGTAAGTCTAGAGTATAGTAGAGAGTTTTGGAACTCCATGT0.169697
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGACGGAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGAGAAGAACGAGTGTGAGAGTGGAAAGTTCACACTGTGACGGTATCTTACCAGAAAGGGACGG0.163462
d__Bacteria;p__Firmicutes;c__Negativicutes;o__SelenomonadalesTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATTGTAAAGCTCTGTTAATCGGGACGAAAGAGTTCTGTGTAAATAATGCAGAAAAGTGACGGTACCGGAATAGAAAGCCACGG0.161850
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGAAGGTCTTCGGATTGTAAAGCTCTGTTAATCGGGACGAAAGAGTTCTGTGTGAATAATGCAGAAAAGTGACGGTACCGGAATAGAAAGCCACGG0.160428
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillaceae 2TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGCTCGCAGGCGGTCTTTTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGAGGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.157576
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Pseudomonadaceae;g__PseudomonasTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTAGTTAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCAAAACTGACTGACTAGAGTATGGTAGAGGGTGGTGGAATTTCCTG0.154930

Annotations:

common ontology terms
term enrichment score
TermScore
sweden0.863880
oncorhynchus mykiss0.314286
rainbow trout0.314286
municipality of umea0.208791
lund0.181818
clayey till0.181818
late weichselian glaciation0.181818
fish0.168582
loam soil0.166667
kingdom of denmark0.117647
infant0.109489
gay0.100000
agricultural field0.095238
homosexual0.090909
msm0.090909
charles river laboratories0.090909
glacier0.086957
male0.086785
child0.086420
digestive system0.085603
ice0.084848
fishmeal diet0.078431
cold environment0.076923
gut content0.076923
18c0.076923
hiv infection0.076923
lake sediment0.074074
colon0.074074
saliva0.073762
3-month-old human stage0.072727
peatland0.068966
filtered 0.2um0.066667
18-month-old human stage0.064935
warm temperature habitat0.064935
12c0.064935
larvae insect diet0.064935
gastrointestinal system mucosa0.064516
kingdom of spain0.062350
12-month-old human stage0.061920
heterosexual0.059172
msw0.059172
c57bl/60.055556
3-year-old human stage0.052632
pre pupae insect diet0.052632
ursus arctos0.051282
brown bear0.051282
depth 0-5cm0.051282
LOWER IN 3-month-old human stage0.050633
research facility0.050063
snow0.050000
mouse0.049383
6-month-old human stage0.048780
mus musculus0.045977
2-days-old human0.040000
5-year-old human stage0.040000
LOWER IN defatted larvae insect diet0.040000
defatted larvae insect diet0.040000
LOWER IN larvae insect diet0.040000
LOWER IN pre pupae insect diet0.040000
lapland0.040000
subsurface0.040000
depth 20-100cm0.040000
7-year-old human stage0.039216
depth (water) 1m0.039216
western diet0.039216
LOWER IN fishmeal diet0.039216
depth 0-20cm0.039216
depth (water) 5m0.038462
surface0.037736
2-year-old human stage0.037037
finland0.036364
kingdom of norway0.035714
homo sapiens0.035257
wild0.033333
high fat diet0.033333
mouse chow0.031746
LOWER IN 18-month-old human stage0.027027
LOWER IN 3-year-old human stage0.027027
chest0.027027
torso0.027027
plough layer 0.027027
depth 70-120cm0.027027
sandy till 0.027027
depth 200-260cm0.027027
depth 300-350cm0.027027
LOWER IN warm temperature habitat0.027027
LOWER IN 12c0.027027
LOWER IN cold environment0.027027
depth 450-480cm0.027027
depth 550-600cm0.027027
LOWER IN depth 200-350cm0.027027
depth 200-350cm0.027027
defatted larvae insects diet0.027027
epidermis0.026667
fish feed0.026667
2-month-old human stage0.026667
LOWER IN 12-month-old human stage0.026490
depth (soil) 20-30cm0.026316
province of ontario0.025974
LOWER IN 2-year-old human stage0.025641
Fraction of dbbact annotations with this term covered by the query
TermScore
sweden0.866667
fishmeal diet0.666667
municipality of umea0.500000
2-days-old human0.500000
5-year-old human stage0.500000
18-month-old human stage0.500000
3-year-old human stage0.500000
LOWER IN 2-days-old human0.500000
LOWER IN 18-month-old human stage0.500000
LOWER IN 3-year-old human stage0.500000
LOWER IN 5-year-old human stage0.500000
