Summary for ontology term: united kingdom

Number of annotations with term: 198

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__RhodobiaceaeTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGGGTGAAGAAGGCCTTAGGGTTGTAAACCCCTTTCAGCGGGGAAGATAATGACGGTACCCGCAGAAGAAGTCCCGGCTAACTCCGTGCCAGCAGCCGCGGTA0.205323
d__BacteriaTGGGGGATCTTGCGCTAATGCGCGAAAGCGTGACGCAGCGACGCCGCGTGGGGGATGAAGGCCTTCGGGTTGTAAACCCCTTTCGGCAGGGACGAAGGGAAACTGACGGTACCTGCAGAAGAAGTCCCGGCTAACTACGTGCCAGCAGCC0.195652
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGGGTGATGAAGGCCCTAGGGTTGTAAAGCCCTTTCGGCGGGGAAGATAATGACGGTACCCGCAGAAGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.194444
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__BradyrhizobiaceaeTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGAGTGATGAAGGCCCTAGGGTTGTAAAGCTCTTTTGTGCGGGAAGATAATGACGGTACCGCAAGAATAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.192893
d__BacteriaTGGGGAATATTGCGCAATGGGCGAAAGCTTGACGCAGCAACGCCGCGTGAGTGATGAAGGCCTTCGGGTCGTAAAGCTCTGTCGGGAGGAACGAATGCTCCTGAGGTTAACAGCCTCGGGAGGTGACGGTACCTTCAAAGGAAGCACCGG0.179688
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaTGGGGAATATTGGACAATGGGGGAAACCCTGATCCAGCAATGCCGCGTGAGTGAAGAAGGCCTTAGGGTTGTAAAGCTCTTTCGGCGGGGACGATGGTGACGGTACCCGCAGAAGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.168675
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Acidimicrobiales;f__Acidimicrobiaceae;g__IlumatobacterTGGGGAATCTTGCACAATGGGCGAAAGCCTGATGCAGCAACGCCGCGTGCGGGAAGAAGGCCTTAGGGTTGTAAACCGCTTTCAGCAGGGAAGAAAATGACGGTACCTGTAGAAGAAGGTGCGGCCAACTACGTGCCAGCAGCCGCGGTG0.167300
d__BacteriaTGGGGAATATTGCGCAATGGGCGAAAGCCTGACGCAGCGACGCCGCGTGTGGGATGACGGCCTTCGGGTTGTAAACCACTGTCGGGAGGGACGAAATCAATGACGGTACCTCCAAAGGAAGCACCGGCTAACTCTGTGCCAGCAGCCGCG0.166667
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaTGGGGAATCTTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGAGTGAAGAAGGCCTTCGGGTTGTAAAGCTCTTTTACCAGGGACGATAATGACGGTACCTGGAGAATAAGCCCCGGCAAACTTCGTGCCAGCAGCCGCGGTA0.160584
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp1;g__Gp1TGGGGAATTTTGCGCAATGGGGGAAACCCTGACGCAGCAACGCCGCGTGGAGGATGAAGTCCCTTGGGACGTAAACTCCTTTCGACCCGGACGATAATGACGGTACGGGTGGAAGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.157303

Annotations:

common ontology terms
term enrichment score
TermScore
united kingdom0.494352
cambridge0.302817
rare charitable research reserve0.302817
grand river watershed0.302817
luvisol0.214286
province of ontario0.208232
meadow ecosystem0.175000
solidago0.175000
apocynum0.175000
dipsacus fullonum0.175000
decomissioned agricultural field0.175000
forest0.168067
fagus grandifolia0.168067
acer saccharum subsp. nigrum0.168067
acer saccharum0.168067
quercus rubra0.168067
quercus alba0.168067
quercus velutina0.168067
scotland0.163488
daucus carota0.160920
forested area0.143885
depth 15-30cm0.139130
brunisol0.139130
manchester0.132075
chicken0.126949
gallus gallus0.124318
perth0.123894
canada0.118343
depth 0-15cm0.116071
age 1-3 years0.110236
gleysol0.108108
sihong county0.108108
poplar0.108108
poplar plantation0.108108
chenwei forest0.108108
mature forest0.108108
depth 30-45cm0.108108
cambridgeshire0.108108
clay loam0.102564
newt0.102564
recurrent otitis media0.100000
2-year-old human stage0.099291
ph 6-70.088106
equus caballus0.082305
horse0.082305
caecum0.082051
old growth forest0.074766
oak0.074766
jiangsu province0.072727
park0.072072
quercus0.072072
drinking water0.071942
depth (soil) 0-30 cm0.069565
1-year-old human stage0.068627
child0.064103
sus scrofa0.058824
pig0.058824
gaz:000521000.057143
temperate grassland biome0.057143
flooded grassland biome0.057143
LOWER IN depth 15-30cm0.057143
lissotriton vulgaris0.057143
triturus cristatus0.057143
age 18 weeks0.057143
research facility0.055886
overweight body mass index status0.055556
middle ear0.055556
fen0.055556
colonic mucosa0.055556
soil0.055179
peat soil0.054054
australia0.053846
farm0.052910
age 6 weeks0.052632
mouse0.052083
digestive system0.051546
obesity0.050000
mus musculus0.048309
depth (soil) 0-20cm0.047619
england0.047619
age 30 days0.046948
nasopharynx0.046512
age 1 week0.045872
control0.043418
fish0.041667
skin0.040404
