Summary for ontology term: under-1-year-old human stage

Number of annotations with term: 105

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.086957
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.076087
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGGCCGGGGCTTAACTCCGTGTATTGCAGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAACTCCTG0.076087
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.065217
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.065217
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.065217
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCGGTTCAATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGGAGAATTGCATCAGAAACTGTTGAACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.065217
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATGATTAAGTGGGATGTGAAATACCCGGGCTCAACTTGGGTGCTGCATTCCAAACTGGTTATCTAGAGTGCAGGAGAGGAGAGTGGAATTCCTAG0.065217
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTTTCGCTCATGGTCAAGCCGCAGCTTTGGGTTGTGGTGAGGGTAGTGGGTAAAGAAGCGCCGGCTAACTAC0.065217
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.054348

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.296296
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.296296
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AnaerostipesTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAACCCAGGGCTTAACTCTGGGACTGCTTTTGAAACTGTCAGACTAGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.296296
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.296296
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Lachnospiracea_incertae_sedisTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAGTGCAAGTCAGATGTGAAAGGCCGGGGCTCAACCCCGGAGCTGCATTTGAAACTGCTCGGCTAGAGTACAGGAGAGGCAGGCGGAATTCCTAG0.296296
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__Clostridium IVTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGTGTAGGCGGGATATCAAGTCAGAAGTGAAAATTACGGGCTCAACTCGTAACCTGCTTTTGAAACTGACATTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCTAG0.296296
d__BacteriaTACGTAGGTGACAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGACTGTCAAGTCAGTCGTGAAATACCGGGGCTTAACCCCGGGGCTGCGATTGAAACTGACAGCCTTGAGTATCGGAGAGGAAAGCGGAATTCCTAG0.296296
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Lachnospiracea_incertae_sedisTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAGTGCAAGTCAGATGTGAAAGGCCGGGGCTCAACCCCGGAGCTGCATTTGAAACTGCATAGCTAGAGTACAGGAGAGGCAGGCGGAATTCCTAG0.296296
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__IntestinibacterTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTTAAGTCAGGAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTCTTGAAACTGGAGGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.296296
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGATGCAAGTCTGAAGTGAAATACCCGGGCTCAACCTGGGAACTGCTTTGGAAACTGTATGGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.296296

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGCTCGTAGGCGGCTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCTGCGCCGGGTACGGGCGGGCTGGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.200000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGGGGGAACCCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGAGAAGAACGAGTGTGAGAGTGGAAAGTTCACGCTGTGACGGTATCTTACCAGAAAGGGACGG0.190476
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTGTTAGGGAGCAAGGCACTTTGTGTTGAGTGTACCTTTCGAATAAGCACCGGCTAACTACGTGCCAGC0.188406
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTGTTTGGGAGCAAGCCTTCGGGTGAGTGTACCTTTCGAATAAGCGCCGGCTAACTACGTGCCAGCAGC0.187050
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTTCATAAGTCTGTCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGATGGAAACTATGGAACTGGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.183486
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGGCCGGGGCTTAACTCCGTGTATTGCAGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAACTCCTG0.183333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTATCGGGGAGCAAGCGTGAGTGAGTTTACCCGTTGAATAAGCACCGGCTAACTACGTGCCAGCAGCCG0.170213
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTATCAGGGAGCAAGGCTTCGGTTGAGTGTACCTGTTGAATAAGCACCGGCTAACTACGTGCCAGCAGC0.149533
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTAGGGAATCTTCGGCAATGGACGAAAGTCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAACTCTGTTGTTAGAGAAGAACAAGGACGTTAGTAACTGAACGTCCCCTGACGGTATCTAACCAGAAAGCCACGGC0.144928
