Summary for ontology term: thailand

Number of annotations with term: 28

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGCTATTTAAGTGAGGTGTGAAATCCCCGGGCTTAACCTGGGAATTGCATTTCAGACTGGGTAGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.037037
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGCCTGCATTTGAAACTGTAGTTCTTGAGTGGTGGAGAGGCAAATGGAATTCCTAG0.037037
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTCAAGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTTTGACTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.037037
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTCAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.037037
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGTGTAGGTGGCCATGCAAGTCAGAAGTGAAAATCCGGGGCTCAACCCCGGAACTGCTTTTGAAACTGTGAGGCTAGAGTGCAGGAGGGGTGAGTGGAATTCCTAG0.037037
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGATGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGGACTGCAAGTTGGATGTGAAATACCGTGGCTTAACCACGGAACTGCATCCAAAACTGTAGTTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCGAG0.037037
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGAAAGCAAGTTGGAAGTGAAATGCATGGGCTCAACCCATGAGCTGCTTTCAAAACTGTTTTTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAG0.037037
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAATCCATGGGCTCAACCCGTGAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.037037
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAATGGCAAGTCTGATGTGAAAGGCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGCCAATCTAGAGTACCGGAGGGGTAAGTGGAATTCCTAG0.037037
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTAAGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTTTGGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.037037

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTCCCAAGTCCCTCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGAAGGAAACTGGGAAGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.333333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATAGGCAAGTCTGGAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGCAGATCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.333333
d__Bacteria;p__FirmicutesTACGTAGGTGGCAAGCGTTATCCGGAATCATTGGGCGTAAAGGGTGCGTAGGTGGCGTACTAAGTCTGTAGTAAAAGGCAATGGCTCAACCATTGTAAGCTATGGAAACTGGTAGGCTAGAGTGCAGAAGAGGGCGATGGAATTCCATGT0.333333
d__BacteriaTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGTGCGTAGGCGGCGAGATAAGTCTGAGGTAAAAGCCCGTGGCTCAACCACGGTAAGCCTTGGAAACTGTCTGGCTGGAGTGCAGGAGAGGACAATGGAATTCCATGT0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGATAGGCAAGTCTGGAGTGAAAACCCAGGGCTCAACCTTGGGACTGCTTTGGAAACTGCAGATCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.333333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCTGTTTTTTAAGTTAGAGGTGAAAGCTCGACGCTCAACGTCGAAATTGCCTCTGATACTGAGAGACTAGAGTGTAGTTGCGGAAGGCGGAATGTGTGG0.333333
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__AkkermansiaTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCGGTTTCGTAAGTCGTGTGTGAAAGGCGGGGGCTCAACCCCCGGACTGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG0.333333
d__Bacteria;p__Firmicutes;c__ClostridiaTACGTAGGGAGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGGCTGTCAAGTCAGATGTGAAATACCGGGGCTCAACTCCGGGGCTGCATTTGAAACTGATGGTCTTGAGTGAAGTAGAGGCAGGCGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGTGCGTAGGTGGTAACTTAAGCGCGGGGTTTAAGGCAATGGCTTAACCATTGTTCGCCCTGCGAACTGGGATACTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rickettsiales;f__Anaplasmataceae;g__EhrlichiaTACGGAGGGGGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCACGTAGGTGGACTAGTAAGTTAAAAGTGAAATACCAAAGCTTAACTTTGGAGCGGCTTTTAATACTGCTAGACTAGAGGTCGAAAGAGGATAGCGGAATTCCTAG0.193548
d__BacteriaTACATAGGTCGCAAGCATTATTCGGATTTATTGGGCGTAAAGCAAGCGCAGGCGGATGTGTAAGTTCTGTGTTAAATGCAGCTACTCAATAGTTGTATGCACCGAATACTACATGTCTAGATTGTGGTAGGGAGTTTCGGAATTAAGCAT0.193548
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__SpongiimonasTGAGGAATATTGGTCAATGGAGGGAACTCTGAACCAGCCATCCCGCGTGTAGGAAGACGGCCTTATGGGTTGTAAACTACTTTTATACAGGAAGAAACGTACCCTCGTGAGGGTGCCTGACGGTACTGTAGGAATAAGCACCGGCTAACT0.193548
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Alteromonadales;f__Pseudoalteromonadaceae;g__PseudoalteromonasTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGTAAGGAGGAAAGGTTAGTAGTTAATACCTGCTAGCTGTGACGTTACTTACAGAAGAAGCACCGGC0.193548
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TGAGGAATATTGGTCAATGGGCGATAGCCTGAACCAGCCAAGTCGCGTGAGGGAAGACTGCCCTATGGGTTGTAAACCTCTTTTGTAAGTGGAGAATAAGCGTTACGTGTAGCGCGATGACTGTAACTTACGAATAAGCATCGGCTAACT0.193548
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Vibrionales";f__Vibrionaceae;g__VibrioTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTGTGAAGAAGGCCTTCGGGTTGTAAAGCACTTTCAGTTGTGAGGAAGGTGGTGTCGTTAATAGCGGCATCATTTGACGTTAGCAACAGAAGAAGCACCGGC0.187500
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Vibrionales";f__VibrionaceaeTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCCATGCCGCGTGTATGAAGAAGGCCTTCGGGTTGTAAAGTACTTTCAGCAGTGAGGAAGGCGGAGTCGTTAATAGCGGCCTCGTTTGACGTTAGCTGCAGAAGAAGCACCGGC0.181818
d__BacteriaTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGAGAGTAGGCGGTTTAGAAAGTGTAAAGTAAAAGGCTAGTGCTCAACGCTGGTATGCTTTACAAACTAATAGACTAGAGTACAGGAGAGGTTAACGGAATTCCATGT0.166667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__ParabacteroidesTGAGGAATATTGGTCAATGGCCGAGAGGCTGAACCAGCCAAGTCGCGTGAAGGATGAAGGATCTATGGTTTGTAAACTTCTTTTATAGGGGAATAAAGTGTGGGACGTGTTCCATTTTGTATGTACCCTATGAATAAGCATCGGCTAACT0.162162
d__BacteriaTACGTAGGTGGCAAGCGTTGTCCGGAATGACTGGGCGTAAAGGGTGCGTAGGTGGCTATTCAAGTTAGCGGTGAAATCCCGGGGCTCAACTCCGGTGCTACCACTAATACTGTTTAGCTTGAGTACGGGAGAGGTAACTGGAATTCCTAG0.153846

