Summary for ontology term: triticum aestivum

Number of annotations with term: 89

Top positive-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACAGAGGAGCCAAGCGTTGTCCGGATTGACTGGGCGTAAAGCGCACGCAGGCGGATGTGCGCGTGGGGTGTGAAATCTGGCCGCTTAACGGCCAGGCGCCATCCCATACGGCACGTCTGGAGCAATGCAGAGGTCGGTGGAATTGCCGG0.034091
d__BacteriaTACGTAGGGTCCGAGCGTTGTCCGGAGTTACTGGGCGTAAAGCGCGCGCAGGCGGCTCGTTAAGACCGGCGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCGTTGGTGACTGGCGGGCTTGAAGCCAGCAGGGGCAGGTGGAATTCCCGG0.034091
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp6;g__Gp6TACAGAGGTGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGTGGCCTTTTGAGTCAGACGTGAAATCCCCCGGCTTAACCTGGGAACTGCGTCTGATACTGGAAGGCTCGAGTTCGGGAGAGGGATGTGGAATTCCAGG0.034091
d__Bacteria;p__candidate division WPS-1;g__WPS-1_genera_incertae_sedisGACAGAGGTGCCGAGCGTTAGGCGGAATCACTGGGCTTAAAGCGTGTGTAGGCGGACCGTTAAGTACCTTGTGAAATCCCACGGCTCAACCGTGGAACGGCTGGGTATACTGGCGGTCTTGAGCCACCTAGGGGCGAGCGGAACAAGCGG0.034091
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__SphingomonadalesTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCCATTTAAGTCAGAGGTGAAAGCCTGGAGCTCAACTCCAGAACTGCCTTTGAGACTGGATGGCTAGAATCTTGGAGAGGCGAGTGGAATTCCGAG0.034091
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTTACGTCGGATGTGAAAACCCGAGGCTTAACCTCGGGCCTGCATTCGATACGGGCAGACTCGAGTGTGGTAGGGGAGACTGGAACTCCTGG0.034091
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__RhizobialesTACGAAGGGGGCTAGCGTTGCTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATTCTTAAGTCAGGGGTGAAATCCCGGAGCTCAACTCCGGAACTGCCTTTGATACTGAGAATCTCGAGTCCGGGAGAGGTGAGTGGAACTCCGAG0.034091
d__Bacteria;p__Firmicutes;c__Bacilli;o__BacillalesTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTCTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.034091
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Microbacteriaceae;g__MicrobacteriumTACGTAGGGCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAATCCCGAGGCTCAACCTCGGGCCTGCAGTGGGTACGGGCAGACTAGAGTGCGGTAGGGGAGATTGGAATTCCTGG0.034091
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCAAGCGTTAATCGGATTTACTGGGCGTAAAGCGCGCGTAGGCGGCTAATTAAGTCAAATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGTTAGCTAGAGTGTGGGAGAGGATGGTAGAATTCCAGG0.034091

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Propionibacteriaceae;g__MicrolunatusTACGTAGGGTCCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTCGTCACGTCGGAAGTGAAAACTCAGGGCTTAACCCTGAGCCTGCTTCCGATACGGGCAAACTAGAGGAATGCAGGGGAGAACGGAATTCCTGG0.666667
d__BacteriaTACGTAGGGGCCGAGCGTTGTCCGGAGTTACTGGGCGTAAAGCGCGCGCAGGCGGCCACGCGCGCCCGGCGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCGTCGGGGACGGCGTGGCTTGAGGGCGGTAGGGGCCGGTGGAATCCCTGG0.666667
d__BacteriaGACGTAGGGGGCGAGCGTTGTCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGTAAGTCGGGTGTGAAATCCTGGGGCTCAACCCCAGGACTGCACTCGATACTGCCAGGCTAGAGGTAGGTAGGGGAGATCGGAATTCCTGG0.666667
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGCGTGTAGGCGGCCATGTAGGTCTGACGTGAAATTCCGAGGCTCAACCTCGGCAGGTCGTTGGAAACCATATGGCTAGAGTCCGGAAGAGGAGAGTGGAATTCCTGG0.666667
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.666667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTCTGTCGCGTCGGAAGTGAAAACCCGGGGCTCAACCCCGGGCCTGCTTTCGATACGGGCAGACTAGAGTTCGGCAGGGGAGACTGGAATTCCTGG0.666667
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__AcinetobacterTACAGAGGGTGCGAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGCGTAGGCGGCTTTTTAAGTCGGATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTCGATACTGGGAAGCTAGAGTATGGGAGAGGATGGTAGAATTCCAGG0.666667
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Moraxellaceae;g__EnhydrobacterTACAGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGTGTAGGTGGCTCATTAAGTCACATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATGTGATACTGGTGGTGCTAGAATATGTGAGAGGGAAGTAGAATTCCAG0.666667