feces0.040252
glasgow0.039604
adult0.039085
edinburgh0.038835
drosophila melanogaster0.038835
LOWER IN depth 0-15cm0.038835
city of london0.038835
fruit fly0.038095
depth 5cm0.036697
sputum0.036697
intestine0.034483
LOWER IN control0.033830
ileum0.030534
diet0.030303
Fraction of dbbact annotations with this term covered by the query
TermScore
crohn's disease1.000000
glasgow1.000000
LOWER IN crohn's disease1.000000
manchester1.000000
lumen of colon1.000000
LOWER IN lumen of colon1.000000
spring1.000000
standard feed0.666667
LOWER IN standard feed0.666667
united kingdom0.521739
gleysol0.500000
sihong county0.500000
poplar0.500000
poplar plantation0.500000
chenwei forest0.500000
depth 30-4cm0.500000
depth 40-50cm0.500000
caudal teeth0.500000
LOWER IN rostral teeth0.500000
edinburgh0.500000
LOWER IN weight loss0.500000
LOWER IN weight loss diet0.500000
gaz:000521000.500000
weight loss0.500000
weight loss diet0.500000
drosophila melanogaster0.500000
cmy diet0.500000
LOWER IN cmy diet0.500000
campylobacter0.500000
LOWER IN campylobacter0.500000
age 15 - 35 days0.500000
recurrent otitis media0.500000
perth0.500000
LOWER IN recurrent otitis media0.500000
middle ear fluid0.500000
middle ear rinse0.500000
LOWER IN middle ear rinse0.500000
LOWER IN middle ear fluid0.500000
LOWER IN sucram0.500000
sucram0.500000
temperate grassland biome0.500000
flooded grassland biome0.500000
cyprinus carpio0.500000
common carp0.500000
depth 0-15cm0.500000
LOWER IN depth 15-30cm0.500000
luvisol0.500000
cambridge0.500000
rare charitable research reserve0.500000
grand river watershed0.500000
preston flats0.500000
depth 15-30cm0.500000
LOWER IN depth 0-15cm0.500000
forest0.500000
fagus grandifolia0.500000
acer saccharum subsp. nigrum0.500000
acer saccharum0.500000
quercus rubra0.500000
quercus alba0.500000
quercus velutina0.500000
brunisol0.500000
mature forest0.500000
depth 30-45cm0.500000
old growth forest0.500000
meadow ecosystem0.500000
solidago0.500000
apocynum0.500000
dipsacus fullonum0.500000
decomissioned agricultural field0.500000
LOWER IN depth 30-45cm0.500000
LOWER IN cyprinus carpio0.500000
LOWER IN common carp0.500000
cambridgeshire0.500000
lissotriton vulgaris0.500000
triturus cristatus0.500000
LOWER IN high wellfare feed0.500000
city of london0.500000
high wellfare feed0.500000
great britain0.500000
liverpool0.500000
age 42 days0.500000
LOWER IN equine grass sickness0.500000
equine grass sickness0.500000
LOWER IN age 18 weeks0.500000
age 18 weeks0.500000
ulva0.500000
calvert island0.500000
alga0.500000
ulva lactuca0.500000
oak0.500000
acute oak decline0.500000
LOWER IN acute oak decline0.500000
saline water aquarium0.500000
scylla paramamosain0.500000
mud crab0.500000
polga mutant0.500000
LOWER IN wild type genotype0.500000
wild type genotype0.500000
LOWER IN polga mutant0.500000
scotland0.428571
Fraction of annotations for the query sequences containing the term
TermScore
united kingdom0.469697
soil0.308081
canada0.227273
province of ontario0.217172
cambridge0.217172
rare charitable research reserve0.217172
grand river watershed0.217172
feces0.207071
research facility0.156566
luvisol0.136364
adult0.126263
daucus carota0.106061
meadow ecosystem0.106061
solidago0.106061
apocynum0.106061
dipsacus fullonum0.106061
decomissioned agricultural field0.106061
scotland0.101010
forested area0.101010
forest0.101010
fagus grandifolia0.101010
acer saccharum subsp. nigrum0.101010
acer saccharum0.101010
quercus rubra0.101010
quercus alba0.101010
quercus velutina0.101010
mus musculus0.101010
mouse0.101010
gallus gallus0.095960
chicken0.095960
homo sapiens0.090909
caecum0.080808
depth 15-30cm0.080808
brunisol0.080808
child0.075758
ph 6-70.075758
china0.075758
australia0.070707
age 1-3 years0.070707
perth0.070707
2-year-old human stage0.070707
1-year-old human stage0.070707
manchester0.070707
control0.065657
depth 0-15cm0.065657
jiangsu province0.060606
clay loam0.060606
gleysol0.060606
sihong county0.060606
poplar0.060606
poplar plantation0.060606
chenwei forest0.060606
mature forest0.060606
depth 30-45cm0.060606
skin0.060606
cambridgeshire0.060606
newt0.060606
recurrent otitis media0.055556
