Summary for ontology term: tenth decade human stage

Number of annotations with term: 6

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGATTGGCAAGTCAGTAGTGAAATCCATGGGCTTAACCCATGACGTGCTATTGAAACTGTTGATCTTGAGTGAAGTAGAGGTAAGCGGAATTCCCGG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGATGTAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTATGTAACTAGAGTGTCGGAGAGGCAAGTGGAATTCCCAG0.400000
d__Bacteria;p__FirmicutesTACGTAGATGGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGTGTAGGCGGGATCATAAGTTGCGTGTGAAATGCAGGGGCTCAACCCCTGAACTGCGCGCAAAACTGTGGTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCCGG0.400000
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCGTACTAAGTCTGTAGTAAAAGGCAATGGCTCAACCATTGTAAGCTATGGAAACTGGTAGGCTAGAGTGCAGAAGAGGGCGATGGAATTCCATGT0.400000
d__Bacteria;p__Firmicutes;c__ClostridiaTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGGCTGTCAAGTCAGATGTGAAATACCGGGGCTCAACTCCGGGGCTGCATTTGAAACTGATGGTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGGTCTCAAGTCGAATGTTAAATCTACCGGCTCAACTGGTAGCTGCGTTCGAAACTGGGGCTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAGT0.400000
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGAGCGTAGGCGGTCGATTAAGTTAGATGTGAAACCCCCGGGCTTAACTTGGGGACTGCATCTAATACTGGTTGACTTAGAGTACAGGAGAGGGAAGCGGAATTCCTA0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCATGATAAGTCTGATGTGAAAACCCAAGGCTCAACCATGGGACTGCATTGGAAACTGTCGTGCTGGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTTTTAAGTGAGATGTGAAATACTCGGGCTTAACCTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAAGGGAATTCCTAG0.400000
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGACTGGGCGTAAAGGGCGTGTAGGCGGCCGATTAAGTGTGGAGTGAAAGTCCTGCTTTTAAGGTGGGAATTGCTTTGCAGACTGGTTGGCTTGAGTGCGGAAGAGGTAAGTGGAATTCCCAG0.400000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTTAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGCGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGAATGGCTTTGGAAACTGTGCGGCTAGAGTACCGGAGGGGTAAGCGGAATTCCTAG0.666667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGACGGGAGATTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGTTTCCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVbTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGCATGGTAAGTAAGATGTGAAAGCCCGAGGCTTAACCTCGAGGATTGCATTTTAAACTATCAAGCTAGAGTACAGGAGAGGAAAGCGGAATTCCTA0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGTGCGCAAGTCAGATGTGAAATCTCAGGGCTCAACCCTGAAACTGCATTTGAAACTGTGCATCTTGAGTGCCGGAGAGGTAATCGGAATTCCTTG0.666667
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAACGCAGGCGGTCTTTTAAGTCTGATGTGAAAGCCTTCGGCTTAACCGAAGTAGTGCATTGGAAACTGGAAGACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.666667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCCGTCCTTTAAGCGTGCTGTGAAATGCCGCGGCTCAACCGTGGCACTGCAGCGCGAACTGGAGGACTTGAGTACGCACGAGGTAGGCGGAATTCGTGG0.666667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGACGGGTTTTTAAGTCAGCTGTGAAAGTTTGGGGCTCAACCTTAAAATTGCAGTTGAAACTGGAGACCTTGAGTACGGTTGAGGCAGGCGGAATTCGTGG0.666667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACATCTGAACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.666667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.666667

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGTGGTAACTTAAGCGCGGGGTTTAAGGCAATGGCTTAACTATTGTTCGCCCTGCGAACTGGGATACTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.500000
d__BacteriaTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGCGCTTAAGTCAGTGGTGAAATACCGGAGCTTAACTCCGGGGCTGCCATTGAAACTGGGTGTCTTGAGTGCGGGAGAGGAAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerTACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAGATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__AnaerofilumTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGAACTGCAAGTTGGATGTCAAATCTACGGGCTCAACCCGTATACGCATTCAAAACTGCGGTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGGT0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGATCGTAAGTTGGGAGTGAAATTCATGGGCTCAACCCATGACCTGCTTTCAAAACTGCGATTCTTGAGTGGTGTAGAGGTAGGCGGAATTCCCGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACCATAGGCTCAACCTATGGATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.444444
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTTGTTGTTTAAGTCCGCGGTGAAAGTTTGTGGCTCAACCATAAAATTGCCGTTGAAACTGAATGACTTGAGTGTATTTGATGTAGGCGGAATGCGTGG0.444444
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCGCTCAAGCGGGACCTCTAATCCCGGGGCTCAACCCCGGGCCGGGTCCCGAACTGGGCGGCTCGAGTCAGGTAGAGGCAGGCGGAATTCCCGGT0.444444
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCGCGCCAAGCGGGACCTCTAACCCCGGGGCTCAACCCCGGGCCGGGTCCCGGACTGGCGCGCTCGAGTGCGGTAGAGGCGAGTGGAATTCCCGGT0.444444
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Carnobacteriaceae;g__AtopostipesTACGTAGGTGACGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGCGGTTGGAACAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAAGGTCATTGGAAACTGTCCAACTTGAATACAGAAGAGGTAAGTGGAATTCCATG0.444444

Annotations:

common ontology terms

Problems / suggestions? Please email info AT dbbact DOT org