Summary for ontology term: tucson

Number of annotations with term: 6

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae"TACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGTCTGGTAAGTCTGATGTGAAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGCCAGACTAGAGTACTGGAGAGGTGGGCGGAACTACAAGT0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__PeptostreptococcaceaeTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTCAAGTCAGGAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTCTTGAAACTGGGAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.107143
d__BacteriaTACGTAGGAGGCAAGCGTTATCCGGAATGACTGGGCGTAAAGGGTGCGTAGGTGGCTTGGCAAGTTGGTAGCGTAATTCCGAGGCTCAACCTCGGCGCTACTACCAAAACTGTCAGGCTCGAGTGCAGGAGGGGTAAGTGGAATTCCTAG0.105263
d__Bacteria;p__"Verrucomicrobia";c__Verrucomicrobiae;o__Verrucomicrobiales;f__Verrucomicrobiaceae;g__AkkermansiaTACAGAGGTCTCAAGCGTTGTTCGGAATCACTGGGCGTAAAGCGTGCGTAGGCTGTTTCGTAAGTCGTGTGTGAAAGGCAGGGGCTCAACCCCTGGATTGCACATGATACTGCGAGACTAGAGTAATGGAGGGGGAACCGGAATTCTCGG0.102564
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAAGAGCAAGTCTGATGTGAAAGGCTGGGGCTTAACCCCAGGACTGCATTGGAAACTGTTGTTCTAGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.100000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Rikenellaceae";g__AlistipesTACGGAGGATTCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTAGATAAGTTAGAGGTGAAATCCCGGGGCTTAACTCCGAAATTGCCTCTAATACTGTTTGACTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG0.083333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGACATGTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGCGTGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.083333
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCTCGGCTTAACCGAGGAAGTGCATCGGAAACTGGGAAACTTGAGTGCAGAAGAGGACAGTGGAACTCCATG0.064516
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.055556
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTTGAAACTGGCAGGCTTGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.054054

Annotations:

common ontology terms
Fraction of dbbact annotations with this term covered by the query
TermScore
tucson0.500000
diarrhea0.500000
non c. diff diarrhea0.333333
clostridium difficile colitis0.333333
LOWER IN non c. diff diarrhea0.333333
LOWER IN clostridium difficile colitis0.333333
clostridium difficile infection0.250000
LOWER IN clostridium difficile infection0.250000
hospital0.100000
adult0.005780
united states of america0.004049
homo sapiens0.003690
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
homo sapiens1.000000
united states of america1.000000
hospital1.000000
adult1.000000
tucson1.000000
non c. diff diarrhea0.500000
clostridium difficile colitis0.500000
clostridium difficile infection0.500000
diarrhea0.333333
LOWER IN non c. diff diarrhea0.166667
LOWER IN clostridium difficile colitis0.166667
LOWER IN clostridium difficile infection0.166667

Problems / suggestions? Please email info AT dbbact DOT org