sus scrofa0.055556
pig0.055556
farm0.050505
equus caballus0.050505
horse0.050505
digestive system0.050505
water0.050505
drinking water0.050505
depth (soil) 0-20cm0.045455
old growth forest0.040404
park0.040404
rhizosphere0.040404
quercus0.040404
oak0.040404
depth (soil) 0-30 cm0.040404
LOWER IN control0.035354
obesity0.030303
overweight body mass index status0.030303
gaz:000521000.030303
nasopharynx0.030303
middle ear0.030303
fen0.030303
peat soil0.030303
temperate grassland biome0.030303
flooded grassland biome0.030303
intestine0.030303
england0.030303
fish0.030303
LOWER IN depth 15-30cm0.030303
lissotriton vulgaris0.030303
triturus cristatus0.030303
disease0.030303
age 6 weeks0.030303
age 18 weeks0.030303
colonic mucosa0.030303
age 1 week0.025253
age 30 days0.025253
glasgow0.020202
dentition0.020202
edinburgh0.020202
drosophila melanogaster0.020202
fruit fly0.020202
Exp. ID User ID Description Date Region Flag Sequences
599amnon high in caudal teeth compared to rostral teeth in farm dentition equus caballus scotland horse edinburgh 2020-03-25v4No1 / 1
244amnon high in diet cmy diet compared to starch diet in digestive system research facility drosophila melanogaster fruit fly united kingdom 2017-11-15v4No1 / 1
244amnon high in diet starch diet compared to cmy diet in digestive system research facility drosophila melanogaster fruit fly united kingdom 2017-11-15v4No1 / 1
256amnonhigher in illeum compared to other gi tract locations in pigs ( high in ileum compared to caecum duodenum jejunum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 1
84amnondominant fen, soil, peat soil, temperate grassland biome, flooded grassland biome, depth 5cm, united kingdom2017-03-07v4No1 / 1
379amnonhigher in chickens infeceted with campylobacter at age 20 days compared to noninfected controls ( high in campylobacter compared to control in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 2
110amnondominant water, drinking water, scotland, site c2017-04-08v4No1 / 2
110amnondominant water, drinking water, scotland, site b2017-04-08v4No1 / 2
828sheryoDominant in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (dominant soil, jiangsu province, depth (soil) 0-10cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 3
842sheryoDominant in soil depth of 0-15cm in a mature forest in Ontario, Canada (dominant soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 0-15cm, mature forest)2021-11-14v3No1 / 3
84amnondominant fen, soil, peat soil, temperate grassland biome, flooded grassland biome, depth 20cm, united kingdom2017-03-07v4No1 / 4
110amnondominant water, drinking water, scotland, site a2017-04-08v4No1 / 4
828sheryoDominant in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (dominant soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, depth 10-20cm, poplar plantation, chenwei forest)2021-08-25v4No1 / 5
842sheryoDominant in soil depth of 0-15cm in an old growth forest in Ontario, Canada (dominant soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 0-15cm, old growth forest)2021-11-14v3No1 / 5
842sheryoDominant in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant soil, canada, province of ontario, daucus carota, meadow ecosystem, luvisol, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 0-15cm, decomissioned agricultural field)2021-11-14v3No1 / 5
842sheryoDominant in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant soil, canada, province of ontario, daucus carota, meadow ecosystem, luvisol, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 0-15cm, decomissioned agricultural field)2021-11-14v3No1 / 5
448amnonhigh freq. in healthy horse feces (dominant feces, control, farm, equus caballus, horse, united kingdom)2019-01-08v4No1 / 5
605amnoncommon control, nasopharynx, child, australia, age 1-3 years, perth, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 6
605amnoncommon middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear rinse, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 6
842sheryoDominant in soil depth of 0-15cm in a mature forest in Ontario, Canada (dominant soil, canada, province of ontario, forested area, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, brunisol, mature forest)2021-11-14v3No1 / 6
