Summary for ontology term: under-1-year-old human stage

Number of annotations with term: 126

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.473684
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.368421
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.368421
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.368421
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCGGTTCAATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGGAGAATTGCATCAGAAACTGTTGAACTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.368421
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.315789
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.315789
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.315789
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.263158
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__Pasteurellaceae;g__HaemophilusTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTTATTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCAGACTGGGTAACTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.263158

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG1.200000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__AnaerostipesTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAACCCAGGGCTTAACTCTGGGACTGCTTTTGAAACTGTCAGACTAGAGTGCAGGAGAGGTAAGCGGAATTCCTAG1.100000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Lachnospiracea_incertae_sedisTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAGTGCAAGTCAGATGTGAAAGGCCGGGGCTCAACCCCGGAGCTGCATTTGAAACTGCTCGGCTAGAGTACAGGAGAGGCAGGCGGAATTCCTAG1.100000
d__BacteriaTACGTAGGTGACAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGACTGTCAAGTCAGTCGTGAAATACCGGGGCTTAACCCCGGGGCTGCGATTGAAACTGACAGCCTTGAGTATCGGAGAGGAAAGCGGAATTCCTAG1.100000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Lachnospiracea_incertae_sedisTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAGTGCAAGTCAGATGTGAAAGGCCGGGGCTCAACCCCGGAGCTGCATTTGAAACTGCATAGCTAGAGTACAGGAGAGGCAGGCGGAATTCCTAG1.100000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__IntestinibacterTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTTAAGTCAGGAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTCTTGAAACTGGAGGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT1.100000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGATGCAAGTCTGAAGTGAAATACCCGGGCTCAACCTGGGAACTGCTTTGGAAACTGTATGGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG1.100000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG1.000000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAATCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG1.000000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGTTTCATAAGTCTGTCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGATGGAAACTATGGAACTGGAGTATCGGAGAGGAAAGCGGAATTCCTAGT0.666667
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGGGGGAACCCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGAGAAGAACGAGTGTGAGAGTGGAAAGTTCACGCTGTGACGGTATCTTACCAGAAAGGGACGG0.562500
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTAGGGAATCTTCCGCAATGGGCGAAAGCCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGATTTCGGTTCGTAAAGCTCTGTTGTTAGGGAAGAATGATTGTGTAGTAACTATACACATTAGAGACGGTACCTAACCAGAAAGCCACGGC0.518519
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTGTTAGGGAGCAAGGCACTTTGTGTTGAGTGTACCTTTCGAATAAGCACCGGCTAACTACGTGCCAGC0.454545
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGGGCTCGTAGGCGGCTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCTGCGCCGGGTACGGGCGGGCTGGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.415584
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTATCAGGGAGCAAGGCTTCGGTTGAGTGTACCTGTTGAATAAGCACCGGCTAACTACGTGCCAGCAGC0.411765
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTGGGGAATATTGCACAATGGGCGCAAGCCTGATGCAGCGACGCCGCGTGAGGGATGGAGGCCTTCGGGTTGTAAACCTCTTTTGTTAGGGAGCAAGGCATTTTTTGTTGAGTGTACCTTTCGAATAAGCACCGGCTAACTACGTGCCAGC0.411765
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTGGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGATGACGGCCTTCGGGTTGTAAAGCTCTGTTAATCGGGACGAATGGCTACCATGCGAATAGTGTGGGAGTTTGACGGTACCGGAATAGAAAGCCACGG0.400000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTAGGGAATCTTCGGCAATGGGGGCAACCCTGACCGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAGCTCTGTTGTAAGAGAAGAACGAGTGTGAGAGTGGAAAGTTCACGCTGTGACGGTATCTTACCAGAAAGGGACGG0.390244