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.666667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__MicrococcusTACGTAGGGTGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGTCGTGAAAGTCCGGGGCTTAACCCCGGATCTGCGGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTGG0.666667

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Archaea;p__"Thaumarchaeota";o__Nitrososphaerales;f__Nitrososphaeraceae;g__NitrososphaeraGCGCGAAACCTCTGCAATAGGCGAAAGCCTGACAGGGTTACTCTGAGTGATTCCCGCTAAGGGGATCTTTTGGCACCTCTAAAAATGGTGCAGAATAAGGGGTGGGCAAGTCTGGTGTCAGCCGCCGCGGTAATACCAGCACCCCGAGTG0.230769
d__BacteriaTGGGGAATATTGCGCAATGGGCGAAAGCCTGACGCAGCAACGCCGCGTGAGTGATGAAGGCCTTCGGGTCGTAAAGCTCTGTCGGAGGGAACGAATGCTTTTGAGGTTAATAGCCTCAGGAGGTGACGGTACCCTCAAAGGAAGCACCGG0.227273
d__BacteriaGACGGAGGGTGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGCCTGGTCAGTCGGATGTGAAAGCCCGGGGCTCAACCCCGGAACGGCATCCGAGACGGCCAGGCTGGAGACCGGGAGAGGAGGGTGGAATAGCCAG0.220472
d__Archaea;p__"Thaumarchaeota";o__Nitrososphaerales;f__Nitrososphaeraceae;g__NitrososphaeraGCGCGAAAACTCTGCAATAAGCGAAAGCTTGACAGGGTTATTCTGAGTGATTTCCGCTAAGGAAATCTTTTGGCACCTCTAAAAATGGTGCAGAATAAGGGGTGGGCAAGCCTGGTGTCAGCCGCCGCGGTAATACCAGCACCCCGAGTG0.220183
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Solirubrobacterales;f__Conexibacteraceae;g__ConexibacterTACGTAGGGGGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGCGCGTGTAGGCGGCTCGGTAAGTCTGCTGTGAAAGTCCAGGGCTCAACCCTGGGATGCCGGTGGATACTGTCGAGCTCGAGTCCGGAAGAGGCGAGTGGAATTCCTGG0.219512
d__Bacteria;p__"Actinobacteria"TACGTAGGGGGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGCGCGTGTAGGCGGCCAGGTAGGTCTGCTGTGAAAACTCGAGGCTCAACTTCGAGATGTCGGCGGAAACCATCTGGCTAGAGTCCGGAAGAGGAGAGTAGAATTCCTGG0.213115
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodospirillales;f__RhodospirillaceaeTACGAAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGTTTGTCAAGTCAGGCGTGAAAGCCCCGGGCTCAACCTGGGAACTGCGCTTGAGACTGGCAGGCTCGAGTTCGGGAGAGGATGGTGGAATTCCCAG0.211382
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Nocardioidaceae;g__NocardioidesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTTGTCGCGTCGGGAGTGAAAACCCAGGGCTTAACCCTGGGCTGGCTTCCGATACGGGCAGACTAGAGGTATGCAGGGGAGAACGGAATTCCTGG0.209790
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGCGTGTAGGCGGCCAGGTAAGTCGGCTGTGAAAACTCGAGGCTCAACCTCGAGATGTCGGCCGAAACTATCTGGCTAGAGTCCGGAAGAGGAGAATGGAATTCCCGG0.208000
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCGTGTAGGCGGCCTGACAGGTCCGTTGTGAAAACCCGAGGCTCAACCTCGGGACGTCGATGGAAACCGTCAGGCTAGAGTCCGGAAGAGGAGAGTGGAATTCCTGG0.206897

Annotations:

common ontology terms
term enrichment score
TermScore
triticum aestivum0.942068
zea mays0.372372
silt loam0.299213
loess plateau0.296943
wheat0.287770
crop rotation0.264463
bernburg0.264463
shaanxi province0.252101
ph 7.60.251748
bonn0.212389
campus klein-altendorf0.212389
agricultural field0.202643
haplic luvisol0.192000
soil0.180180
conventional tillage0.168224
silty clay loam0.168067
ph 6.90.168067
bulk soil0.161290
red soil0.152381
ph 70.143885
heilongjiang province0.141593
black soil0.141593
mollisol0.141593
cambisol0.141593
maize pre-crop0.135922
mouldboard plough0.118812
rapeseed pre-crop0.118812
cultivator tillage0.118812
vertisol0.118812
northen israel0.118812
brassica napus0.112150
conservation tillage0.112150
kingdom of denmark0.111732
glycine max0.110345
hunan province0.110345
germany0.104283
depth (soil) 45-75cm0.082474
depth (soil) 75-105cm0.082474
depth 0-40cm0.082474
loess chernozem0.082474
high biochar0.082474
agricultural feature0.079602
LOWER IN zea mays0.073394
rhizosphere0.067950
depth 40-100cm0.063158
depth 100-300cm0.063158
LOWER IN conventional tillage0.063158
LOWER IN reforestation0.063158
LOWER IN robinia pseudoacacia0.063158
no tillage0.063158
israel0.062827