842sheryoDominant in soil depth of 15-30cm in a mature forest in Ontario, Canada (dominant soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 15-30cm, mature forest)2021-11-14v3No1 / 6
842sheryoDominant in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant soil, canada, province of ontario, daucus carota, meadow ecosystem, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 0-15cm, brunisol, decomissioned agricultural field)2021-11-14v3No1 / 6
110amnondominant water, drinking water, scotland, site d2017-04-08v4No1 / 6
110amnondominant water, drinking water, scotland, site e2017-04-08v4No1 / 6
698amnondominant control, park, rhizosphere, ph 6-7, united kingdom, quercus, oak, depth (soil) 0-20cm, depth (soil) 0-30 cm2028-04-01v3No1 / 6
605amnoncommon external acoustic meatus, child, australia, ear canal, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 7
842sheryoDominant in soil depth of 30-45cm in a mature forest in Ontario, Canada (dominant soil, canada, province of ontario, forested area, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 30-45cm, brunisol, mature forest)2021-11-14v3No1 / 7
842sheryoDominant in soil depth of 30-45cm in a mature forest in Ontario, Canada (dominant soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 30-45cm, mature forest)2021-11-14v3No1 / 7
842sheryoDominant in soil depth of 30-45cm in an old growth forest in Ontario, Canada (dominant soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 30-45cm, old growth forest)2021-11-14v3No1 / 7
842sheryoDominant in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant soil, canada, province of ontario, daucus carota, meadow ecosystem, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 15-30cm, brunisol, decomissioned agricultural field)2021-11-14v3No1 / 7
842sheryoDominant in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant soil, canada, province of ontario, daucus carota, meadow ecosystem, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 30-45cm, brunisol, decomissioned agricultural field)2021-11-14v3No1 / 7
599amnon high in caudal teeth compared to rostral teeth in farm dentition equus caballus scotland horse edinburgh 2020-03-25v4No1 / 8
842sheryoDominant in soil depth of 15-30cm in an old growth forest in Ontario, Canada (dominant soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 15-30cm, old growth forest)2021-11-14v3No1 / 8
842sheryoDominant in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant soil, canada, province of ontario, daucus carota, meadow ecosystem, luvisol, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 15-30cm, decomissioned agricultural field)2021-11-14v3No1 / 8
828sheryoDominant in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (dominant soil, jiangsu province, depth (soil) 20-30cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 9
244amnondominant digestive system, research facility, drosophila melanogaster, fruit fly, united kingdom2017-11-15v4No1 / 9
605amnoncommon middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear fluid, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 9
842sheryoDominant in soil depth of 15-30cm in a mature forest in Ontario, Canada (dominant soil, canada, province of ontario, forested area, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 15-30cm, brunisol, mature forest)2021-11-14v3No1 / 9
842sheryoDominant in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (dominant soil, canada, province of ontario, daucus carota, meadow ecosystem, luvisol, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 30-45cm, decomissioned agricultural field)2021-11-14v3No1 / 9
698amnondominant park, rhizosphere, disease, ph 5-6, united kingdom, quercus, oak, acute oak decline, plant disease, depth (soil) 0-20cm, depth (soil) 0-30 cm2028-04-01v3No1 / 9
828sheryoDominant in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (dominant soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 30-4cm)2021-08-25v4No1 / 10