chest0.500000
torso0.500000
lund0.500000
clayey till0.500000
late weichselian glaciation0.500000
plough layer 0.500000
depth 70-120cm0.500000
sandy till 0.500000
depth 200-260cm0.500000
depth 300-350cm0.500000
temp 12c0.500000
cold environment0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
oncorhynchus mykiss0.500000
rainbow trout0.500000
gut content0.500000
warm temperature habitat0.500000
18c0.500000
LOWER IN 12c0.500000
LOWER IN cold environment0.500000
12c0.500000
LOWER IN 18c0.500000
warm termpterature habitat0.500000
LOWER IN yeast diet0.500000
depth 450-480cm0.500000
depth 550-600cm0.500000
depth 20-120cm0.500000
LOWER IN depth 200-350cm0.500000
depth 200-350cm0.500000
LOWER IN depth 20-120cm0.500000
LOWER IN depth 450-600cm0.500000
depth 450-600cm0.500000
LOWER IN colonic lumen0.500000
colonic lumen0.500000
defatted larvae insects diet0.500000
larvae insect diet0.500000
pre-pupae insect diet0.500000
pre pupae insect diet0.500000
LOWER IN defatted larvae insect diet0.500000
defatted larvae insect diet0.500000
LOWER IN larvae insect diet0.500000
LOWER IN pre pupae insect diet0.500000
14-days-old human0.500000
lapland0.500000
LOWER IN lapland0.500000
LOWER IN subsurface0.500000
LOWER IN depth 20-100cm0.500000
subsurface0.500000
depth 20-100cm0.500000
LOWER IN trichuris muris0.500000
trichuris muris0.500000
7-year-old human stage0.333333
epidermis0.333333
loam soil0.333333
LOWER IN age 1-7 years0.333333
age 1-7 years0.333333
fish feed0.333333
ursus arctos0.333333
brown bear0.333333
LOWER IN depth (water) 1m0.333333
lake sediment0.333333
depth (water) 1m0.333333
LOWER IN western diet0.333333
colon0.333333
western diet0.333333
colonic mucosa0.333333
LOWER IN colonic mucosa0.333333
LOWER IN fishmeal diet0.333333
LOWER IN 2-month-old human stage0.333333
2-month-old human stage0.333333
depth 0-5cm0.333333
depth 0-20cm0.333333
ice0.333333
LOWER IN depth 0-20cm0.333333
LOWER IN 7-year-old human stage0.333333
3-month-old human stage0.285714
LOWER IN 3-month-old human stage0.285714
12-month-old human stage0.285714
LOWER IN 12-month-old human stage0.285714
depth (soil) 20-30cm0.250000
depth (water) 5m0.250000
LOWER IN depth (water) 5m0.250000
charles river laboratories0.250000
snow0.250000
gay0.250000
LOWER IN gay0.250000
province of ontario0.200000
6-month-old human stage0.200000
Fraction of annotations for the query sequences containing the term
TermScore
sweden0.861111
homo sapiens0.395833
research facility0.312500
saliva0.243056
digestive system0.229167
oncorhynchus mykiss0.229167
fish0.229167
rainbow trout0.229167
child0.194444
feces0.194444
male0.152778
municipality of umea0.131944
adult0.111111
kingdom of denmark0.111111
agricultural field0.111111
lund0.111111
loam soil0.111111
clayey till0.111111
late weichselian glaciation0.111111
infant0.104167
kingdom of spain0.090278
mus musculus0.083333
mouse0.083333
gay0.062500
homosexual0.062500
msm0.062500
hiv infection0.062500
c57bl/60.055556
charles river laboratories0.055556
glacier0.055556
ice0.048611
3-month-old human stage0.041667
cold environment0.041667
gut content0.041667
18c0.041667
gastrointestinal system mucosa0.041667
fishmeal diet0.041667
peatland0.041667
lake sediment0.041667
depth (sediment) 0-20cm0.041667
stordalen mire0.041667
colon0.041667
filtered 0.2um0.041667
control0.041667
18-month-old human stage0.034722
12-month-old human stage0.034722
warm temperature habitat0.034722
12c0.034722
larvae insect diet0.034722
heterosexual0.034722
msw0.034722
3-year-old human stage0.027778
LOWER IN 3-month-old human stage0.027778
6-month-old human stage0.027778
wild0.027778
ursus arctos0.027778
brown bear0.027778
pre pupae insect diet0.027778
depth 0-5cm0.027778
snow0.027778
7-year-old human stage0.020833
2-days-old human0.020833
5-year-old human stage0.020833
2-year-old human stage0.020833
depth (water) 5m0.020833
depth (water) 1m0.020833
mouse chow0.020833
high fat diet0.020833
western diet0.020833
LOWER IN defatted larvae insect diet0.020833
defatted larvae insect diet0.020833