ph<60.061224
ph>60.061224
china0.060955
npk fertilizer0.059406
ph<50.059406
ph>50.059406
root0.044776
non-manured soil0.043011
LOWER IN non-manured soil0.043011
fluvo-aquic soil0.043011
LOWER IN depth 0-40cm0.043011
LOWER IN maize pre-crop0.043011
LOWER IN rapeseed pre-crop0.043011
LOWER IN cultivator tillage0.043011
LOWER IN mouldboard plough0.043011
chromic cambisol0.043011
LOWER IN depth (soil) 45-75cm0.043011
robinia pseudoacacia0.043011
reforestation0.043011
low biochar0.043011
straw0.043011
LOWER IN depth (soil) 75-105cm0.043011
LOWER IN manured soil0.042105
manured soil0.042105
luancheng county0.042105
LOWER IN brassica napus0.042105
LOWER IN conservation tillage0.042105
ph 7.70.042105
shanxi province0.041237
hebei province0.040404
ph 6.50.040404
LOWER IN bulk soil0.038835
LOWER IN triticum aestivum0.036036
LOWER IN agricultural field0.035398
depth (soil) 0-20cm0.031621
LOWER IN depth (soil) 0-20cm0.023392
LOWER IN depth 40-100cm0.021978
LOWER IN depth 100-300cm0.021978
LOWER IN 10 years0.021978
20 years0.021978
LOWER IN 20 years0.021978
LOWER IN 30 years0.021978
30 years0.021978
soil unamended with straw0.021978
LOWER IN soil amended with straw0.021978
soil amended with straw0.021978
LOWER IN soil unamended with straw0.021978
LOWER IN no tillage0.021978
LOWER IN ph&gt;60.021739
Fraction of dbbact annotations with this term covered by the query
TermScore
triticum aestivum0.909091
loess plateau0.666667
non-manured soil0.500000
LOWER IN non-manured soil0.500000
fluvo-aquic soil0.500000
depth (soil) 45-75cm0.500000
bonn0.500000
campus klein-altendorf0.500000
depth (soil) 75-105cm0.500000
silt loam0.500000
depth 0-40cm0.500000
shaanxi province0.500000
depth 40-100cm0.500000
depth 100-300cm0.500000
LOWER IN depth 40-100cm0.500000
LOWER IN depth 0-40cm0.500000
LOWER IN depth 100-300cm0.500000
crop rotation0.500000
mouldboard plough0.500000
conventional tillage0.500000
loess chernozem0.500000
bernburg0.500000
LOWER IN maize pre-crop0.500000
rapeseed pre-crop0.500000
LOWER IN rapeseed pre-crop0.500000
maize pre-crop0.500000
cultivator tillage0.500000
LOWER IN cultivator tillage0.500000
LOWER IN mouldboard plough0.500000
LOWER IN conventional tillage0.500000
chromic cambisol0.500000
LOWER IN depth (soil) 45-75cm0.500000
LOWER IN 10 years0.500000
LOWER IN reforestation0.500000
LOWER IN robinia pseudoacacia0.500000
robinia pseudoacacia0.500000
reforestation0.500000
20 years0.500000
LOWER IN 20 years0.500000
LOWER IN 30 years0.500000
30 years0.500000
high biochar0.500000
low biochar0.500000
straw0.500000
soil unamended with straw0.500000
LOWER IN soil amended with straw0.500000
soil amended with straw0.500000
LOWER IN soil unamended with straw0.500000
LOWER IN depth (soil) 75-105cm0.500000
vertisol0.500000
northen israel0.500000
no tillage0.500000
LOWER IN no tillage0.500000
red soil0.500000
zea mays0.400000
wheat0.400000
heilongjiang province0.333333
black soil0.333333
mollisol0.333333
ph<60.333333
LOWER IN ph&gt;60.333333
ph>60.333333
LOWER IN ph&lt;60.333333
LOWER IN manured soil0.333333
manured soil0.333333
ph 7.60.333333
luancheng county0.333333
silty clay loam0.333333
ph 6.90.333333
haplic luvisol0.333333
brassica napus0.333333
LOWER IN brassica napus0.333333
conservation tillage0.333333
LOWER IN conservation tillage0.333333
ph 7.70.333333
cambisol0.333333
bulk soil0.285714
npk fertilizer0.250000
LOWER IN npk fertilizer0.250000
shanxi province0.250000
ph<50.250000
LOWER IN ph&gt;50.250000
ph>50.250000
LOWER IN ph&lt;50.250000
hebei province0.200000
ph 6.50.200000
LOWER IN zea mays0.200000
ph 70.200000
agricultural field0.166667
glycine max0.142857
LOWER IN bulk soil0.142857
hunan province0.142857
kingdom of denmark0.111111
soil0.099010
LOWER IN triticum aestivum0.090909
LOWER IN agricultural field0.083333