Annotations:

common ontology terms
term enrichment score
TermScore
thailand0.962963
blood0.300000
bangkok0.300000
semi domestic dog0.300000
penaeus monodon0.222222
black tiger shrimp0.222222
rural community0.180180
hmong0.176471
myanmar0.176471
karen0.176471
broiler chicken0.142857
saen thong subdistrict0.133333
elephas maximus0.117647
asian elephant0.117647
village0.117647
LOWER IN thailand0.117647
pathogen0.089552
chicken0.086957
human late adulthood stage0.083333
gallus gallus0.083333
dog0.072289
ehrlichiosis0.066667
ehrlichia canis0.066667
mycoplasma haemocanis0.066667
anaplasmosis0.066667
anaplasma platys0.066667
increased weight0.066667
top weight group0.066667
LOWER IN decreased weight0.066667
LOWER IN bottom weight group0.066667
decreased weight0.066667
bottom weight group0.066667
LOWER IN increased weight0.066667
LOWER IN top weight group0.066667
LOWER IN myanmar0.066667
LOWER IN karen0.066667
LOWER IN hmong0.066667
canis lupus familiaris0.065217
viet nam0.064516
LOWER IN viet nam0.064516
intestine0.062500
captive0.062500
low bmi0.054054
LOWER IN low bmi0.054054
LOWER IN rural community0.051282
LOWER IN high bmi0.048780
high bmi0.048780
farm0.046512
female0.028571
feces0.024983
adult0.022222
homo sapiens0.014510
china0.011029
LOWER IN china0.010000
LOWER IN united states of america0.007273
united states of america0.007273
Fraction of dbbact annotations with this term covered by the query
TermScore
thailand1.000000
saen thong subdistrict1.000000
blood0.500000
ehrlichiosis0.500000
bangkok0.500000
semi domestic dog0.500000
ehrlichia canis0.500000
mycoplasma haemocanis0.500000
anaplasmosis0.500000
anaplasma platys0.500000
increased weight0.500000
top weight group0.500000
LOWER IN decreased weight0.500000
LOWER IN bottom weight group0.500000
penaeus monodon0.500000
black tiger shrimp0.500000
decreased weight0.500000
bottom weight group0.500000
LOWER IN increased weight0.500000
LOWER IN top weight group0.500000
hmong0.500000
LOWER IN myanmar0.500000
LOWER IN karen0.500000
myanmar0.500000
karen0.500000
LOWER IN hmong0.500000
elephas maximus0.333333
asian elephant0.333333
village0.333333
viet nam0.333333
LOWER IN thailand0.333333
LOWER IN viet nam0.333333
rural community0.181818
broiler chicken0.142857
low bmi0.111111
LOWER IN low bmi0.111111
human late adulthood stage0.100000
LOWER IN rural community0.090909
pathogen0.076923
LOWER IN high bmi0.076923
high bmi0.076923
chicken0.062500
gallus gallus0.058824
captive0.055556
dog0.043478
intestine0.040000
canis lupus familiaris0.038462
farm0.027778
female0.015873
feces0.012739
adult0.011561
homo sapiens0.007380
china0.005814
LOWER IN china0.005814
LOWER IN united states of america0.004049
united states of america0.004049
Fraction of annotations for the query sequences containing the term
TermScore
thailand0.928571
feces0.642857
homo sapiens0.428571
adult0.285714
canis lupus familiaris0.214286
dog0.214286
blood0.214286
bangkok0.214286
semi domestic dog0.214286
rural community0.178571
farm0.142857
intestine0.142857
penaeus monodon0.142857
black tiger shrimp0.142857
gallus gallus0.142857
chicken0.142857
broiler chicken0.142857
female0.142857
pathogen0.107143
hmong0.107143
china0.107143
myanmar0.107143
karen0.107143
captive0.071429
elephas maximus0.071429
asian elephant0.071429
village0.071429
saen thong subdistrict0.071429
human late adulthood stage0.071429
LOWER IN thailand0.071429
ehrlichiosis0.035714
ehrlichia canis0.035714
mycoplasma haemocanis0.035714
anaplasmosis0.035714
anaplasma platys0.035714
contamination0.035714
increased weight0.035714
top weight group0.035714
LOWER IN decreased weight0.035714
LOWER IN bottom weight group0.035714
decreased weight0.035714
bottom weight group0.035714
LOWER IN increased weight0.035714
LOWER IN top weight group0.035714
viet nam0.035714
