Summary for ontology term: taconic farms

Number of annotations with term: 20

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGATGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCTCGGGACTGCTTTGGAAACTGTATGGCTGGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.235294
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGTGCCAAGTCTGGTGTGAAAGGCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGGCATGCTGGAGTGCCGGAGGGGCAAGCGGAATTCCTAG0.235294
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__EnterorhabdusTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCGCCTAAGCGGGACCTCTAACCCCGGGGCTCAACCCCGGGCCGGGTCCCGGACTGGGCGGCTCGAGTGCGGTAGAGGAGAGCGGAATTCCCGGT0.235294
d__BacteriaTACGTAGGTGGCAAGCGTTGTTCGGAATAACTGGGCGTAAAGGATGCGTAGGCGGTTAAACAAGTTATATGTTAAATATATAGGCTTAACCTGTAGAAAGCATATAAAACTGTTTAACTAGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.235294
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGAACGCAGGCGGTCTTTTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGTAGTGCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.235294
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.235294
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGCCGGCAAGTCAGATGTGAAATCCCAAGGCTCAACCTTGGAACTGCATTTGAAACTGTTGGTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.235294
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGAGCAAGTCTGAAGTGAAAGCCCGCGGCCCAACTGCGGGACTGCTTTGGAAACTGCCCGGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.235294
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCTTTGCAAGTCTGATGTGAAAGGCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTAAAGCTAGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.235294
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCTGTGCAAGTCTGGAGTGAAAGGCGGGGGCCCAACCCCCGGACTGCTCTGGAAACTGTAAAGCTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.235294

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAGAGCAAGTCTGAAGTGAAAGCCCGCGGCTCAACTGCGGGACTGCTTTGGAAACTGTTCAACTGGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.800000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGGAGCAAGTCTGATGTGAAAATCCGGGGCCCAACCCCGGAACTGCATTGGAAACTGTTTATCTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.800000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Lachnospiracea_incertae_sedisTACGTATGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTACGGCAAGTCAGAAGTGAAAGCCTGGGGCTCAACCCCGGAATTGCTTTTGAAACTGTCGAACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.800000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGACTGTCAAGTCAGCGGTAAAATTGAGAGGCTCAACCTCTTCCCGCCGTTGAAACTGGTGGTCTTGAGTGGATGAGAAGTACGCGGAATGCGTGGT0.800000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTCCGTTAAGTCAGCGGTAAAATTGCGGGGCTCAACCCCGTCGAGCCGTTGAAACTGGCAGACTTGAGTTGGCGAGAAGTACGCGGAATGCGCGGT0.800000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGCGTAAAGGGAGCGCAGGCGGCGCGCCAAGTCTGATGTGAAACCCCGGGGCTCAACCCCGGGCATGCATTGGAAACTGGCGGGCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.800000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAGAGCAAGTCAGACGTGAAATTCCAGGGCTCAACCCTGGAACTGCGTTTGAAACTGTTCTTCTTGAGTGATGGAGAGGCAGGCGGAATTCCGTG0.800000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__EnterorhabdusTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCGCCTAAGCGGAACCTCTAACCCCGGGGCTCAACCTCGGGCCGGGTTCCGGACTGGGCGGCTCGAGTGCGGTAGAGGAGAGCGGAATTCCCGGT0.800000
d__BacteriaTACGTAGGTGACAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGATGTGCAAGTCAGTCGTGAAATACCGGGGCTCAACCCCGGGGCTGCGATTGAAACTGCACACCTTGAGTATCGGAGAGGAAAGCGGAATTCCTAG0.800000
d__BacteriaTACGTAGGAGGCAAGCGTTATCCGGAATGACTGGGCGTAAAGGGTGCGTAGGTGGTTTGACAAGTTGGTAGCGTAACTCCGGAGCTCAACTTCGGAACTACTACCAAAACTGTTGGACTCGAGTGCAGGAGGGGCAACTGGAATTTCTAG0.800000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__LactobacillaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGAACGCAGGCGGTCTTTTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGGAGTAGTGCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGCGGAACTCCATG0.615385
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGATGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCTCGGGACTGCTTTGGAAACTGTATGGCTGGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.580645
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGTGGCGTGCCAAGTCAGGAGTGAAAACCCAGGGCCCAACCCTGGGACTGCTCTTGAAACTGACAGGCTTGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.580645
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGTCGCAAGTCTGAAGTGAAAGCCCGTGGCTCAACTGCGGAACCGCTTTGGAAACTGCGTGGCTGGAGTGCTGGAGAGGTAAGCGGAATTCCTGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGGGCAAGCCAGAAGTGAAAACGCAGAGCTTAACTTTGCGACTGCTTTTGGAACTGCCCGGCTAGAGTACAGGAGAGGTAAGTGGAATTCCTAG0.500000
d__BacteriaTACGTAGGAGGCGAGCGTTATCCGGAATGACTGGGCGTAAAGGGTGCGTAGGTGGTTTGACAAGTTGGTAGCGTAACTCCGAGGCTCAACCTCGGCACTACTACCAAAACTGTCGGACTTGAGTGCAGGAGGGGCAATTGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGGAGCAAGTCTGAAGTGAAAGCCCCGGGCTTAACCCGGGAACTGCTTTGGAAACTGTACTGCTGGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCTTTGCAAGTCTGATGTGAAAGGCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTAAAGCTAGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__AcetanaerobacteriumTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAAGGCAAGTTGAATGTTAAATCTACCGGCTCAACCGGTAGCCGCGTTCAAAACTGTTTTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAGT0.484848
d__BacteriaTACGTAGGAGGCAAGCGTTATCCGGAATGACTGGGCGTAAAGGGTGCGTAGGTGGTTTGACAAGTTGGTAGCGTAATTCCGAGGCTCAACCTCGGCGCTACTACCAAAACTGTCGGACTTGAGTGCAGGAGGGGCAAATGGAATTCCTAG0.482759