agricultural feature0.071429
root0.066667
LOWER IN root0.066667
germany0.062500
Fraction of annotations for the query sequences containing the term
TermScore
soil1.000000
triticum aestivum0.977528
china0.505618
zea mays0.348315
germany0.314607
agricultural field0.258427
wheat0.224719
silt loam0.213483
ph 7.60.202247
loess plateau0.191011
crop rotation0.179775
bernburg0.179775
rhizosphere0.168539
shaanxi province0.168539
haplic luvisol0.134831
bonn0.134831
campus klein-altendorf0.134831
silty clay loam0.112360
ph 6.90.112360
bulk soil0.112360
kingdom of denmark0.112360
ph 70.112360
conventional tillage0.101124
heilongjiang province0.089888
agricultural feature0.089888
glycine max0.089888
black soil0.089888
mollisol0.089888
hunan province0.089888
red soil0.089888
cambisol0.089888
maize pre-crop0.078652
mouldboard plough0.067416
brassica napus0.067416
rapeseed pre-crop0.067416
cultivator tillage0.067416
conservation tillage0.067416
vertisol0.067416
israel0.067416
northen israel0.067416
depth (soil) 45-75cm0.044944
depth (soil) 75-105cm0.044944
depth (soil) 0-20cm0.044944
depth 0-40cm0.044944
loess chernozem0.044944
LOWER IN zea mays0.044944
high biochar0.044944
ph<60.033708
npk fertilizer0.033708
ph>60.033708
root0.033708
depth 40-100cm0.033708
depth 100-300cm0.033708
LOWER IN conventional tillage0.033708
LOWER IN reforestation0.033708
LOWER IN robinia pseudoacacia0.033708
no tillage0.033708
ph<50.033708
ph>50.033708
non-manured soil0.022472
LOWER IN manured soil0.022472
manured soil0.022472
LOWER IN non-manured soil0.022472
fluvo-aquic soil0.022472
hebei province0.022472
luancheng county0.022472
LOWER IN bulk soil0.022472
ph 6.50.022472
LOWER IN depth 0-40cm0.022472
LOWER IN maize pre-crop0.022472
LOWER IN brassica napus0.022472
LOWER IN rapeseed pre-crop0.022472
LOWER IN conservation tillage0.022472
LOWER IN cultivator tillage0.022472
LOWER IN mouldboard plough0.022472
ph 7.70.022472
chromic cambisol0.022472
shanxi province0.022472
LOWER IN depth (soil) 45-75cm0.022472
LOWER IN triticum aestivum0.022472
LOWER IN agricultural field0.022472
robinia pseudoacacia0.022472
reforestation0.022472
low biochar0.022472
straw0.022472
LOWER IN depth (soil) 75-105cm0.022472
LOWER IN depth (soil) 0-20cm0.022472
LOWER IN ph&gt;60.011236
LOWER IN ph&lt;60.011236
LOWER IN npk fertilizer0.011236
LOWER IN root0.011236
LOWER IN rhizosphere0.011236
LOWER IN depth 40-100cm0.011236
LOWER IN depth 100-300cm0.011236
LOWER IN 10 years0.011236
20 years0.011236
LOWER IN 20 years0.011236
LOWER IN 30 years0.011236
30 years0.011236
soil unamended with straw0.011236
Exp. ID User ID Description Date Region Flag Sequences
155amnonhigh freq in soil loosely bound to wheat root (dominant triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 1
155amnonhigh freq in bulk soil in wheat field (dominant triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 1
412amnondominant soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 1
155amnonhigh freq in soil tightly bound to wheat root (dominant triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 2
837sheryoDominant in agricultural field at depths 0-40cm, shaanxi, China (dominant depth 0-40cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 3
414amnondominant soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 5
765sheryoDominant in wheat field in the loess plateau in china (dominant triticum aestivum, ph 7.7, loess plateau, silt loam, chromic cambisol, shanxi province, china, soil)2021-04-12v3No1 / 5
414amnondominant soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 6
837sheryoDominant in agricultural field at depths 100-300cm, shaanxi, China (dominant depth 100-300cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 6
