Summary for ontology term: turtle farm

Number of annotations with term: 6

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGTCTTTTAAGTCAGCGTTGAAAGTTTGCGGCTCAACCGTAAAATTGGCATTGAAACTGGAAGACTTGAGTGTAAATGAAGTAGGCGGAATTCGTTG0.545455
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGTAAACAAGTCAGATGTGAAATACCGAGGCTCAACTTCGGGGCTGCATTTGAAACTGTATATCTTGAGTGTCGGAGAGGAAAGCGGAATTCCTAG0.545455
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1TACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGAGCGTAGGCGGATATTTAAGTGGGATGTGAAATACTTGGGCTCAACCCGAGAACGGCATTCCAAACTGGATATCTAGAGTGCAGGAGAGGAGAGTGGAATTCCTAG0.428571
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__VeillonellaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGAGCGCAGGTGGGAAAGTAAGTCTGTCTTAAAAGTGCGAGGCTCAACCTCGTGAGGGGATGGAAACTATTTTTCTTGAGTGCAGGAGAGGAAAGCGGAATTCCTAGT0.400000
d__Bacteria;p__"Bacteroidetes";c__Cytophagia;o__Cytophagales;f__CytophagaceaeTACGGAGGGTGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGTGGTTTAGTAAGTCTGGTTTGAAAGTCAGCCGCTTAACGGTTGAGGGTGGCTGGATACTGCTGAACTTGAATTTTTCGGAGGCAGGCGGAACGGGTTG0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACTTTTAAGTGAGATGTGAAATACCCGGGCTCAACCTGGGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAATGGAATTCCTAG0.400000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTCATTTAAGTCAGCGTTGAAAGTTTTCGGCTCAACCGGAAAATTGGCATTGAAACTGGATGACTTGAGTGTAAATGAAGTGGGCGGAATTCGTTG0.375000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTCATTTAAGTCAGCGTTGAAAGTTTTCGGCTCAACCGGAAAATTGGCATTGAAACTGGATGACTTGAGTGTAAATGAAGTGGGCGGAATTCGTTG0.352941
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGCGATTTAAGTCAGATGTGAAAACTCAGGGCTCAACCTTGAGACTGCATCTGAAACTGAGTTGCTAGAGTGCAGGAGAGGAAAGCGGAATTCCGAG0.347826
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__TerrisporobacterTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTTTTTTAAGTCAGGAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTCTTGAAACTGGAAAACTTGAGTGCAGGAGAGGAAAGTGGAATTCCTAGT0.333333

Annotations:

common ontology terms
term enrichment score
TermScore
turtle farm0.666667
trachemys scripta elegans0.571429
red-eared slider turtle0.571429
hainan autonomous prefecture0.400000
neonate stage0.400000
age 0 days0.400000
age 3-5 weeks0.333333
pond water0.250000
intestine0.075472
farm0.054054
water0.034483
china0.011561
Fraction of dbbact annotations with this term covered by the query
TermScore
trachemys scripta elegans0.500000
red-eared slider turtle0.500000
turtle farm0.500000
neonate stage0.500000
age 0 days0.500000
age 3-5 weeks0.333333
hainan autonomous prefecture0.250000
pond water0.200000
intestine0.040000
farm0.027778
water0.018182
china0.005814
Fraction of annotations for the query sequences containing the term
TermScore
farm1.000000
china1.000000
hainan autonomous prefecture1.000000
turtle farm1.000000
intestine0.666667
trachemys scripta elegans0.666667
red-eared slider turtle0.666667
age 3-5 weeks0.333333
water0.333333
pond water0.333333
neonate stage0.333333
age 0 days0.333333

Problems / suggestions? Please email info AT dbbact DOT org