LOWER IN fishmeal diet0.020833
LOWER IN larvae insect diet0.020833
LOWER IN pre pupae insect diet0.020833
kingdom of norway0.020833
finland0.020833
lapland0.020833
surface0.020833
depth 0-20cm0.020833
subsurface0.020833
depth 20-100cm0.020833
LOWER IN 2-year-old human stage0.013889
LOWER IN 18-month-old human stage0.013889
LOWER IN 3-year-old human stage0.013889
skin0.013889
canada0.013889
province of ontario0.013889
chest0.013889
epidermis0.013889
torso0.013889
depth (soil) 20-30cm0.013889
plough layer 0.013889
depth 70-120cm0.013889
sandy till 0.013889
depth 200-260cm0.013889
depth 300-350cm0.013889
LOWER IN 12-month-old human stage0.013889
fish feed0.013889
LOWER IN warm temperature habitat0.013889
LOWER IN 12c0.013889
Exp. ID User ID Description Date Region Flag Sequences
596amnonpeaks at 6 months in human saliva ( high in 6-month-old human stage compared to 2-year-old human stage 3-month-old human stage 12-month-old human stage in homo sapiens saliva child sweden )2020-03-18v3No1 / 1
763amnonalgae chloroplast (other glacier, chloroplast, sweden, algae)2021-04-08v3No1 / 1
578amnon high in hiv infection compared to control in feces homo sapiens adult kingdom of spain sweden gay homosexual msm male 2020-01-14v3No1 / 1
313amnon high in fishmeal diet compared to yeast diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-04-10v4No1 / 2
827sheryoDominant in soil at 25cm depth in clayey till loam soil, Lund Denmark (dominant kingdom of denmark, depth (soil) 20-30cm, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, plough layer )2021-08-24v3No1 / 3
313amnonlower in gut content of fish grown in 12C compared to 18C water ( high in warm temperature habitat 18c compared to 12c cold environment in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout gut content )2018-04-10v4No1 / 3
313amnonlower in gut mucosa of fish grown in 12C compared to 18C water ( high in 18c warm termpterature habitat compared to 12c cold environment in digestive system research facility gastrointestinal system mucosa oncorhynchus mykiss sweden fish rainbow trout )2018-04-10v4No1 / 3
494amnon high in colonic mucosa compared to colonic lumen in research facility mus musculus c57bl/6 male sweden mouse charles river laboratories 2019-02-27v4No1 / 3
827sheryoDominant in soil at 95cm depth in clayey till loam soil, Lund Denmark (dominant kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 70-120cm, sandy till )2021-08-24v3No1 / 4
313amnonhigh freq. in rainbow trout gut content grown in 18C water (dominant digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 5
313amnonhigh freq. in rainbow trout gut mucosa grown in 18C water (dominant digestive system, research facility, gastrointestinal system mucosa, oncorhynchus mykiss, sweden, fish, rainbow trout, warm temperature habitat, 18c)2018-04-10v4No1 / 5
313amnonhigh freq. in rainbow trout gut mucosa grown in 12C water (dominant digestive system, research facility, gastrointestinal system mucosa, oncorhynchus mykiss, sweden, fish, rainbow trout, 12c, cold environment)2018-04-10v4No1 / 6
900amnondominant peatland, lake sediment, sweden, depth (water) 5m, depth (sediment) 0-20cm, stordalen mire2022-04-25v4No1 / 6
827sheryoDominant in soil at 325cm depth in clayey till loam soil, Lund Denmark (dominant kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 300-350cm)2021-08-24v3No1 / 7
777amnondominant homo sapiens, saliva, infant, sweden, municipality of umea, 2-days-old human2021-04-26v3No1 / 8
313amnoncommon in rainbow trout gut mucosa grown in 18C water (common digestive system, research facility, gastrointestinal system mucosa, oncorhynchus mykiss, sweden, fish, rainbow trout, warm temperature habitat, 18c)2018-04-10v4No1 / 8
313amnoncommon in rainbow trout gut content grown in 18C water (common digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, gut content, warm temperature habitat, 18c)2018-04-10v4No1 / 9
900amnondominant peatland, lake sediment, sweden, depth (water) 1m, depth (sediment) 0-20cm, stordalen mire2022-04-25v4No1 / 9