764sheryoDominant in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (dominant maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 7
837sheryoDominant in agricultural field at depths 40-100cm, shaanxi, China (dominant depth 40-100cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 8
764sheryoDominant in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (dominant ph 7.6, crop rotation, cultivator tillage, conservation tillage, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 8
764sheryoDominant in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (dominant rapeseed pre-crop, brassica napus, maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 8
610sheryoDominant in agricultural field soil (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, triticum aestivum)2020-04-21v3No1 / 8
820naCommon in top soil, 0-20cm depth, wheat rhizosphere haplic luvisol in germany (dominant depth (soil) 0-20cm, triticum aestivum, ph 6.5, silt loam, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 9
764sheryoDominant in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (dominant crop rotation, triticum aestivum, ph 7.6, mouldboard plough, conventional tillage, loess chernozem, bernburg, germany, soil)2021-04-12v3No1 / 9
610sheryoDominant in agricultural field soil amended with low biochar (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum, low biochar)2020-04-21v3No1 / 9
769sheryodominant in no tillage wheat field in northern israel (dominant bulk soil, triticum aestivum, no tillage, northen israel, israel, vertisol, soil)2021-04-18v4No1 / 9
820naDominant in lower subsoil, 75-105cm depth, wheat rhizosphere haplic luvisol in germany (dominant depth (soil) 75-105cm, silty clay loam, ph 6.9, triticum aestivum, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 10
610sheryoDominant in agricultural field soil amended with high biochar (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 10
610sheryoDominant in agricultural field soil amended with straw (dominant soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum, straw)2020-04-21v3No1 / 10
769sheryoDominant in conventional tillage wheat field in northern israel (dominant conventional tillage, bulk soil, soil, vertisol, israel, northen israel, triticum aestivum)2021-04-18v4No1 / 10
412amnondominant soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 11
750sheryoDominant in soil of wheat field in China (dominant fluvo-aquic soil, ph 7.6, hebei province, luancheng county, china, triticum aestivum, soil)2021-03-11v3No1 / 12
820nadominant in upper subsoil, 45-75cm depth, wheat rhizosphere haplic luvisol in germany (dominant silty clay loam, ph 6.9, depth (soil) 45-75cm, triticum aestivum, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 14
610sheryoHigher in agricultural field soil unamended with straw ( high in soil unamended with straw compared to soil amended with straw in triticum aestivum ph 7 wheat kingdom of denmark agricultural field soil )2020-04-21v3No1 / 22
764sheryoHigh in rapeseed pre-crop compared to maize pre-crop in leoss soil in wheat field grown under conservation tillage and crop rotation in germany ( high in brassica napus rapeseed pre-crop compared to maize pre-crop zea mays in ph 7.6 crop rotation cultivator tillage conservation tillage triticum aestivum soil germany bernburg )2021-04-12v3No1 / 30
155amnonhigher in bulk soil compared to loose bound root soil ( high in bulk soil compared to rhizosphere in triticum aestivum wheat soil china )2017-07-02v4No1 / 31
764sheryoHigh in maize pre-crop compared to rapeseed pre-crop in leoss soil in wheat field grown under conservation tillage and crop rotation in germany ( high in maize pre-crop zea mays compared to rapeseed pre-crop brassica napus in ph 7.6 crop rotation cultivator tillage conservation tillage triticum aestivum soil germany bernburg )2021-04-12v3No1 / 31
