Summary for ontology term: terminal ileum

Number of annotations with term: 16

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGGGCAAGTCTGATGTGAAAGGTCGGGGCCCAACCCCGGGACTGCATTGGAAACTGTCCGGCTGGAGTACAGGAGAGGTAAGTGGAATTCCTAG0.133333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGCTGACAAGTCAGATGTGAAATCCGGGGGCTCAACCCCCGAACTGCATTTGAAACTGTTGGTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.133333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAAAGCAAGTTGAATGTTTAAGGTACGGGCTCAACCTGTACAAGCGTTCAAAACTGTTTTTCTTGAGTGGAGTAGAGGTAAGCGGAATTCCTAGT0.133333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGCCGGGCTGACAAGTCAGATGTGAAATTCCGGGGCTCAACCCCGGACCTGCATTTGAAACTGTTGGTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.133333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGAAAGTCTGAAGTGAAAGCCCGCGGCTCAACCGCGGAATGGCTTTGGAAACTTTTTTGCTGGAGTACCGGAGAGGTAAGCGGAATTCCTAG0.133333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.133333
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGTTTATAAGTCAGATGTGAAATCCCGCGGCTCAACCGCGGAACTGCATTTGAAACTGTAGATCTTGAGTACTGGAGAGGCAGGCGGAATTCCTAG0.133333
d__BacteriaTACGTAGGAGGCAAGCGTTATCCGGAATGACTGGGCGTAAAGGGTGCGTAGGTGGTTTGGCAAGTTAGTAGCGTAACTCCGGAGCTCAACTTCGGAACTACTACTAAAACTGTCGGACTTGAGTGCAGGAGGGGCAACTGGAATTCCTAG0.133333
d__BacteriaTACGATTAACCCAAACTAATTATCTTCGGCGTAAAACGTGTCAACTATAAATAAATAGAATTAAAATCCAACTTATATGTGAAAATTCATTGTTAGGACCTAAACTCAATAACGAAAGTAATTCTAGTCATTTATAATACACGACAGCTA0.133333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGAGTGCAAGTCAGATGTGAAATCCCGCGGCTCAACCGCGGAACTGCATTTGAAACTGTGCTTCTTGAGTGCTGGAGAGGCAGACGGAATTCCTAG0.133333

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__EnterorhabdusTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCGCCTAAGCGGGACCTCTAACCCCGGGGCTCAACCCCGGGCCGGGTCCCGGACTGGGCGGCTCGAGTGCGGTAGAGGAGAGCGGAATTCCCGGT0.666667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGGATGCCAAGTCAGCGGTAAAAAAGCGGTGCTCAACGCCGTCGAGCCGTTGAAACTGGCGTTCTTGAGTGGGCGAGAAGTATGCGGAATGCGTGGT0.666667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCCTGCCAAGTCAGCGGTAAAATTGCGGGGCTCAACCCCGTACAGCCGTTGAAACTGCCGGGCTCGAGTGGGCGAGAAGTATGCGGAATGCGTGGT0.666667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACTTTTAAGTGAGATGTGAAATACTCGGGCTCAACTTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAATGGAATTCCTAG0.666667
d__BacteriaGACGGGGGGGGCAAGTGTTCTTCGGAATGACTGGGCGTAAAGGGCACGTAGGCGGTGAATCGGGTTGAAAGTGAAAGTCGCCAAAAAGTGGCGGAATGCTCTCGAAACCAATTCACTTGAGTGAGACAGAGGAGAGTGGAATTTCGTGTG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGAGCGTAGACGGATCTGCAAGTCTGATGTGAAAGGCGGGGGCTCAACTCCTGGACTGCATTGGAAACTGTAGATCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGAGCGTAGACGGATGTGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTAAATCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.666667
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCGGTTCAATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGGAGAATTGCATCAGAAACTGTTGAACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.333333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTGCTTAGGTCTGATGTGAAAGCCTTCGGCTTAACCGAAGAAGTGCATCGGAAACCGGGCGACTTGAGTGCAGAAGAGGACAGTGGAACTCCATG0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaTACGATTAACCCAAACTAATTATCTTCGGCGTAAAACGTGTCAACTATAAATAAATAAATAGAATTAAAATCCAACTTATATGTGAAAATTCATTGTTAGGACCTAAACTCAATAACGAAAGTAATTCTAGTCATTTATAATACACGACC0.461538
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGATGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCTCGGGACTGCTTTGGAAACTGTATGGCTGGAGTGCTGGAGAGGCAAGCGGAATTCCTAG0.275862
d__BacteriaTACGTAGGGAGCAAGCGTTGTTCGGAATGACTGGGCGTAAAGGGTGCGTAGGCGGTTGTACAAGTTAGAAGTGAAATACCCAGGGCTTAACTCGGGTGCTGCTTCTAAAACTGTATGACTTGAGTGCAGTAGAGGTTAGTGGAATTCCTC0.272727
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGGGCAAGCCAGAAGTGAAAACGCAGAGCTTAACTTTGCGACTGCTTTTGGAACTGCCCGGCTAGAGTACAGGAGAGGTAAGTGGAATTCCTAG0.272727
d__Bacteria;p__FirmicutesTACGTAGGGGGCGAGCGTTGTCCGGAATGACTGGGCGTAAAGGGAGTGTAGGCGGCATATTAAGTTATGTGTGAAAGCCCGCGGCTCAACCGCGGAATTGCACATAAAACTGGTAAGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCCGG0.216216
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAAAGCAAGTCGAATGTTTAAGGTACGGGCTCAACCTGTACAAGCGTTCAAAACTGTTTTTCTTGAGTGGAGTAGAGGTAAGCGGAATTCCTAGT0.210526
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGTGGCGTGCCAAGTCAGGAGTGAAAACCCAGGGCCCAACCCTGGGACTGCTCTTGAAACTGACAGGCTTGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.206897
d__BacteriaTACGTAGGAGGCGAGCGTTATCCGGAATGACTGGGCGTAAAGGGTGCGTAGGTGGTTTGACAAGTTGGTAGCGTAACTCCGAGGCTCAACCTCGGCACTACTACCAAAACTGTCGGACTTGAGTGCAGGAGGGGCAATTGGAATTCCTAG0.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AcetatifactorTACGTAGGGGGCGAGCGTTATCCGGATTCACTGGGTGTAAAGGGAGCGTAGACGGCCAAGCAAGCCAGGGGTGAAAGCCCGGGGCCCAACCCCGGGACTGCCCTTGGAACTGCTTGGCTGGAGTGCGGGAGGGGCAGGCGGAATTCCTGG0.200000
d__BacteriaTACGATTAACCCAAACTAATTATCTTCGGCGTAAAACGTGTCAACTATAAATAAATAGAATTAAAATCCAACTTATATGTGAAAATTCATTGTTAGGACCTAAACTCAATAACGAAAGTAATTCTAGTCATTTATAATACACGACAGCTA0.200000