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumGATGAACGCTGGCGGCGTGCTTAACACATGCAAGTCGAACGGGATCCATCGGGCTTTGCTTGGTGGTGAGAGTGGCGAACGGGTGAGTAATGCGTGACCGACCTGCCCCATACACCGGAATAGCTCCTGGAAACGGGTGGTAATGCCGGA0.384615

Annotations:

common ontology terms
term enrichment score
TermScore
infant0.759237
1-month-old human stage0.384071
3-month-old human stage0.352941
under-1-year-old human stage0.246914
formula fed0.230769
6-month-old human stage0.220386
breast fed0.217195
age0.207650
sweden0.165584
los angeles district0.160000
LOWER IN 3-month-old human stage0.158046
hispanic0.148148
2-month-old human stage0.143541
hispanic or latin american0.137931
LOWER IN under-1-year-old human stage0.132353
homo sapiens0.126839
state of victoria0.125000
LOWER IN 1-month-old human stage0.117994
1-year-old human stage0.115108
kingdom of denmark0.113636
india0.113208
edo state0.112676
state of california0.106762
rhesus macaque0.106667
LOWER IN 1-year-old human stage0.102190
nigeria0.091954
gambia0.088889
feces0.088311
municipality of umea0.086957
saliva0.085185
macaca mulatta0.084211
child0.079918
9-month-old human stage0.074906
kingdom of the netherlands0.068966
germany0.065089
nasopharynx0.064516
LOWER IN formula fed0.060914
LOWER IN breast fed0.060302
urban slum0.059701
dhaka0.059701
monkey0.059259
infant stage0.057971
bangladesh0.057971
nasal cavity0.057143
12-month-old human stage0.056338
australia0.045455
vellore district0.045455
age 6-12 months0.045455
captive0.044693
LOWER IN infant0.043165
kingdom of spain0.036036
LOWER IN 18-month-old human stage0.031008
LOWER IN 2-month-old human stage0.031008
age <= 24 hours0.030769
latvia0.030769
18-month-old human stage0.030769
age one week0.030769
4-month-old human stage0.030769
LOWER IN 9-month-old human stage0.030769
14-month-old human stage0.030769
13-month-old human stage0.030769
11-month-old human stage0.030769
10-month-old human stage0.030769
hypopharynx0.030769
LOWER IN age 7 months0.030769
city0.030769
LOWER IN infant stage0.030303
age 1 week0.030303
LOWER IN 12-month-old human stage0.030303
age 7 months0.030303
LOWER IN 2-year-old human stage0.029851
finland0.028169
diarrhea0.027778
hospital0.027397
rural community0.025316
LOWER IN age 6 months0.015625
age 8 months0.015625
LOWER IN newborn human stage0.015625
LOWER IN age &lt; 3 months0.015625
LOWER IN age 8 months0.015625
age 6 months0.015625
2-days-old human0.015625
LOWER IN 2-days-old human0.015625
LOWER IN age one week0.015625
8-month-old human stage0.015625
7-month-old human stage0.015625
LOWER IN 6-month-old human stage0.015625
LOWER IN age 6-12 months0.015625
LOWER IN bifidobacterium supplement0.015625
bifidobacterium supplement0.015625
LOWER IN state of oregon0.015625
LOWER IN state of california0.015625
LOWER IN age 1 month0.015625
LOWER IN age &gt; 3 months0.015504
LOWER IN age 1-7 years0.015504
age 1-7 years0.015504
LOWER IN age 1-3 years0.015504
age 1 month0.015504
LOWER IN 2-5 year-old child stage0.015385
age 1-3 years0.015385
Fraction of dbbact annotations with this term covered by the query
TermScore
under-1-year-old human stage0.909091
LOWER IN under-1-year-old human stage0.900000
1-month-old human stage0.875000
3-month-old human stage0.857143
LOWER IN 3-month-old human stage0.833333
LOWER IN 1-month-old human stage0.833333
6-month-old human stage0.833333
breast fed0.750000
2-month-old human stage0.750000
LOWER IN formula fed0.750000
infant0.676471
LOWER IN 18-month-old human stage0.666667
9-month-old human stage0.666667
LOWER IN 2-month-old human stage0.666667
gambia0.666667
LOWER IN 1-year-old human stage0.636364
1-year-old human stage0.615385
formula fed0.600000
LOWER IN breast fed0.600000
LOWER IN age 6 months0.500000
age 8 months0.500000
LOWER IN newborn human stage0.500000
LOWER IN age &lt; 3 months0.500000
LOWER IN age 8 months0.500000
age 6 months0.500000
age <= 24 hours0.500000
municipality of umea0.500000
latvia0.500000
2-days-old human0.500000
LOWER IN 2-days-old human0.500000
18-month-old human stage0.500000
LOWER IN age one week0.500000
age one week0.500000
4-month-old human stage0.500000
LOWER IN 9-month-old human stage0.500000
edo state0.500000
state of victoria0.500000
8-month-old human stage0.500000
7-month-old human stage0.500000
14-month-old human stage0.500000
13-month-old human stage0.500000