610sheryoHigher in agricultural field soil amended with straw ( high in soil amended with straw compared to soil unamended with straw in triticum aestivum ph 7 wheat kingdom of denmark agricultural field soil )2020-04-21v3No1 / 34
837sheryoHigher in agricultural field at depths 40-100cm compared to 0-40cm, shaanxi, China ( high in depth 40-100cm compared to depth 0-40cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 42
764sheryoHigh in convetional tillage compared to conservation tillage leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany ( high in mouldboard plough conventional tillage compared to cultivator tillage conservation tillage in rapeseed pre-crop brassica napus ph 7.6 crop rotation triticum aestivum soil germany bernburg )2021-04-12v3No1 / 52
764sheryoHigh in conservation tillage compared to conventional tillage in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany ( high in cultivator tillage conservation tillage compared to mouldboard plough conventional tillage in maize pre-crop ph 7.6 crop rotation triticum aestivum soil germany bernburg )2021-04-12v3No1 / 56
155amnonlower in bulk soil compared to loose bound root soil ( high in rhizosphere compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 63
769sheryoHigh in no tillage compared to conventional tillage in wheat field in northern israel ( high in no tillage compared to conventional tillage in bulk soil soil vertisol israel northen israel triticum aestivum )2021-04-18v4No1 / 65
764sheryoHigh in conservation tillage compared to conventional tillage leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany ( high in conservation tillage cultivator tillage compared to conventional tillage mouldboard plough in bernburg germany soil triticum aestivum crop rotation ph 7.6 brassica napus rapeseed pre-crop )2021-04-12v3No1 / 68
764sheryoHigh in conventional tillage compared to conservation tillage in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany ( high in conventional tillage mouldboard plough compared to conservation tillage cultivator tillage in maize pre-crop ph 7.6 crop rotation triticum aestivum soil germany bernburg )2021-04-12v3No1 / 72
837sheryoHigher in agricultural field at depths 100-300cm compared to 0-40cm, shaanxi, China ( high in depth 100-300cm compared to depth 0-40cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 81
820naHigher in 45-5cm depth compared to 75-105cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 45-75cm compared to depth (soil) 75-105cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v1No1 / 83
764sheryoHigh in rapeseed pre-crop compared to maize pre-crop leoss soil in wheat field grown under conventional tillage and crop rotation in germany ( high in brassica napus rapeseed pre-crop compared to maize pre-crop zea mays in soil germany bernburg loess chernozem conventional tillage mouldboard plough ph 7.6 triticum aestivum crop rotation )2021-04-12v3No1 / 91
769sheryoHigh in conventional tillage compared to no tillage in wheat field in northern israel ( high in conventional tillage compared to no tillage in bulk soil soil vertisol israel northen israel triticum aestivum )2021-04-18v4No1 / 91
837sheryoHigher in agricultural field at depths0-40cm compared to 40-100cm, shaanxi, China ( high in depth 0-40cm compared to depth 40-100cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 95
414amnon high in non-manured soil compared to manured soil in agricultural feature soil zea mays glycine max triticum aestivum heilongjiang province black soil mollisol china 2018-11-26v4No1 / 104
414amnon high in manured soil compared to non-manured soil in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 118