828sheryoDominant in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (dominant soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 40-50cm)2021-08-25v4No1 / 10
605amnondominant control, nasopharynx, child, australia, age 1-3 years, perth, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 10
256amnondominant duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 10
396amnondominant digestive system, intestine, cyprinus carpio, england, fish, common carp2018-11-14v4No1 / 10
353amnonhigh freq. in wild Lissotriton vulgaris newts skin (dominant skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 10
353amnonhigh freq. in wild Triturus cristatus newts skin (dominant skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 10
605amnondominant middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear rinse, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 12
396amnondominant digestive system, intestine, oncorhynchus mykiss, england, fish, rainbow trout2018-11-14v4No1 / 12
605amnondominant middle ear, child, australia, age 1-3 years, perth, recurrent otitis media, middle ear fluid, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 13
605amnondominant external acoustic meatus, child, australia, ear canal, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 13
605amnon high in middle ear fluid compared to middle ear rinse in middle ear child australia age 1-3 years perth recurrent otitis media 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 13
110amnoncommon water, drinking water, scotland, site c2017-04-08v4No1 / 13
721amnonlower in high protein weight loss diet compared to control diet ( high in control diet compared to weight loss weight loss diet high protein diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 )2028-05-23v4No1 / 14
605amnoncommon nasopharynx, child, australia, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 14
605amnondominant nasopharynx, child, australia, age 1-3 years, perth, recurrent otitis media, 2-year-old human stage, 1-year-old human stage2020-04-07v3No1 / 14
579amnonhigh freq. in pond water of mud crab aquaculture (dominant fish farm, saline water, summer, autumn, saline water aquarium, scylla paramamosain, china, pond, mud crab)2020-01-14v3No1 / 14
379amnonlower in chickens infeceted with campylobacter at age 20 days compared to noninfected controls ( high in control compared to campylobacter in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 15
805amnondominant homo sapiens, sputum, adult, united kingdom, city of london2021-06-18v3No1 / 15
738amnon high in high wellfare feed compared to standard feed in caecum gallus gallus age 1 week chicken united kingdom 2021-01-30v3No1 / 16
448amnondominant feces, farm, equus caballus, horse, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 16
353amnonhigh freq. in captive Triturus cristatus newts skin (dominant research facility, skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 17
698amnondominant park, rhizosphere, united kingdom, london, quercus, ph 4-4.5, oak, depth (soil) 0-20cm, depth (soil) 0-30 cm2028-04-01v3No1 / 17
84amnonincreases in drought in late time points ( high in timepoint drought environment compared to control in fen soil peat soil temperate grassland biome flooded grassland biome depth 5cm united kingdom )2017-03-07v4No1 / 18
909amnon high in age 18 weeks compared to age 6 weeks in research facility colonic mucosa mus musculus mouse united kingdom manchester 2022-05-20v3No1 / 18
599amnoncommon farm, dentition, equus caballus, scotland, horse, edinburgh2020-03-25v4No1 / 19
599amnondominant farm, dentition, equus caballus, scotland, horse, edinburgh2020-03-25v4No1 / 19
256amnondominant caecum, left colon, right colon, sus scrofa, pig, united kingdom2017-11-26v4No1 / 19
738amnondominant caecum, gallus gallus, chicken, age 30 days, united kingdom2021-01-30v3No1 / 19
355amnondominant ocean, pacific ocean, ulva, canada, province of british columbia, calvert island, alga, ulva lactuca2018-08-01v4No1 / 19
353amnonhigh freq. in captive Lissotriton vulgaris newts skin (dominant research facility, skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 20