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGGGGCAACCCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGAGAAGAACGAGTGTGAGAGTGGAAAGTTCACGCTGTGACGGTATCTTACCAGAAAGGGACGG0.140351

Annotations:

common ontology terms
term enrichment score
TermScore
infant0.780761
3-month-old human stage0.406780
1-month-old human stage0.358744
formula fed0.244604
6-month-old human stage0.242424
age0.234568
breast fed0.222222
under-1-year-old human stage0.213333
los angeles district0.205128
LOWER IN 3-month-old human stage0.182724
sweden0.178947
hispanic0.170213
hispanic or latin american0.156863
india0.142857
kingdom of denmark0.137931
rhesus macaque0.132231
LOWER IN under-1-year-old human stage0.129032
state of california0.127660
homo sapiens0.123756
LOWER IN 1-month-old human stage0.121212
1-year-old human stage0.116667
macaca mulatta0.104575
municipality of umea0.102564
LOWER IN 1-year-old human stage0.100000
child0.099617
feces0.089904
2-month-old human stage0.088889
kingdom of the netherlands0.085106
monkey0.073733
dhaka0.073394
gambia0.073394
nasopharynx0.072727
bangladesh0.070796
nasal cavity0.070175
saliva0.065574
captive0.064257
germany0.059219
LOWER IN breast fed0.054054
LOWER IN formula fed0.054054
vellore district0.054054
LOWER IN infant0.045802
kingdom of spain0.042328
infant stage0.041451
age <= 24 hours0.036697
age 1 week0.036697
age one week0.036697
4-month-old human stage0.036697
hypopharynx0.036697
diarrhea0.036697
LOWER IN age 7 months0.036697
age 7 months0.036697
city0.036364
LOWER IN 2-year-old human stage0.036036
finland0.033613
hospital0.032000
LOWER IN infant stage0.026846
age 6 months0.018692
LOWER IN age 8 months0.018692
age 8 months0.018692
LOWER IN age 6 months0.018692
2-days-old human0.018692
LOWER IN 2-days-old human0.018692
LOWER IN 18-month-old human stage0.018692
18-month-old human stage0.018692
LOWER IN age one week0.018692
LOWER IN bifidobacterium supplement0.018692
bifidobacterium supplement0.018692
LOWER IN age &gt; 3 months0.018519
LOWER IN age &lt; 3 months0.018519
LOWER IN age 1-7 years0.018519
age 1-7 years0.018519
LOWER IN 2-month-old human stage0.018519
age 1 month0.018519
LOWER IN age 1 month0.018519
LOWER IN newborn human stage0.018349
LOWER IN age 1-3 years0.018349
age 1-3 years0.018349
LOWER IN age 1 week0.018349
probiotics0.018349
LOWER IN 6-month-old human stage0.018182
2-year-old human stage0.018018
LOWER IN state of oregon0.018018
state of oregon0.018018
LOWER IN 12-month-old human stage0.017857
12-month-old human stage0.017857
female0.017316
LOWER IN 2-5 year-old child stage0.017241
2-5 year-old child stage0.017241
control diet0.016807
LOWER IN control diet0.016807
LOWER IN state of california0.015267
united states of america0.014797
LOWER IN child0.014184
research facility0.012490
china0.008909
LOWER IN adult0.007194
adult0.007194
LOWER IN control0.006897
urban slum0.000000
age 6-12 months0.000000
Fraction of dbbact annotations with this term covered by the query
TermScore
dhaka1.000000
los angeles district1.000000
gambia1.000000
3-month-old human stage0.857143
1-month-old human stage0.833333
6-month-old human stage0.800000
infant0.730769
LOWER IN 3-month-old human stage0.714286
LOWER IN 1-month-old human stage0.666667
2-month-old human stage0.666667
age 6 months0.500000
LOWER IN age 8 months0.500000
rhesus macaque0.500000
age 8 months0.500000
LOWER IN age 6 months0.500000
formula fed0.500000
age <= 24 hours0.500000
municipality of umea0.500000
breast fed0.500000
2-days-old human0.500000
LOWER IN 2-days-old human0.500000
LOWER IN 18-month-old human stage0.500000
18-month-old human stage0.500000
age 1 week0.500000
LOWER IN age one week0.500000
age one week0.500000
4-month-old human stage0.500000
bangladesh0.500000
LOWER IN breast fed0.500000
LOWER IN formula fed0.500000
hypopharynx0.500000
vellore district0.500000
diarrhea0.500000
LOWER IN bifidobacterium supplement0.500000
bifidobacterium supplement0.500000
LOWER IN age 7 months0.500000
age 7 months0.500000
1-year-old human stage0.466667
india0.428571
LOWER IN under-1-year-old human stage0.421053
under-1-year-old human stage0.421053
LOWER IN 1-year-old human stage0.400000
age0.333333
LOWER IN age &gt; 3 months0.333333
LOWER IN age &lt; 3 months0.333333