820naHigher in 75-105cm depth compared to 45-75cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 75-105cm compared to depth (soil) 45-75cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v1No1 / 159
764sheryoHigh in maize pre-crop compared to rapeseed pre-crop leoss soil in wheat field grown under conventional tillage and crop rotation in germany ( high in maize pre-crop zea mays compared to brassica napus rapeseed pre-crop in soil germany bernburg loess chernozem conventional tillage mouldboard plough ph 7.6 triticum aestivum crop rotation )2021-04-12v3No1 / 173
750sheryoCommon in soil of wheat field in China (common fluvo-aquic soil, ph 7.6, hebei province, luancheng county, china, triticum aestivum, soil)2021-03-11v3No1 / 337
412amnonhigh in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in manured soil compared to non-manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 395
837sheryoHigher in agricultural field at depths 0-40cm compared to 100-300cm, shaanxi, China ( high in depth 0-40cm compared to depth 100-300cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 431
412amnonlower in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in non-manured soil compared to manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 437
820naCommon in upper subsoil, 45-75cm depth, wheat rhizosphere haplic luvisol in germany (common silty clay loam, ph 6.9, depth (soil) 45-75cm, triticum aestivum, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 648
820naHigher in 45-75cm depth compared to 0-20cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 45-75cm compared to depth (soil) 0-20cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v1No1 / 686
820naCommon in lower subsoil, 75-105cm depth, wheat rhizosphere haplic luvisol in germany (common depth (soil) 75-105cm, silty clay loam, ph 6.9, triticum aestivum, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 700
412amnon high in ph<5 compared to ph>5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 706
820naHigher in 75-105cm depth compared to 0-20cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 75-105cm compared to depth (soil) 0-20cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v1No1 / 740
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 856
769sheryocommon in conventional tillage wheat field in northern israel (common conventional tillage, bulk soil, soil, vertisol, israel, northen israel, triticum aestivum)2021-04-18v4No1 / 861
769sheryocommon in no tillage wheat field in northern israel (common bulk soil, soil, vertisol, israel, northen israel, no tillage, triticum aestivum)2021-04-18v4No1 / 871
820naHigher in 0-20cm depth compared to 75-105cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 0-20cm compared to depth (soil) 75-105cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v1No1 / 917
820naHigher in 0-20cm depth compared to 45-75cm depth in wheat rhizosphere haplic luvisol in germany ( high in depth (soil) 0-20cm compared to depth (soil) 45-75cm in silty clay loam ph 6.9 triticum aestivum haplic luvisol germany bonn campus klein-altendorf rhizosphere soil )2021-07-14v1No1 / 923
414amnon high in ph<6 npk fertilizer compared to ph>6 in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 963
610sheryoCommon in agricultural field soil amended with straw (common straw, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 998
412amnon high in ph>5 compared to ph<5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 1005
610sheryoCommon in agricultural field soil amended with low biochar (common low biochar, triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1009