11-month-old human stage0.500000
10-month-old human stage0.500000
urban slum0.500000
dhaka0.500000
los angeles district0.500000
LOWER IN 6-month-old human stage0.500000
hypopharynx0.500000
vellore district0.500000
age 6-12 months0.500000
LOWER IN age 6-12 months0.500000
LOWER IN bifidobacterium supplement0.500000
bifidobacterium supplement0.500000
LOWER IN age 7 months0.500000
LOWER IN state of oregon0.500000
LOWER IN state of california0.500000
LOWER IN age 1 month0.500000
rhesus macaque0.333333
LOWER IN infant stage0.333333
age0.333333
LOWER IN age &gt; 3 months0.333333
age 1 week0.333333
LOWER IN 12-month-old human stage0.333333
LOWER IN age 1-7 years0.333333
age 1-7 years0.333333
infant stage0.333333
bangladesh0.333333
LOWER IN age 1-3 years0.333333
hispanic0.333333
age 7 months0.333333
age 1 month0.333333
india0.272727
LOWER IN 2-year-old human stage0.250000
LOWER IN 2-5 year-old child stage0.250000
12-month-old human stage0.250000
age 1-3 years0.250000
hispanic or latin american0.250000
probiotics0.250000
LOWER IN infant0.230769
sweden0.214286
kingdom of denmark0.200000
LOWER IN age 1 week0.200000
nigeria0.166667
state of oregon0.142857
macaca mulatta0.125000
kingdom of the netherlands0.125000
2-5 year-old child stage0.125000
finland0.125000
diarrhea0.111111
nasopharynx0.100000
2-year-old human stage0.100000
hospital0.100000
state of california0.096774
nasal cavity0.071429
LOWER IN child0.071429
homo sapiens0.068111
child0.065217
rural community0.062500
control diet0.058824
LOWER IN control diet0.058824
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.920635
infant0.865079
feces0.730159
1-month-old human stage0.246032
3-month-old human stage0.222222
saliva0.182540
germany0.174603
age0.150794
formula fed0.142857
under-1-year-old human stage0.142857
sweden0.134921
breast fed0.126984
6-month-old human stage0.126984
state of california0.119048
child0.103175
los angeles district0.095238
hispanic0.095238
hispanic or latin american0.095238
LOWER IN 3-month-old human stage0.087302
kingdom of denmark0.079365
2-month-old human stage0.079365
united states of america0.071429
LOWER IN under-1-year-old human stage0.071429
state of victoria0.071429
australia0.071429
india0.071429
monkey0.063492
rhesus macaque0.063492
macaca mulatta0.063492
research facility0.063492
captive0.063492
LOWER IN 1-month-old human stage0.063492
1-year-old human stage0.063492
edo state0.063492
nigeria0.063492
LOWER IN 1-year-old human stage0.055556
nasopharynx0.047619
nasal cavity0.047619
kingdom of the netherlands0.047619
municipality of umea0.047619
gambia0.047619
9-month-old human stage0.039683
kingdom of spain0.031746
LOWER IN formula fed0.031746
LOWER IN breast fed0.031746
12-month-old human stage0.031746
infant stage0.031746
urban slum0.031746
dhaka0.031746
bangladesh0.031746
LOWER IN infant0.023810
vellore district0.023810
city0.023810
age 6-12 months0.023810
LOWER IN infant stage0.015873
age <= 24 hours0.015873
latvia0.015873
LOWER IN 18-month-old human stage0.015873
18-month-old human stage0.015873
age 1 week0.015873
age one week0.015873
4-month-old human stage0.015873
LOWER IN 9-month-old human stage0.015873
LOWER IN 12-month-old human stage0.015873
LOWER IN 2-year-old human stage0.015873
14-month-old human stage0.015873
13-month-old human stage0.015873
11-month-old human stage0.015873
10-month-old human stage0.015873
LOWER IN 2-month-old human stage0.015873
female0.015873
finland0.015873
rural community0.015873
hypopharynx0.015873
hospital0.015873
china0.015873
diarrhea0.015873
LOWER IN age 7 months0.015873
age 7 months0.015873
LOWER IN age 6 months0.007937
age 8 months0.007937
LOWER IN newborn human stage0.007937
LOWER IN age &gt; 3 months0.007937
LOWER IN age &lt; 3 months0.007937
LOWER IN age 8 months0.007937
age 6 months0.007937
2-days-old human0.007937
LOWER IN 2-days-old human0.007937
LOWER IN child0.007937
LOWER IN age one week0.007937
8-month-old human stage0.007937
7-month-old human stage0.007937
LOWER IN 2-5 year-old child stage0.007937
LOWER IN age 1-7 years0.007937
2-5 year-old child stage0.007937
age 1-7 years0.007937
LOWER IN age 1-3 years0.007937
2-year-old human stage0.007937
age 1-3 years0.007937
LOWER IN 6-month-old human stage0.007937
Number of experiments associating the term to the sequence
TermScore
infant23.000000