LOWER IN 2-year-old human stage0.333333
LOWER IN age 1-7 years0.333333
age 1-7 years0.333333
hispanic0.333333
LOWER IN 2-month-old human stage0.333333
age 1 month0.333333
LOWER IN age 1 month0.333333
LOWER IN newborn human stage0.250000
kingdom of denmark0.250000
LOWER IN age 1-3 years0.250000
age 1-3 years0.250000
hispanic or latin american0.250000
LOWER IN age 1 week0.250000
probiotics0.250000
sweden0.200000
LOWER IN 6-month-old human stage0.200000
macaca mulatta0.166667
kingdom of the netherlands0.166667
2-year-old human stage0.166667
LOWER IN state of oregon0.166667
state of oregon0.166667
LOWER IN 12-month-old human stage0.142857
finland0.142857
12-month-old human stage0.142857
LOWER IN infant0.115385
state of california0.115385
nasopharynx0.100000
hospital0.100000
nasal cavity0.090909
LOWER IN 2-5 year-old child stage0.090909
2-5 year-old child stage0.090909
child0.083333
monkey0.071429
control diet0.071429
LOWER IN control diet0.071429
homo sapiens0.066421
captive0.055556
city0.050000
feces0.047771
kingdom of spain0.047619
LOWER IN infant stage0.045455
infant stage0.045455
saliva0.043478
LOWER IN state of california0.038462
germany0.034483
LOWER IN child0.027778
female0.015873
united states of america0.008097
research facility0.006803
china0.005814
LOWER IN adult0.005780
adult0.005780
LOWER IN control0.005405
urban slum0.000000
age 6-12 months0.000000
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.904762
infant0.838095
feces0.761905
3-month-old human stage0.266667
1-month-old human stage0.228571
germany0.209524
age0.180952
formula fed0.161905
sweden0.161905
breast fed0.142857
6-month-old human stage0.142857
under-1-year-old human stage0.142857
state of california0.142857
saliva0.133333
child0.123810
hispanic or latin american0.114286
los angeles district0.114286
hispanic0.114286
LOWER IN 3-month-old human stage0.104762
kingdom of denmark0.095238
united states of america0.085714
india0.085714
research facility0.076190
macaca mulatta0.076190
monkey0.076190
captive0.076190
rhesus macaque0.076190
LOWER IN under-1-year-old human stage0.076190
LOWER IN 1-month-old human stage0.066667
1-year-old human stage0.066667
nasal cavity0.057143
nasopharynx0.057143
kingdom of the netherlands0.057143
municipality of umea0.057143
LOWER IN 1-year-old human stage0.057143
2-month-old human stage0.047619
kingdom of spain0.038095
bangladesh0.038095
dhaka0.038095
infant stage0.038095
urban slum0.038095
gambia0.038095
LOWER IN infant0.028571
LOWER IN breast fed0.028571
LOWER IN formula fed0.028571
city0.028571
vellore district0.028571
age 6-12 months0.028571
LOWER IN infant stage0.019048
age <= 24 hours0.019048
age 1 week0.019048
age one week0.019048
4-month-old human stage0.019048
LOWER IN 2-year-old human stage0.019048
female0.019048
finland0.019048
hypopharynx0.019048
hospital0.019048
diarrhea0.019048
china0.019048
LOWER IN age 7 months0.019048
age 7 months0.019048
age 6 months0.009524
LOWER IN age 8 months0.009524
age 8 months0.009524
LOWER IN age 6 months0.009524
LOWER IN newborn human stage0.009524
LOWER IN age &gt; 3 months0.009524
LOWER IN age &lt; 3 months0.009524
2-days-old human0.009524
LOWER IN 2-days-old human0.009524
LOWER IN child0.009524
LOWER IN 18-month-old human stage0.009524
18-month-old human stage0.009524
LOWER IN age one week0.009524
LOWER IN 12-month-old human stage0.009524
LOWER IN age 1-7 years0.009524
LOWER IN 2-5 year-old child stage0.009524
age 1-7 years0.009524
2-5 year-old child stage0.009524
LOWER IN age 1-3 years0.009524
age 1-3 years0.009524
2-year-old human stage0.009524
LOWER IN 6-month-old human stage0.009524
LOWER IN age 1 week0.009524
probiotics0.009524
LOWER IN control0.009524
LOWER IN age 6-12 months0.009524
12-month-old human stage0.009524
LOWER IN 2-month-old human stage0.009524
control diet0.009524
LOWER IN bifidobacterium supplement0.009524
bifidobacterium supplement0.009524
LOWER IN control diet0.009524
LOWER IN adult0.009524
adult0.009524
LOWER IN state of oregon0.009524
state of oregon0.009524
LOWER IN state of california0.009524
age 1 month0.009524
Exp. ID User ID Description Date Region Flag Sequences
596amnonpeaks at 6 months in human saliva ( high in 6-month-old human stage compared to 2-year-old human stage 3-month-old human stage 12-month-old human stage in homo sapiens saliva child sweden )2020-03-18v3No1 / 1
