Summary for ontology term: trachemys scripta elegans

Number of annotations with term: 4

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGTCTTTTAAGTCAGCGTTGAAAGTTTGCGGCTCAACCGTAAAATTGGCATTGAAACTGGAAGACTTGAGTGTAAATGAAGTAGGCGGAATTCGTTG0.444444
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGTAAACAAGTCAGATGTGAAATACCGAGGCTCAACTTCGGGGCTGCATTTGAAACTGTATATCTTGAGTGTCGGAGAGGAAAGCGGAATTCCTAG0.444444
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAATGTAAGTCAGATGTGAAACCTTGGGGCTCAACCTCAAGCATGCATCTGAAACTGCGTAGCTAGAGTGCAGGAGAGGAAAGCGGAATTCCGAG0.375000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__TerrisporobacterTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGGAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTCTTGAAACTGGGAGACTTGAGTGCAGGAGAGGAAAGTGGAATTCCTAGT0.363636
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGAGCGTAGGCGGATATTTAAGTGGGATGTGAAATACTTGGGCTCAACCCGAGAACGGCATTCCAAACTGGATATCTAGAGTGCAGGAGAGGAGAGTGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACTTTTAAGTGAGATGTGAAATACCCGGGCTCAACCTGGGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAATGGAATTCCTAG0.307692
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Paenibacillaceae 1;g__PaenibacillusTACGTAGGGGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTCTTTAAGTCTGGTGTTTAAACCCGAGGCTCAACTTCGGGTCGCACTGGAAACTGGGGGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCACGT0.307692
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGTGTAGGCGGCTGTGCAAGTCAGAAGTGAAAACCCGGGGCTCAACCCCGGGACTGCTTTTGAAACTGCATGGCTTGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__ButyricicoccusTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGAGTAGGCGGGCTGGCAAGTTGGGAGTGAAATCCGGGGGCTCAACCCCCGAACTGCTTTCAAAACTGCTAGTCTTGAGTGATGGAGAGGCAGGCGGAATTCCCAG0.285714
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGTGCGTAGGCGGCTAAGCAAGTCAGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTTGAAACTGTTTAGCTTGAGTGATGTAGAGGTAGGCGGAATTCCCGG0.285714

Annotations:

common ontology terms
term enrichment score
TermScore
trachemys scripta elegans0.666667
red-eared slider turtle0.666667
turtle farm0.666667
neonate stage0.500000
age 0 days0.500000
age 3-5 weeks0.400000
hainan autonomous prefecture0.400000
intestine0.076923
farm0.054054
china0.011561
Fraction of dbbact annotations with this term covered by the query
TermScore
trachemys scripta elegans0.500000
red-eared slider turtle0.500000
turtle farm0.500000
neonate stage0.500000
age 0 days0.500000
age 3-5 weeks0.333333
hainan autonomous prefecture0.250000
intestine0.040000
farm0.027778
china0.005814
Fraction of annotations for the query sequences containing the term
TermScore
farm1.000000
intestine1.000000
china1.000000
hainan autonomous prefecture1.000000
trachemys scripta elegans1.000000
red-eared slider turtle1.000000
turtle farm1.000000
age 3-5 weeks0.500000
neonate stage0.500000
age 0 days0.500000

Problems / suggestions? Please email info AT dbbact DOT org