homo sapiens22.000000
feces18.000000
under-1-year-old human stage10.000000
LOWER IN under-1-year-old human stage9.000000
1-year-old human stage8.000000
1-month-old human stage7.000000
age7.000000
LOWER IN 1-year-old human stage7.000000
3-month-old human stage6.000000
LOWER IN 3-month-old human stage5.000000
LOWER IN 1-month-old human stage5.000000
6-month-old human stage5.000000
formula fed3.000000
sweden3.000000
saliva3.000000
breast fed3.000000
LOWER IN infant3.000000
child3.000000
2-month-old human stage3.000000
LOWER IN formula fed3.000000
LOWER IN breast fed3.000000
state of california3.000000
india3.000000
united states of america2.000000
LOWER IN 18-month-old human stage2.000000
18-month-old human stage2.000000
kingdom of denmark2.000000
age 1 week2.000000
9-month-old human stage2.000000
LOWER IN 12-month-old human stage2.000000
LOWER IN 2-year-old human stage2.000000
12-month-old human stage2.000000
LOWER IN 2-month-old human stage2.000000
gambia2.000000
germany1.000000
LOWER IN age 6 months1.000000
age 8 months1.000000
monkey1.000000
rhesus macaque1.000000
macaca mulatta1.000000
research facility1.000000
captive1.000000
LOWER IN infant stage1.000000
LOWER IN newborn human stage1.000000
nasopharynx1.000000
nasal cavity1.000000
kingdom of the netherlands1.000000
LOWER IN age &gt; 3 months1.000000
LOWER IN age &lt; 3 months1.000000
LOWER IN age 8 months1.000000
age 6 months1.000000
age <= 24 hours1.000000
municipality of umea1.000000
latvia1.000000
2-days-old human1.000000
LOWER IN 2-days-old human1.000000
LOWER IN child1.000000
LOWER IN age one week1.000000
age one week1.000000
kingdom of spain1.000000
4-month-old human stage1.000000
LOWER IN 9-month-old human stage1.000000
edo state1.000000
nigeria1.000000
state of victoria1.000000
australia1.000000
8-month-old human stage1.000000
7-month-old human stage1.000000
LOWER IN 2-5 year-old child stage1.000000
LOWER IN age 1-7 years1.000000
2-5 year-old child stage1.000000
age 1-7 years1.000000
14-month-old human stage1.000000
13-month-old human stage1.000000
11-month-old human stage1.000000
10-month-old human stage1.000000
female1.000000
infant stage1.000000
urban slum1.000000
dhaka1.000000
bangladesh1.000000
finland1.000000
rural community1.000000
LOWER IN age 1-3 years1.000000
2-year-old human stage1.000000
age 1-3 years1.000000
los angeles district1.000000
hispanic1.000000
hispanic or latin american1.000000
LOWER IN 6-month-old human stage1.000000
hypopharynx1.000000
LOWER IN age 1 week1.000000
vellore district1.000000
city1.000000
probiotics1.000000
hospital1.000000
china1.000000
diarrhea1.000000
age 6-12 months1.000000
LOWER IN age 6-12 months1.000000
LOWER IN bifidobacterium supplement1.000000
control diet1.000000
LOWER IN control diet1.000000
bifidobacterium supplement1.000000
LOWER IN age 7 months1.000000
LOWER IN state of oregon1.000000
LOWER IN state of california1.000000
state of oregon1.000000
age 7 months1.000000
age 1 month1.000000
LOWER IN age 1 month1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
919amnon high in breast fed compared to formula fed in 2-month-old human stage 1-month-old human stage state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 1approvedNo
596amnonpeaks at 6 months in human saliva ( high in 6-month-old human stage compared to 12-month-old human stage 3-month-old human stage 2-year-old human stage in homo sapiens sweden saliva child )2020-03-18v31 / 1approvedNo
227amnonpeaks at age 1 month in baby nasopharynx ( high in 1-month-old human stage age compared to infant stage newborn human stage in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v41 / 2approvedNo
227amnonpeaks at age 3 months in baby nasopharynx ( high in 3-month-old human stage age compared to infant stage age > 3 months age < 3 months in homo sapiens nasopharynx nasal cavity infant kingdom of the netherlands )2017-10-30v41 / 2approvedNo
919amnon high in formula fed compared to breast fed in 2-month-old human stage 1-month-old human stage state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 3approvedNo
966amnon high in under-1-year-old human stage compared to 1-year-old human stage in infant gambia rural community homo sapiens feces 2022-12-21v31 / 3approvedNo
966amnon high in 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens rural community gambia infant 2022-12-21v31 / 3approvedNo