227amnonpeaks at age 1 month in baby nasopharynx ( high in age 1-month-old human stage compared to newborn human stage infant stage in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 2
227amnonpeaks at age 3 months in baby nasopharynx ( high in age 3-month-old human stage compared to age > 3 months age < 3 months infant stage in homo sapiens nasal cavity nasopharynx infant kingdom of the netherlands )2017-10-30v4No1 / 2
797amnon high in bifidobacterium supplement compared to control diet in feces homo sapiens infant germany formula fed 3-month-old human stage 2021-06-13v3No1 / 3
332amnonhigher in infants treated with Lactobacillus rhamnosus GG probiotics compared to non-treated ( high in probiotics compared to control in homo sapiens city infant vellore district india 2-month-old human stage )2018-05-14v4No1 / 5
797amnon high in control diet compared to bifidobacterium supplement in feces homo sapiens infant germany formula fed 3-month-old human stage 2021-06-13v3No1 / 5
891amnondominant feces, homo sapiens, infant, bangladesh, dhaka, infant stage, under-1-year-old human stage, urban slum2022-04-03v4No1 / 7
891amnoncommon feces, homo sapiens, infant, bangladesh, dhaka, infant stage, under-1-year-old human stage, urban slum2022-04-03v4No1 / 8
859amnon high in 1-month-old human stage compared to 6-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v4No1 / 8
332amnoncommon homo sapiens, city, infant, vellore district, india, 2-month-old human stage2018-05-14v4No1 / 8
227amnoncommon in baby nasopharynx age 1 day to 3 months (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 3-month-old human stage)2017-10-30v4No1 / 9
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 1-month-old human stage2021-06-13v3No1 / 9
332amnondominant homo sapiens, city, infant, vellore district, india, 2-month-old human stage2018-05-14v4No1 / 9
391amnoncommon feces, hospital, infant, diarrhea, china, under-1-year-old human stage2018-11-04v4No1 / 9
859amnoncommon feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 10
848amnoncommon feces, homo sapiens, infant, kingdom of spain, 4-month-old human stage2021-12-13v1No1 / 11
391amnondominant feces, hospital, infant, diarrhea, china, under-1-year-old human stage2018-11-04v4No1 / 11
227amnonhigh freq. in baby nasopharynx age 1 day to 3 months (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, 3-month-old human stage)2017-10-30v4No1 / 12
777amnondominant homo sapiens, saliva, infant, sweden, municipality of umea, 3-month-old human stage2021-04-26v3No1 / 12
669amnoncommon feces, homo sapiens, infant, sweden, 2-month-old human stage2020-09-26v4No1 / 12
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in age under-1-year-old human stage compared to age 1-3 years 2-year-old human stage 1-year-old human stage in feces homo sapiens infant )2017-11-13v4No1 / 13
859amnoncommon feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 13
859amnoncommon feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 13
797amnon high in breast fed compared to formula fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v3No1 / 13
669amnondominant feces, homo sapiens, infant, sweden, 2-month-old human stage2020-09-26v4No1 / 13
596amnondominant homo sapiens, saliva, infant, child, sweden, 6-month-old human stage2020-03-17v3No1 / 14
596amnondominant homo sapiens, saliva, child, sweden, 3-month-old human stage2020-03-17v3No1 / 14
797amnon high in breast fed compared to formula fed in feces homo sapiens infant germany 1-month-old human stage 2021-06-13v3No1 / 14
797amnon high in 1-month-old human stage compared to 3-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 14
797amnondominant feces, homo sapiens, infant, germany, breast fed, 3-month-old human stage2021-06-13v3No1 / 15
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 1-month-old human stage2021-06-13v3No1 / 15
596amnon high in 6-month-old human stage compared to 3-month-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 15
797amnoncommon feces, homo sapiens, infant, germany, breast fed, 3-month-old human stage2021-06-13v3No1 / 15
339amnondominant feces, homo sapiens, infant, india, under-1-year-old human stage2018-05-24v4No1 / 15
797amnon high in 3-month-old human stage compared to age 7 months in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 15