494amnon high in colonic lumen compared to colonic mucosa in research facility mus musculus c57bl/6 male sweden mouse charles river laboratories 2019-02-27v4No1 / 9
392amnondominant digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, fishmeal diet2018-11-05v4No1 / 9
392amnondominant digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, defatted larvae insects diet2018-11-05v4No1 / 9
313amnonhigh freq. in rainbow trout gut content grown in 12C water (dominant digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, gut content, 12c, cold environment)2018-04-10v4No1 / 10
717amnondominant homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 11
777amnondominant homo sapiens, saliva, infant, sweden, municipality of umea, 3-month-old human stage2021-04-26v3No1 / 12
596amnondominant homo sapiens, saliva, child, sweden, 12-month-old human stage2020-03-17v3No1 / 12
827sheryoDominant in soil at 575cm depth in clayey till loam soil, Lund Denmark (dominant kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 550-600cm)2021-09-13v3No1 / 12
82amnonhigh freq. in dairy cow rumen fluid (dominant rumen, bos taurus, sweden)2017-03-05v4No1 / 12
669amnoncommon feces, homo sapiens, infant, sweden, 2-month-old human stage2020-09-26v4No1 / 12
578amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 12
313amnoncommon in rainbow trout gut mucosa grown in 12C water (common digestive system, research facility, gastrointestinal system mucosa, oncorhynchus mykiss, sweden, fish, rainbow trout, 12c, cold environment)2018-04-10v4No1 / 13
827sheryoDominant in soil at 465cm depth in clayey till loam soil, Lund Denmark (dominant kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 450-480cm)2021-09-13v3No1 / 13
392amnondominant digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, larvae insect diet2018-11-05v4No1 / 13
669amnondominant feces, homo sapiens, infant, sweden, 2-month-old human stage2020-09-26v4No1 / 13
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 13
596amnondominant homo sapiens, saliva, infant, child, sweden, 6-month-old human stage2020-03-17v3No1 / 14
596amnondominant homo sapiens, saliva, child, sweden, 2-year-old human stage2020-03-17v3No1 / 14
596amnondominant homo sapiens, saliva, child, sweden, 3-month-old human stage2020-03-17v3No1 / 14
313amnonhigh freq. in fishfeed (dominant sweden, fish feed)2018-04-10v4No1 / 14
494amnondominant research facility, colon, mus musculus, high fat diet, c57bl/6, male, sweden, mouse, western diet, charles river laboratories2019-02-27v4No1 / 14
777amnoncommon homo sapiens, saliva, infant, sweden, municipality of umea, 2-days-old human2021-04-26v3No1 / 15
827sheryoDominant in soil at 230cm depth in clayey till loam soil, Lund Denmark (dominant kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 200-260cm)2021-08-24v3No1 / 15
596amnondominant homo sapiens, saliva, child, sweden, 7-year-old human stage2020-03-17v3No1 / 15
596amnon high in 6-month-old human stage compared to 3-month-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 15
313amnonhigher in gut mucosa of fish grown in 12C compared to 18C water ( high in 12c cold environment compared to warm temperature habitat 18c in digestive system research facility gastrointestinal system mucosa oncorhynchus mykiss sweden fish rainbow trout )2018-04-10v4No1 / 15
494amnondominant research facility, colon, mus musculus, c57bl/6, male, sweden, mouse, mouse chow, charles river laboratories2019-02-27v4No1 / 15
392amnondominant digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre pupae insect diet2018-11-05v4No1 / 15
511amnondominant kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 15
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 18-month-old human stage2021-04-26v3No1 / 17
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 3-year-old human stage2021-04-26v3No1 / 17
387amnon high in winter compared to summer in feces sweden wild ursus arctos brown bear 2018-11-03v4No1 / 17