797amnon high in bifidobacterium supplement compared to control diet in 3-month-old human stage formula fed germany infant feces homo sapiens 2021-06-13v31 / 3approvedNo
332amnonhigher in infants treated with Lactobacillus rhamnosus GG probiotics compared to non-treated ( high in probiotics compared to control in 2-month-old human stage homo sapiens infant vellore district city india )2018-05-14v41 / 5approvedNo
797amnon high in control diet compared to bifidobacterium supplement in 3-month-old human stage formula fed germany infant feces homo sapiens 2021-06-13v31 / 5approvedNo
919amnondominant 2-month-old human stage, 1-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 6approvedNo
919amnon high in 2-month-old human stage compared to 12-month-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 7approvedNo
891amnondominant urban slum, under-1-year-old human stage, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v41 / 7approvedNo
960amnoncommon 1-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 8approvedNo
891amnoncommon under-1-year-old human stage, urban slum, infant stage, dhaka, bangladesh, infant, homo sapiens, feces2022-04-03v41 / 8approvedNo
859amnon high in 1-month-old human stage compared to 6-month-old human stage in hispanic los angeles district hispanic or latin american state of california infant homo sapiens feces 2022-01-12v41 / 8approvedNo
332amnoncommon 2-month-old human stage, homo sapiens, infant, vellore district, city, india2018-05-14v41 / 8approvedNo
227amnoncommon in baby nasopharynx age 1 day to 3 months (common 3-month-old human stage, homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age)2017-10-30v41 / 9approvedNo
797amnoncommon 1-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 9approvedNo
332amnondominant 2-month-old human stage, homo sapiens, infant, vellore district, city, india2018-05-14v41 / 9approvedNo
391amnoncommon under-1-year-old human stage, feces, infant, hospital, china, diarrhea2018-11-04v41 / 9approvedNo
1019amnoncommon latvia, under-1-year-old human stage, infant, feces, homo sapiens2023-04-03v31 / 10approvedNo
919amnoncommon saliva, 2-month-old human stage, 1-month-old human stage, infant, state of victoria, australia, homo sapiens2022-07-17v41 / 10approvedNo
859amnoncommon formula fed, 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v41 / 10approvedNo
848amnoncommon 4-month-old human stage, kingdom of spain, infant, homo sapiens, feces2021-12-13v11 / 11approvedNo
391amnondominant under-1-year-old human stage, feces, infant, hospital, china, diarrhea2018-11-04v41 / 11approvedNo
227amnonhigh freq. in baby nasopharynx age 1 day to 3 months (dominant 3-month-old human stage, homo sapiens, nasopharynx, nasal cavity, infant, kingdom of the netherlands, age)2017-10-30v41 / 12approvedNo
777amnondominant 3-month-old human stage, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v31 / 12approvedNo
669amnoncommon 2-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v41 / 12approvedNo
241amnonhigher in babies age <1 year compared to age 1-3 years ( high in under-1-year-old human stage age compared to 2-year-old human stage 1-year-old human stage age 1-3 years in homo sapiens feces infant )2017-11-13v41 / 13approvedNo
859amnoncommon breast fed, 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v41 / 13approvedNo
859amnoncommon breast fed, 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v41 / 13approvedNo
797amnon high in breast fed compared to formula fed in 3-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 13approvedNo
669amnondominant 2-month-old human stage, sweden, infant, feces, homo sapiens2020-09-26v41 / 13approvedNo
596amnondominant 6-month-old human stage, homo sapiens, sweden, saliva, child, infant2020-03-17v31 / 14approvedNo
596amnondominant 3-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v31 / 14approvedNo
919amnondominant 14-month-old human stage, 13-month-old human stage, 12-month-old human stage, 11-month-old human stage, 10-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 14approvedNo
797amnon high in breast fed compared to formula fed in 1-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 14approvedNo