805amnon high in nicotine dependence smoker cigarette smoking compared to non-smoker in homo sapiens sputum adult united kingdom city of london 2021-06-18v3No1 / 20
579amnonhigh freq. in pond water of mud crab aquaculture (dominant fish farm, saline water, saline water aquarium, scylla paramamosain, china, pond, mud crab, spring)2020-01-14v3No1 / 20
396amnoncommon digestive system, intestine, oncorhynchus mykiss, england, fish, rainbow trout2018-11-14v4No1 / 21
110amnoncommon water, drinking water, scotland, site b2017-04-08v4No1 / 21
122amnondominant feces, homo sapiens, united kingdom2017-04-13v4No1 / 21
909amnon high in age 18 weeks compared to age 6 weeks in feces research facility mus musculus mouse united kingdom manchester 2022-05-20v3No1 / 22
110amnoncommon water, drinking water, scotland, site a2017-04-08v4No1 / 22
225amnonhigh freq. in wild type cotrols (dominant feces, research facility, mus musculus, wild type genotype, mouse, united kingdom)2017-10-29v4No1 / 22
73amnondominant feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 23
738amnondominant caecum, gallus gallus, age 1 week, chicken, united kingdom2021-01-30v3No1 / 23
225amnonhigh freq. in polgA mutants (accelerated aging) (dominant feces, research facility, mus musculus, mouse, polga mutant, united kingdom)2017-10-29v4No1 / 23
721amnonhigher in high protein weight loss diet compared to control diet ( high in weight loss weight loss diet high protein diet compared to control diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 )2028-05-23v4No1 / 24
605amnon high in middle ear rinse compared to middle ear fluid in middle ear child australia age 1-3 years perth recurrent otitis media 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 24
721amnondominant feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 25
721amnon high in high fiber fiber diet compared to weight loss weight loss diet high protein diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 2028-05-23v4No1 / 25
379amnondominant feces, gallus gallus, chicken, age 15 - 35 days, united kingdom2018-09-14v4No1 / 25
909amnondominant feces, research facility, mus musculus, mouse, age 18 weeks, united kingdom, manchester2022-05-20v3No1 / 25
909amnondominant research facility, colonic mucosa, mus musculus, mouse, age 18 weeks, united kingdom, manchester2022-05-20v3No1 / 25
909amnondominant feces, research facility, mus musculus, mouse, age 6 weeks, united kingdom, manchester2022-05-20v3No1 / 26
909amnondominant research facility, colonic mucosa, mus musculus, mouse, age 6 weeks, united kingdom, manchester2022-05-20v3No1 / 26
605amnon high in control compared to recurrent otitis media in nasopharynx child australia age 1-3 years perth 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 27
738amnon high in high wellfare feed compared to standard feed in caecum gallus gallus chicken age 30 days united kingdom 2021-01-30v3No1 / 28
379amnonlower in chickens infeceted with campylobacter at age 6 days compared to noninfected controls ( high in control compared to campylobacter in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 33
909amnon high in feces compared to lumen of colon in research facility mus musculus mouse united kingdom manchester 2022-05-20v3No1 / 35
110amnoncommon water, drinking water, scotland, site d2017-04-08v4No1 / 36
84amnondisappears in drought in late time points ( high in control compared to timepoint drought environment in fen soil peat soil temperate grassland biome flooded grassland biome depth 5cm united kingdom )2017-03-07v4No1 / 37
842sheryoHigher in soil depth of 30-45cm compared to soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 30-45cm compared to depth 15-30cm in soil canada province of ontario daucus carota meadow ecosystem cambridge solidago apocynum dipsacus fullonum rare charitable research reserve grand river watershed brunisol decomissioned agricultural field )2021-11-14v3No1 / 38
909amnon high in age 6 weeks compared to age 18 weeks in research facility colonic mucosa mus musculus mouse united kingdom manchester 2022-05-20v3No1 / 39
909amnon high in age 6 weeks compared to age 18 weeks in feces research facility mus musculus mouse united kingdom manchester 2022-05-20v3No1 / 41