820naCommon in top soil, 0-20cm depth, wheat rhizosphere haplic luvisol in germany (common depth (soil) 0-20cm, triticum aestivum, ph 6.5, silt loam, haplic luvisol, germany, bonn, campus klein-altendorf, rhizosphere, soil)2021-07-14v1No1 / 1011
610sheryoCommon in agricultural field soil (common triticum aestivum, ph 7, wheat, kingdom of denmark, agricultural field, soil)2020-04-21v3No1 / 1053
610sheryoCommon in agricultural field soil amended with high biochar (common soil, agricultural field, kingdom of denmark, wheat, ph 7, high biochar, triticum aestivum)2020-04-21v3No1 / 1079
765sheryocommon in wheat field in the loess plateau in china (common triticum aestivum, ph 7.7, loess plateau, silt loam, chromic cambisol, shanxi province, china, soil)2021-04-12v3No1 / 1087
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 1105
764sheryocommon in leoss soil in wheat field grown under crop rotation with rapeseed pre-crop in germany (common bernburg, germany, soil, triticum aestivum, crop rotation, ph 7.6, brassica napus, rapeseed pre-crop)2021-04-12v3No1 / 1129
764sheryoCommon in leoss soil in wheat field grown under conservation tillage and crop rotation in germany (common ph 7.6, crop rotation, cultivator tillage, conservation tillage, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1140
764sheryoCommon in leoss soil in wheat field grown under conventional tillage and crop rotation in germany (common crop rotation, triticum aestivum, ph 7.6, mouldboard plough, conventional tillage, loess chernozem, bernburg, germany, soil)2021-04-12v3No1 / 1213
837sheryoCommon in agricultural field at depths 100-300cm, shaanxi, China (common depth 100-300cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1220
764sheryoCommon in leoss soil in wheat field grown under crop rotation with maize pre-crop in germany (common maize pre-crop, ph 7.6, crop rotation, triticum aestivum, soil, germany, bernburg)2021-04-12v3No1 / 1225
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common depth 40-100cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1263
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 1282
414amnon high in ph>6 compared to ph<6 npk fertilizer in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 1451
837sheryoCommon in agricultural field at depths 0-40cm, shaanxi, China (common depth 0-40cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1470
155amnonhigher in tightly bound root soil compared to loose soil and bulk soil ( high in root compared to bulk soil in triticum aestivum wheat soil china )2017-07-02v4No1 / 1714
155amnoncommon in soil tightly bound to wheat root (common triticum aestivum, wheat, soil, root, china)2017-07-02v4No1 / 1977
155amnoncommon in soil loosely bound to wheat root (common triticum aestivum, wheat, soil, rhizosphere, china)2017-07-02v4No1 / 2425
155amnoncommon in bulk soil in wheat field (common triticum aestivum, wheat, soil, bulk soil, china)2017-07-02v4No1 / 2594
837sheryoHigher in soil of agricultural feild compared to after 20 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 20 years robinia pseudoacacia reforestation in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2892
837sheryoHigher in soil of agricultural feild compared to after 30 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to robinia pseudoacacia 30 years reforestation in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 2927
155amnonlower in tightly bound root soil compared to loose soil and bulk soil ( high in bulk soil compared to root in triticum aestivum wheat soil china )2017-07-02v4No1 / 2933
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 10 years reforestation robinia pseudoacacia in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2994
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 5661

Problems / suggestions? Please email info AT dbbact DOT org