797amnon high in 1-month-old human stage compared to 3-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v31 / 14approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 1-month-old human stage2022-12-20v41 / 15approvedNo
596amnon high in 6-month-old human stage compared to 3-month-old human stage in homo sapiens sweden saliva child 2020-03-18v31 / 15approvedNo
797amnoncommon 3-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 15approvedNo
797amnondominant 3-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 15approvedNo
797amnoncommon 1-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 15approvedNo
339amnondominant under-1-year-old human stage, homo sapiens, feces, infant, india2018-05-24v41 / 15approvedNo
797amnon high in 3-month-old human stage compared to age 7 months in breast fed germany infant homo sapiens feces 2021-06-13v31 / 15approvedNo
273amnoncommon 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v41 / 16approvedNo
227amnonhigh freq. in baby nasopharynx age <= 1 day (dominant 1-month-old human stage, homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v41 / 17approvedNo
859amnondominant 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, breast fed, state of california, infant, homo sapiens, feces2022-01-12v41 / 17approvedNo
859amnondominant 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, breast fed, state of california, infant, homo sapiens, feces2022-01-12v41 / 17approvedNo
797amnoncommon 3-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 17approvedNo
777amnoncommon 3-month-old human stage, infant, municipality of umea, sweden, saliva, homo sapiens2021-04-26v31 / 18approvedNo
273amnondominant 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant2018-01-14v41 / 18approvedNo
848amnoncommon 6-month-old human stage, infant, kingdom of spain, feces, homo sapiens2021-12-13v11 / 18approvedNo
284amnondominant 6-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v41 / 18approvedNo
797amnondominant 1-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 19approvedNo
339amnoncommon under-1-year-old human stage, homo sapiens, feces, infant, india2018-05-24v41 / 19approvedNo
797amnondominant 3-month-old human stage, formula fed, infant, germany, homo sapiens, feces2021-06-13v31 / 20approvedNo
227amnoncommon in baby nasopharynx age <= 1 day (common 1-month-old human stage, homo sapiens, nasal cavity, nasopharynx, age, infant, kingdom of the netherlands, age <= 24 hours)2017-10-30v41 / 20approvedNo
797amnondominant 1-month-old human stage, breast fed, infant, germany, homo sapiens, feces2021-06-13v31 / 20approvedNo
273amnoncommon 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v41 / 20approvedNo
273amnondominant 1-month-old human stage, feces, homo sapiens, kingdom of denmark, infant, age one week2018-01-14v41 / 20approvedNo
1019amnondominant homo sapiens, feces, infant, under-1-year-old human stage, latvia2023-04-03v31 / 21approvedNo
848amnondominant 4-month-old human stage, kingdom of spain, infant, homo sapiens, feces2021-12-13v11 / 21approvedNo
596amnoncommon 3-month-old human stage, homo sapiens, sweden, saliva, child2020-03-17v31 / 21approvedNo
859amnoncommon formula fed, 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, state of california, infant, homo sapiens, feces2022-01-12v41 / 21approvedNo
671amnondominant 3-month-old human stage, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 21approvedNo
960amnondominant homo sapiens, nigeria, edo state, infant, feces, 9-month-old human stage2022-12-20v41 / 22approvedNo
859amnon high in breast fed compared to formula fed in 6-month-old human stage hispanic los angeles district hispanic or latin american state of california infant homo sapiens feces 2022-01-12v41 / 22approvedNo
859amnondominant 1-month-old human stage, hispanic, los angeles district, hispanic or latin american, formula fed, state of california, infant, homo sapiens, feces2022-01-12v41 / 22approvedNo
797amnon high in 1-month-old human stage compared to 3-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v31 / 22approvedNo
960amnoncommon 9-month-old human stage, feces, infant, edo state, nigeria, homo sapiens2022-12-20v41 / 24approvedNo
872amnondominant age 6-12 months, under-1-year-old human stage, gambia, child, infant, homo sapiens, feces2022-02-26v11 / 24approvedNo
848amnondominant 6-month-old human stage, kingdom of spain, infant, homo sapiens, feces2021-12-13v11 / 25approvedNo