777amnoncommon homo sapiens, saliva, infant, sweden, municipality of umea, 3-month-old human stage2021-04-26v3No1 / 18
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 18-month-old human stage2021-04-26v3No1 / 18
777amnondominant homo sapiens, saliva, child, sweden, municipality of umea, 5-year-old human stage2021-04-26v3No1 / 18
387amnonhigh freq. in feces of wild brown bear (dominant feces, sweden, wild, ursus arctos, brown bear)2018-11-03v4No1 / 18
763amnondominant glacier, sweden, filtered 0.2um, ice, subsurface, depth 20-100cm2021-04-10v3No1 / 18
119amnondominant feces, research facility, mus musculus, sweden, mouse2017-04-12v4No1 / 18
763amnondominant glacier, surface, sweden, depth 0-20cm, filtered 0.2um, ice2021-04-10v3No1 / 19
578amnondominant feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 20
596amnoncommon homo sapiens, saliva, child, sweden, 3-month-old human stage2020-03-17v3No1 / 21
392amnon high in fishmeal diet compared to defatted larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 21
511amnon high in kingdom of norway sweden finland lapland compared to united states of america state of colorado in depth 0-5cm snow 2019-03-20v4No1 / 21
392amnon high in fishmeal diet compared to larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 23
669amnondominant feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 23
392amnon high in fishmeal diet compared to pre pupae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 24
511amnon high in united states of america state of colorado compared to kingdom of norway sweden finland lapland in depth 0-5cm snow 2019-03-20v4No1 / 24
578amnondominant feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 26
387amnoncommon in feces of wild brown bear (common feces, sweden, wild, ursus arctos, brown bear)2018-11-03v4No1 / 27
596amnon high in 2-year-old human stage compared to 7-year-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 28
313amnoncommon in rainbow trout gut content grown in 12C water (common digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, gut content, 12c, cold environment)2018-04-10v4No1 / 31
392amnon high in larvae insect diet compared to pre pupae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 32
578amnon high in control compared to hiv infection in feces homo sapiens adult kingdom of spain sweden gay homosexual msm male 2020-01-14v3No1 / 32
669amnon high in 14-days-old human compared to 12-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 33
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, fishmeal diet2018-11-05v4No1 / 34
596amnoncommon homo sapiens, saliva, infant, child, sweden, 6-month-old human stage2020-03-17v3No1 / 35
669amnoncommon feces, homo sapiens, infant, sweden, 12-month-old human stage2020-09-26v4No1 / 35
596amnoncommon homo sapiens, saliva, child, sweden, 12-month-old human stage2020-03-17v3No1 / 36
119amnonhigher in late timepoints (>4weeks) of worm infected mice ( high in parasitic helminthiasis infectious disease late timepoints trichuris muris compared to control in feces research facility mus musculus sweden mouse )2017-04-12v4No1 / 40
763amnon high in subsurface depth 20-100cm compared to surface depth 0-20cm in glacier sweden filtered 0.2um ice 2021-04-10v3No1 / 42
763amnon high in surface depth 0-20cm compared to subsurface depth 20-100cm in glacier sweden filtered 0.2um ice 2021-04-10v3No1 / 43
392amnon high in larvae insect diet compared to defatted larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 46
392amnon high in defatted larvae insect diet compared to larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 46
392amnon high in defatted larvae insect diet compared to pre pupae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 49
596amnon high in 7-year-old human stage compared to 2-year-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 50
392amnon high in larvae insect diet compared to fishmeal diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 51