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 16
227amnonhigh freq. in baby nasopharynx age <= 1 day (dominant homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours, 1-month-old human stage)2017-10-30v4No1 / 17
859amnondominant feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 17
859amnondominant feces, homo sapiens, infant, state of california, breast fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 17
797amnoncommon feces, homo sapiens, infant, germany, formula fed, 3-month-old human stage2021-06-13v3No1 / 17
777amnoncommon homo sapiens, saliva, infant, sweden, municipality of umea, 3-month-old human stage2021-04-26v3No1 / 18
273amnondominant feces, homo sapiens, infant, kingdom of denmark, 1-month-old human stage2018-01-14v4No1 / 18
848amnoncommon feces, homo sapiens, infant, kingdom of spain, 6-month-old human stage2021-12-13v1No1 / 18
284amnondominant feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 18
797amnondominant feces, homo sapiens, infant, germany, formula fed, 1-month-old human stage2021-06-13v3No1 / 19
339amnoncommon feces, homo sapiens, infant, india, under-1-year-old human stage2018-05-24v4No1 / 19
797amnondominant feces, homo sapiens, infant, germany, formula fed, 3-month-old human stage2021-06-13v3No1 / 20
227amnoncommon in baby nasopharynx age <= 1 day (common homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours, 1-month-old human stage)2017-10-30v4No1 / 20
797amnondominant feces, homo sapiens, infant, germany, breast fed, 1-month-old human stage2021-06-13v3No1 / 20
273amnoncommon feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
273amnondominant feces, homo sapiens, infant, kingdom of denmark, age one week, 1-month-old human stage2018-01-14v4No1 / 20
848amnondominant feces, homo sapiens, infant, kingdom of spain, 4-month-old human stage2021-12-13v1No1 / 21
596amnoncommon homo sapiens, saliva, child, sweden, 3-month-old human stage2020-03-17v3No1 / 21
859amnoncommon feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 21
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 21
859amnon high in breast fed compared to formula fed in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 6-month-old human stage 2022-01-12v4No1 / 22
859amnondominant feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 1-month-old human stage2022-01-12v4No1 / 22
797amnon high in 1-month-old human stage compared to 3-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 22
872amnondominant feces, homo sapiens, infant, child, gambia, under-1-year-old human stage, age 6-12 months2022-02-26v1No1 / 24
848amnondominant feces, homo sapiens, infant, kingdom of spain, 6-month-old human stage2021-12-13v1No1 / 25
284amnoncommon feces, homo sapiens, female, infant, state of california, 6-month-old human stage2018-01-27v4No1 / 25
859amnondominant feces, homo sapiens, infant, state of california, formula fed, hispanic or latin american, los angeles district, hispanic, 6-month-old human stage2022-01-12v4No1 / 25
797amnon high in 3-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 27
797amnon high in age 7 months compared to 3-month-old human stage in feces homo sapiens infant germany breast fed 2021-06-13v3No1 / 28
797amnon high in 3-month-old human stage compared to age 7 months in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 29
596amnoncommon homo sapiens, saliva, infant, child, sweden, 6-month-old human stage2020-03-17v3No1 / 35
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in age under-1-year-old human stage compared to 1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 35
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in age age 1 week 1-month-old human stage compared to 3-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 35
233amnon high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens united states of america infant 2017-11-05v4No1 / 37
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 3-month-old human stage 2020-09-27v4No1 / 38
872amnoncommon feces, homo sapiens, infant, child, gambia, under-1-year-old human stage, age 6-12 months2022-02-26v1No1 / 39
797amnon high in 3-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 39