LOWER IN viet nam0.035714
low bmi0.035714
LOWER IN high bmi0.035714
high bmi0.035714
LOWER IN low bmi0.035714
LOWER IN united states of america0.035714
united states of america0.035714
LOWER IN rural community0.035714
LOWER IN myanmar0.035714
LOWER IN karen0.035714
LOWER IN hmong0.035714
LOWER IN china0.035714
Exp. ID User ID Description Date Region Flag Sequences
664amnoncausitive bacteria for ehrlichiosis (other pathogen, canis lupus familiaris, thailand, dog, blood, ehrlichiosis, bangkok, semi domestic dog, ehrlichia canis)2020-09-22v4No1 / 1
664amnondog blood mycoplasma (other pathogen, canis lupus familiaris, thailand, dog, blood, bangkok, semi domestic dog, mycoplasma haemocanis)2020-09-22v4No1 / 1
664amnonanaplasmosis causing pathogen (other pathogen, canis lupus familiaris, thailand, dog, blood, anaplasmosis, bangkok, semi domestic dog, anaplasma platys)2020-09-22v4No1 / 1
664amnoncandidate contaminant in low biomass blood samples (contamination)2020-09-23v4No1 / 2
664amnondominant canis lupus familiaris, thailand, dog, blood, bangkok, semi domestic dog2020-09-22v4No1 / 6
400amnonpositively correlated with bmi ( high in high bmi compared to low bmi in feces homo sapiens adult thailand )2018-11-18v4No1 / 6
778amnon high in increased weight top weight group compared to decreased weight bottom weight group in farm intestine thailand penaeus monodon black tiger shrimp 2021-04-28v3No1 / 9
664amnoncommon canis lupus familiaris, thailand, dog, blood, bangkok, semi domestic dog2020-09-22v4No1 / 11
633amnondominant feces, thailand, captive, elephas maximus, asian elephant2020-06-16v4No1 / 11
400amnonhigh freq. in hmong (chinese) females from thailand (dominant feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 13
400amnonhigh freq. in karen (burma) females from thailand (dominant feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 14
778amnondominant farm, intestine, thailand, penaeus monodon, black tiger shrimp2021-04-28v3No1 / 15
875amnondominant feces, homo sapiens, adult, thailand, rural community, village, saen thong subdistrict, human late adulthood stage2022-03-04v3No1 / 18
568amnondominant feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 23
778amnoncommon farm, intestine, thailand, penaeus monodon, black tiger shrimp2021-04-28v3No1 / 25
778amnon high in decreased weight bottom weight group compared to increased weight top weight group in farm intestine thailand penaeus monodon black tiger shrimp 2021-04-28v3No1 / 40
875amnoncommon feces, homo sapiens, adult, thailand, rural community, village, saen thong subdistrict, human late adulthood stage2022-03-04v3No1 / 65
400amnonnegatively correlated with bmi ( high in low bmi compared to high bmi in feces homo sapiens adult thailand )2018-11-18v4No1 / 70
400amnoncommon in hmong (chinese) females from thailand (common feces, homo sapiens, female, adult, thailand, hmong, china)2018-11-18v4No1 / 95
568amnon high in viet nam compared to thailand in feces gallus gallus chicken broiler chicken 2019-12-08v3No1 / 119
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to myanmar karen in feces homo sapiens thailand rural community )2018-11-18v4No1 / 135
568amnon high in thailand compared to viet nam in feces gallus gallus chicken broiler chicken 2019-12-08v3No1 / 206
568amnoncommon feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 320
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in myanmar karen compared to hmong china in feces homo sapiens thailand rural community )2018-11-18v4No1 / 329
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in feces homo sapiens )2018-11-18v4No1 / 378
633amnoncommon feces, thailand, captive, elephas maximus, asian elephant2020-06-16v4No1 / 591

Problems / suggestions? Please email info AT dbbact DOT org