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 53
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout gut content )2018-04-10v4No1 / 55
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, defatted larvae insects diet2018-11-05v4No1 / 55
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, larvae insect diet2018-11-05v4No1 / 55
578amnon high in sweden compared to kingdom of spain in feces homo sapiens hiv infection adult gay homosexual msm male 2020-01-14v3No1 / 55
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 56
596amnoncommon homo sapiens, saliva, child, sweden, 2-year-old human stage2020-03-17v3No1 / 57
392amnon high in defatted larvae insect diet compared to fishmeal diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 58
596amnoncommon homo sapiens, saliva, child, sweden, 7-year-old human stage2020-03-17v3No1 / 59
763amnonhigher in blank compared to samples (contamination)2021-04-10v3No1 / 70
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
763amnoncommon glacier, sweden, filtered 0.2um, ice, subsurface, depth 20-100cm2021-04-10v3No1 / 74
578amnoncommon feces, homo sapiens, hiv infection, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 74
596amnon high in under-1-year-old human stage compared to age 1-7 years 2-5 year-old child stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 78
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 18-month-old human stage2021-04-26v3No1 / 79
777amnon high in infant 3-month-old human stage compared to child 18-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 79
777amnon high in 3-year-old human stage compared to 5-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 81
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 5-year-old human stage2021-04-26v3No1 / 83
777amnon high in 18-month-old human stage compared to 3-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 83
494amnon high in diet high fat diet western diet compared to mouse chow in research facility colon mus musculus c57bl/6 male sweden mouse charles river laboratories 2019-02-27v4No1 / 85
777amnoncommon homo sapiens, saliva, child, sweden, municipality of umea, 3-year-old human stage2021-04-26v3No1 / 92
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, heterosexual, msw, male2020-01-14v3No1 / 92
763amnoncommon glacier, surface, sweden, depth 0-20cm, filtered 0.2um, ice2021-04-10v3No1 / 98
777amnon high in 2-days-old human compared to 3-month-old human stage in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 104
387amnon high in summer compared to winter in feces sweden wild ursus arctos brown bear 2018-11-03v4No1 / 110
777amnon high in 5-year-old human stage compared to 3-year-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 120
392amnon high in pre pupae insect diet compared to larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 125
392amnoncommon digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, pre-pupae insect diet2018-11-05v4No1 / 126
827sheryoHigher in soil depth of 275cm compared to soil depth of 60cm in clayey till loam soil, Lund Denmark ( high in depth 200-350cm compared to depth 20-120cm in kingdom of denmark agricultural field lund loam soil clayey till late weichselian glaciation )2021-09-13v3No1 / 129
578amnoncommon feces, homo sapiens, control, adult, kingdom of spain, sweden, gay, homosexual, msm, male2020-01-14v3No1 / 132
578amnon high in kingdom of spain compared to sweden in feces homo sapiens hiv infection adult gay homosexual msm male 2020-01-14v3No1 / 133
392amnon high in pre pupae insect diet compared to defatted larvae insect diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 134
827sheryoHigher in soil depth of 465cm compared to soil depth of 275cm in clayey till loam soil, Lund Denmark ( high in depth 450-600cm compared to depth 200-350cm in kingdom of denmark agricultural field lund loam soil clayey till late weichselian glaciation )2021-09-13v3No1 / 137