859amnon high in formula fed compared to breast fed in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 6-month-old human stage 2022-01-12v4No1 / 41
891amnon high in under-1-year-old human stage compared to 1-year-old human stage in feces homo sapiens infant bangladesh dhaka infant stage urban slum 2022-04-03v4No1 / 42
797amnon high in age 7 months compared to 3-month-old human stage in feces homo sapiens infant germany formula fed 2021-06-13v3No1 / 44
339amnon high in infant under-1-year-old human stage compared to adult in feces homo sapiens india 2018-05-24v4No1 / 50
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 3-month-old human stage 2020-09-27v4No1 / 52
45amnonhigher in younf babies compared to 2 year olds in india ( high in age under-1-year-old human stage compared to 1-year-old human stage in feces homo sapiens infant india )2016-12-19v4No1 / 56
872amnon high in infant under-1-year-old human stage age 6-12 months compared to 1-year-old human stage in feces homo sapiens child gambia 2022-02-26v1No1 / 63
671amnon high in age 1 month compared to 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 64
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 1-month-old human stage 2021-06-13v3No1 / 69
859amnon high in 6-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant state of california hispanic or latin american los angeles district hispanic 2022-01-12v4No1 / 72
797amnon high in formula fed compared to breast fed in feces homo sapiens infant germany 3-month-old human stage 2021-06-13v3No1 / 75
596amnon high in under-1-year-old human stage compared to age 1-7 years 2-5 year-old child stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 78
671amnon high in age 6 months 3-month-old human stage compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 79
777amnon high in infant 3-month-old human stage compared to child 18-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 79
777amnon high in 2-days-old human compared to 3-month-old human stage in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 104
273amnon high in age 1-month-old human stage compared to age one week 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 107
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in age 3-month-old human stage compared to age 1 week 1-month-old human stage in homo sapiens hypopharynx infant kingdom of denmark )2017-01-19v4No1 / 116
273amnon high in age age 1 week 1-month-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 127
273amnon high in age 1-month-old human stage compared to 1-year-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 155
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years 2-year-old human stage 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant )2017-11-13v4No1 / 173
872amnon high in 1-year-old human stage compared to infant under-1-year-old human stage age 6-12 months in feces homo sapiens child gambia 2022-02-26v1No1 / 188
777amnon high in 3-month-old human stage compared to 2-days-old human in homo sapiens saliva infant sweden municipality of umea 2021-04-26v3No1 / 197
669amnon high in 12-month-old human stage compared to 2-month-old human stage in feces homo sapiens infant sweden 2020-09-26v4No1 / 212
45amnonlower in young babies compared to 2 year olds in india ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant india )2016-12-19v4No1 / 253
596amnon high in age 1-7 years 2-5 year-old child stage compared to under-1-year-old human stage in homo sapiens saliva child sweden 2020-03-18v3No1 / 288
891amnon high in 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant bangladesh dhaka infant stage urban slum 2022-04-03v4No1 / 363
339amnon high in adult compared to infant under-1-year-old human stage in feces homo sapiens india 2018-05-24v4No1 / 457
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant finland )2017-11-12v4No1 / 567
777amnon high in child 18-month-old human stage compared to infant 3-month-old human stage in homo sapiens saliva sweden municipality of umea 2021-04-26v3No1 / 583
671amnon high in 3-month-old human stage compared to age 1 month in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 714
671amnon high in age 8 months compared to age 6 months 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955

Problems / suggestions? Please email info AT dbbact DOT org