284amnoncommon 6-month-old human stage, homo sapiens, female, feces, state of california, infant2018-01-27v41 / 25approvedNo
859amnondominant 6-month-old human stage, hispanic, los angeles district, hispanic or latin american, formula fed, state of california, infant, homo sapiens, feces2022-01-12v41 / 25approvedNo
797amnon high in 3-month-old human stage compared to 1-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v31 / 27approvedNo
797amnon high in age 7 months compared to 3-month-old human stage in breast fed germany infant homo sapiens feces 2021-06-13v31 / 28approvedNo
797amnon high in 3-month-old human stage compared to age 7 months in formula fed germany infant homo sapiens feces 2021-06-13v31 / 29approvedNo
919amnoncommon 9-month-old human stage, 8-month-old human stage, 7-month-old human stage, 6-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 34approvedNo
596amnoncommon 6-month-old human stage, homo sapiens, sweden, saliva, child, infant2020-03-17v31 / 35approvedNo
240amnonhigher in infants age<1 year compared to 1-3 years in baby feces ( high in under-1-year-old human stage age compared to 1-year-old human stage in homo sapiens feces infant finland )2017-11-12v41 / 35approvedNo
48amnonlower in 3 months compared to 1 week in infant hypopharynx ( high in 1-month-old human stage age age 1 week compared to 3-month-old human stage in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v41 / 35approvedNo
960amnon high in 1-month-old human stage compared to 9-month-old human stage in feces infant edo state nigeria homo sapiens 2022-12-20v41 / 37approvedNo
233amnon high in 1-year-old human stage age compared to under-1-year-old human stage in feces homo sapiens infant united states of america 2017-11-05v41 / 37approvedNo
671amnon high in state of oregon compared to state of california in 3-month-old human stage united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 38approvedNo
872amnoncommon age 6-12 months, under-1-year-old human stage, infant, gambia, child, homo sapiens, feces2022-02-26v11 / 39approvedNo
797amnon high in 3-month-old human stage compared to 1-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v31 / 39approvedNo
859amnon high in formula fed compared to breast fed in los angeles district state of california hispanic hispanic or latin american 6-month-old human stage infant feces homo sapiens 2022-01-12v41 / 41approvedNo
891amnon high in under-1-year-old human stage compared to 1-year-old human stage in infant infant stage urban slum homo sapiens feces dhaka bangladesh 2022-04-03v41 / 42approvedNo
797amnon high in age 7 months compared to 3-month-old human stage in formula fed germany infant homo sapiens feces 2021-06-13v31 / 44approvedNo
339amnon high in under-1-year-old human stage infant compared to adult in homo sapiens feces india 2018-05-24v41 / 50approvedNo
671amnon high in state of california compared to state of oregon in 3-month-old human stage united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v41 / 52approvedNo
45amnonhigher in younf babies compared to 2 year olds in india ( high in under-1-year-old human stage age compared to 1-year-old human stage in homo sapiens feces infant india )2016-12-19v41 / 56approvedNo
919amnoncommon 14-month-old human stage, 13-month-old human stage, 12-month-old human stage, 11-month-old human stage, 10-month-old human stage, state of victoria, australia, infant, saliva, homo sapiens2022-07-17v41 / 62approvedNo
872amnon high in infant age 6-12 months under-1-year-old human stage compared to 1-year-old human stage in gambia child homo sapiens feces 2022-02-26v11 / 63approvedNo
671amnon high in age 1 month compared to 3-month-old human stage in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v41 / 64approvedNo
797amnon high in formula fed compared to breast fed in 1-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 69approvedNo
859amnon high in 6-month-old human stage compared to 1-month-old human stage in hispanic los angeles district hispanic or latin american state of california infant homo sapiens feces 2022-01-12v41 / 72approvedNo
960amnon high in 9-month-old human stage compared to 18-month-old human stage in feces infant edo state nigeria homo sapiens 2022-12-20v41 / 74approvedNo