900amnon high in depth (water) 1m compared to depth (water) 5m in peatland lake sediment sweden depth (sediment) 0-20cm stordalen mire 2022-04-25v4No1 / 152
392amnon high in pre pupae insect diet compared to fishmeal diet in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout 2018-11-05v4No1 / 153
119amnonlower in late timepoints (>4weeks) of worm infected mice ( high in control compared to parasitic helminthiasis infectious disease late timepoints trichuris muris in feces research facility mus musculus sweden mouse )2017-04-12v4No1 / 155
494amnoncommon research facility, colon, mus musculus, high fat diet, c57bl/6, male, sweden, mouse, western diet, charles river laboratories2019-02-27v4No1 / 161
777amnon high in 3-year-old human stage compared to 18-month-old human stage in homo sapiens saliva child sweden municipality of umea 2021-04-26v3No1 / 184
777amnon high in 3-month-old human stage compared to 2-days-old human in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 197
827sheryoHigher in soil depth of 275cm compared to soil depth of 465cm in clayey till loam soil, Lund Denmark ( high in depth 200-350cm compared to depth 450-600cm in kingdom of denmark agricultural field lund loam soil clayey till late weichselian glaciation )2021-09-13v3No1 / 197
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
511amnoncommon kingdom of norway, sweden, finland, lapland, depth 0-5cm, snow2019-03-20v4No1 / 213
578amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 220
119amnoncommon feces, research facility, mus musculus, sweden, mouse2017-04-12v4No1 / 239
494amnoncommon research facility, colon, mus musculus, c57bl/6, male, sweden, mouse, mouse chow, charles river laboratories2019-02-27v4No1 / 275
596amnon high in age 1-7 years 2-5 year-old child stage compared to under-1-year-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 288
494amnon high in mouse chow compared to diet high fat diet western diet in research facility colon mus musculus c57bl/6 male sweden mouse charles river laboratories 2019-02-27v4No1 / 293
827sheryoHigher in soil depth of 60cm compared to soil depth of 275cm in clayey till loam soil, Lund Denmark ( high in depth 20-120cm compared to depth 200-350cm in kingdom of denmark agricultural field lund loam soil clayey till late weichselian glaciation )2021-09-13v3No1 / 295
827sheryoCommon in soil at 575cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 550-600cm)2021-09-13v3No1 / 318
900amnon high in depth (water) 5m compared to depth (water) 1m in peatland lake sediment sweden depth (sediment) 0-20cm stordalen mire 2022-04-25v4No1 / 385
578amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens hiv infection adult kingdom of spain sweden male )2020-01-14v3No1 / 519
777amnon high in child 18-month-old human stage compared to infant 3-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 583
827sheryoCommon in soil at 230cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 200-260cm)2021-08-24v3No1 / 644
900amnoncommon peatland, lake sediment, sweden, depth (water) 1m, depth (sediment) 0-20cm, stordalen mire2022-04-25v4No1 / 772
827sheryoCommon in soil at 465cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 450-480cm)2021-09-13v3No1 / 786
827sheryoCommon in soil at 325cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 300-350cm)2021-08-24v3No1 / 866
900amnoncommon peatland, lake sediment, sweden, depth (water) 5m, depth (sediment) 0-20cm, stordalen mire2022-04-25v4No1 / 884
827sheryoCommon in soil at 25cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, depth (soil) 20-30cm, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, plough layer )2021-08-24v3No1 / 1111
827sheryoCommon in soil at 95cm depth in clayey till loam soil, Lund Denmark (common kingdom of denmark, agricultural field, lund, loam soil, clayey till, late weichselian glaciation, depth 70-120cm, sandy till )2021-08-24v3No1 / 1142
82amnoncommon in dairy cow rumen fluid (common rumen, bos taurus, sweden)2017-03-05v4No1 / 1322

Problems / suggestions? Please email info AT dbbact DOT org