Annotations:

common ontology terms
term enrichment score
TermScore
taconic farms0.774194
age 8 weeks0.380952
colon0.285714
LOWER IN taconic farms0.285714
terminal ileum0.250000
LOWER IN jackson laboratories0.250000
jackson laboratories0.250000
right colon0.222222
cba/caj0.166667
strain 129s0.166667
c57bl/60.103896
mouse0.100000
ileum0.100000
mus musculus0.090909
LOWER IN colon0.086957
LOWER IN terminal ileum0.083333
LOWER IN right colon0.080000
canada0.076190
LOWER IN ileum0.055556
research facility0.040000
female0.027397
feces0.018750
united states of america0.007782
LOWER IN feces0.006173
Fraction of dbbact annotations with this term covered by the query
TermScore
taconic farms0.750000
cba/caj0.500000
LOWER IN taconic farms0.500000
strain 129s0.500000
colon0.333333
LOWER IN colon0.333333
LOWER IN jackson laboratories0.333333
jackson laboratories0.333333
age 8 weeks0.250000
LOWER IN terminal ileum0.250000
terminal ileum0.250000
right colon0.200000
LOWER IN right colon0.200000
LOWER IN ileum0.062500
ileum0.062500
c57bl/60.055556
mouse0.052632
mus musculus0.047619
canada0.040000
research facility0.020408
female0.015873
feces0.009554
united states of america0.004049
LOWER IN feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
research facility1.000000
mus musculus1.000000
mouse1.000000
c57bl/60.800000
canada0.800000
taconic farms0.800000
age 8 weeks0.800000
feces0.500000
colon0.250000
right colon0.250000
ileum0.250000
terminal ileum0.250000
LOWER IN jackson laboratories0.200000
jackson laboratories0.200000
LOWER IN taconic farms0.200000
LOWER IN feces0.100000
female0.100000
cba/caj0.100000
united states of america0.100000
strain 129s0.100000
LOWER IN colon0.050000
LOWER IN right colon0.050000
LOWER IN ileum0.050000
LOWER IN terminal ileum0.050000
Exp. ID User ID Description Date Region Flag Sequences
538amnondominant feces, research facility, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 11
538amnondominant research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 17
538amnondominant research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 18
188amnondominant feces, female, research facility, mus musculus, cba/caj, mouse, taconic farms2017-10-25v4No1 / 20
538amnon high in feces compared to ileum terminal ileum in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 23
538amnon high in feces compared to colon right colon in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 27
538amnon high in ileum terminal ileum compared to feces in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 41
538amnon high in colon right colon compared to feces in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 51
538amnon high in taconic farms compared to jackson laboratories in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 104
538amnon high in taconic farms compared to jackson laboratories in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 108
538amnon high in jackson laboratories compared to taconic farms in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 110
538amnoncommon feces, research facility, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 120
538amnoncommon research facility, colon, right colon, mus musculus, c57bl/6, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 130
538amnoncommon research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 132
538amnon high in taconic farms compared to jackson laboratories in feces research facility mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 135
538amnon high in jackson laboratories compared to taconic farms in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 154
538amnon high in jackson laboratories compared to taconic farms in research facility colon right colon mus musculus c57bl/6 canada mouse age 8 weeks 2019-07-29v4No1 / 172
214amnonhigher in mice from jackson laboratories compared to taconic farms ( high in jackson laboratories compared to taconic farms in feces united states of america research facility mus musculus mouse strain 129s )2017-10-23v4No1 / 181
188amnoncommon feces, female, research facility, mus musculus, cba/caj, mouse, taconic farms2017-10-25v4No1 / 185
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in feces united states of america research facility mus musculus mouse strain 129s )2017-10-23v4No1 / 232

Problems / suggestions? Please email info AT dbbact DOT org