797amnon high in formula fed compared to breast fed in 3-month-old human stage germany infant feces homo sapiens 2021-06-13v31 / 75approvedNo
596amnon high in under-1-year-old human stage compared to 2-5 year-old child stage age 1-7 years in homo sapiens sweden saliva child 2020-03-18v31 / 78approvedNo
671amnon high in 3-month-old human stage age 6 months compared to age 8 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v41 / 79approvedNo
777amnon high in 3-month-old human stage infant compared to 18-month-old human stage child in municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 79approvedNo
777amnon high in 2-days-old human compared to 3-month-old human stage in infant municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 104approvedNo
273amnon high in 1-month-old human stage age compared to 1-month-old human stage age one week in feces homo sapiens kingdom of denmark infant 2018-01-14v41 / 107approvedNo
48amnonhigher in 3 months compared to 1 week in infant hypopharynx ( high in 3-month-old human stage age compared to 1-month-old human stage age 1 week in homo sapiens kingdom of denmark hypopharynx infant )2017-01-19v41 / 116approvedNo
273amnon high in 1-month-old human stage age age 1 week compared to 1-month-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v41 / 127approvedNo
273amnon high in 1-month-old human stage age compared to 1-year-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v41 / 155approvedNo
919amnon high in 12-month-old human stage compared to 2-month-old human stage in state of victoria australia infant saliva homo sapiens 2022-07-17v41 / 164approvedNo
671amnoncommon 3-month-old human stage, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v41 / 170approvedNo
241amnonlower in babies age <1 year compared to age 1-3 years ( high in 2-year-old human stage 1-year-old human stage age age 1-3 years compared to under-1-year-old human stage in homo sapiens feces infant )2017-11-13v41 / 173approvedNo
872amnon high in 1-year-old human stage compared to infant age 6-12 months under-1-year-old human stage in gambia child homo sapiens feces 2022-02-26v11 / 188approvedNo
777amnon high in 3-month-old human stage compared to 2-days-old human in infant homo sapiens saliva sweden municipality of umea 2021-04-26v31 / 197approvedNo
669amnon high in 12-month-old human stage compared to 2-month-old human stage in sweden infant feces homo sapiens 2020-09-26v41 / 212approvedNo
960amnon high in 9-month-old human stage compared to 1-month-old human stage in homo sapiens nigeria edo state infant feces 2022-12-20v41 / 244approvedNo
45amnonlower in young babies compared to 2 year olds in india ( high in 1-year-old human stage age compared to under-1-year-old human stage in homo sapiens feces infant india )2016-12-19v41 / 253approvedNo
596amnon high in 2-5 year-old child stage age 1-7 years compared to under-1-year-old human stage in homo sapiens sweden saliva child 2020-03-18v31 / 288approvedNo
891amnon high in 1-year-old human stage compared to under-1-year-old human stage in urban slum infant stage dhaka bangladesh infant homo sapiens feces 2022-04-03v41 / 363approvedNo
960amnon high in 18-month-old human stage compared to 9-month-old human stage in homo sapiens nigeria edo state infant feces 2022-12-20v41 / 407approvedNo
339amnon high in adult compared to under-1-year-old human stage infant in homo sapiens feces india 2018-05-24v41 / 457approvedNo
273amnon high in 1-year-old human stage age compared to 1-month-old human stage in feces homo sapiens kingdom of denmark infant 2018-01-14v41 / 557approvedNo
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in 1-year-old human stage age compared to under-1-year-old human stage in homo sapiens feces infant finland )2017-11-12v41 / 567approvedNo
777amnon high in 18-month-old human stage child compared to 3-month-old human stage infant in municipality of umea sweden saliva homo sapiens 2021-04-26v31 / 583approvedNo
671amnon high in 3-month-old human stage compared to age 1 month in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v41 / 714approvedNo
671amnon high in age 8 months compared to 3-month-old human stage age 6 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v41 / 955approvedNo

Problems / suggestions? Please email info AT dbbact DOT org