Annotations:

common ontology terms
term enrichment score
TermScore
terminal ileum0.807692
sigmoid colon0.428571
age 8 weeks0.357143
children0.333333
biopsy0.300000
colon0.285714
taconic farms0.277778
jackson laboratories0.217391
LOWER IN terminal ileum0.166667
rectum0.133333
crohn's disease0.117647
LOWER IN crohn's disease0.117647
ileum0.111111
c57bl/60.102041
LOWER IN taconic farms0.100000
LOWER IN jackson laboratories0.090909
LOWER IN ileum0.083333
canada0.075188
germany0.054054
caecum0.050000
mouse0.034130
mus musculus0.030960
homo sapiens0.014475
research facility0.013459
LOWER IN control0.009950
control0.009950
united states of america0.007968
feces0.006211
LOWER IN feces0.006211
Fraction of dbbact annotations with this term covered by the query
TermScore
crohn's disease1.000000
LOWER IN crohn's disease1.000000
terminal ileum0.750000
sigmoid colon0.500000
children0.500000
colon0.333333
biopsy0.250000
LOWER IN terminal ileum0.250000
age 8 weeks0.250000
taconic farms0.250000
LOWER IN taconic farms0.250000
jackson laboratories0.166667
LOWER IN jackson laboratories0.166667
rectum0.090909
LOWER IN ileum0.062500
ileum0.062500
c57bl/60.055556
canada0.040000
germany0.034483
caecum0.027778
mouse0.017544
mus musculus0.015873
homo sapiens0.007380
research facility0.006803
LOWER IN control0.005405
control0.005405
united states of america0.004049
feces0.003185
LOWER IN feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
terminal ileum0.875000
research facility0.625000
mus musculus0.625000
c57bl/60.625000
canada0.625000
mouse0.625000
age 8 weeks0.625000
ileum0.500000
homo sapiens0.375000
sigmoid colon0.375000
biopsy0.375000
jackson laboratories0.312500
taconic farms0.312500
united states of america0.250000
rectum0.250000
caecum0.250000
colon0.250000
children0.250000
germany0.125000
feces0.125000
LOWER IN ileum0.125000
LOWER IN terminal ileum0.125000
LOWER IN feces0.125000
LOWER IN jackson laboratories0.062500
LOWER IN taconic farms0.062500
crohn's disease0.062500
LOWER IN control0.062500
control0.062500
LOWER IN crohn's disease0.062500
Exp. ID User ID Description Date Region Flag Sequences
19amnonhigh freq in biopsies of children (IBD study) (dominant homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 16
538amnondominant research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 18
538amnondominant research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 22
538amnon high in feces compared to ileum terminal ileum in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 23
714amnondominant homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 25
538amnon high in feces compared to ileum terminal ileum in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 25
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 34
714amnoncommon homo sapiens, sigmoid colon, terminal ileum, biopsy, germany2028-05-21v3No1 / 40
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
538amnon high in ileum terminal ileum compared to feces in research facility mus musculus c57bl/6 canada mouse taconic farms age 8 weeks 2019-07-29v4No1 / 41
538amnon high in taconic farms compared to jackson laboratories in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 104
538amnon high in ileum terminal ileum compared to feces in research facility mus musculus c57bl/6 canada mouse jackson laboratories age 8 weeks 2019-07-29v4No1 / 119
538amnoncommon research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, taconic farms, age 8 weeks2019-07-30v4No1 / 132
538amnon high in jackson laboratories compared to taconic farms in research facility ileum mus musculus c57bl/6 terminal ileum canada mouse age 8 weeks 2019-07-29v4No1 / 154
538amnoncommon research facility, ileum, mus musculus, c57bl/6, terminal ileum, canada, mouse, jackson laboratories, age 8 weeks2019-07-30v4No1 / 182
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459

Problems / suggestions? Please email info AT dbbact DOT org