738amnon high in standard feed compared to high wellfare feed in caecum gallus gallus age 1 week chicken united kingdom 2021-01-30v3No1 / 43
110amnoncommon water, drinking water, scotland, site e2017-04-08v4No1 / 44
244amnoncommon digestive system, research facility, drosophila melanogaster, fruit fly, united kingdom2017-11-15v4No1 / 45
396amnoncommon digestive system, intestine, cyprinus carpio, england, fish, common carp2018-11-14v4No1 / 45
738amnon high in standard feed compared to high wellfare feed in caecum gallus gallus chicken age 30 days united kingdom 2021-01-30v3No1 / 45
379amnonnegatively correlated with age 8-35 days in chickens ( high in young age compared to age old age in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 47
256amnonlower in intestinal contents compared to mucosal scraping in pig caecum ( high in mucosa compared to intestinal contents in caecum sus scrofa pig united kingdom )2017-11-26v4No1 / 50
909amnon high in lumen of colon compared to feces in research facility mus musculus mouse united kingdom manchester 2022-05-20v3No1 / 53
225amnonhigher in polgA mutants (accelarated aging) compared to wild type ( high in polga mutant compared to wild type genotype in feces research facility mus musculus mouse united kingdom )2017-10-29v4No1 / 53
738amnoncommon caecum, gallus gallus, age 1 week, chicken, united kingdom2021-01-30v3No1 / 64
448amnoncommon feces, farm, equus caballus, horse, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 65
805amnon high in non-smoker compared to nicotine dependence smoker cigarette smoking in homo sapiens sputum adult united kingdom city of london 2021-06-18v3No1 / 67
738amnon high in age 1 week compared to age 30 days in caecum gallus gallus chicken united kingdom 2021-01-30v3No1 / 68
379amnonhigher in chickens infeceted with campylobacter at age 6 days compared to noninfected controls ( high in campylobacter compared to control in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 69
448amnon high in equine grass sickness disease compared to control in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 72
122amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 77
721amnon high in weight loss weight loss diet high protein diet compared to high fiber fiber diet in feces homo sapiens obesity adult scotland overweight body mass index status gaz:00052100 2028-05-23v4No1 / 83
353amnoncommon in captive Triturus cristatus newts skin (common research facility, skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 84
353amnoncommon in captive Lissotriton vulgaris newts skin (common research facility, skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 86
805amnoncommon homo sapiens, sputum, adult, united kingdom, city of london2021-06-18v3No1 / 88
355amnoncommon ocean, pacific ocean, ulva, canada, province of british columbia, calvert island, alga, ulva lactuca2018-08-01v4No1 / 94
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 15-30cm compared to depth 30-45cm in soil canada province of ontario daucus carota meadow ecosystem cambridge solidago apocynum dipsacus fullonum rare charitable research reserve grand river watershed brunisol decomissioned agricultural field )2021-11-14v3No1 / 98
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in caecum sus scrofa pig united kingdom )2017-11-26v4No1 / 103
256amnonhigher in control diet compared to diet enriched with sucram in pig gut ( high in diet standard feed compared to sucram in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 109
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v4No1 / 125
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 135
225amnonlower in polgA mutants (accelarated aging) compared to wild type ( high in wild type genotype compared to polga mutant in feces research facility mus musculus mouse united kingdom )2017-10-29v4No1 / 139
396amnon high in oncorhynchus mykiss rainbow trout compared to cyprinus carpio common carp in digestive system intestine england fish 2018-11-14v4No1 / 142
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
605amnon high in recurrent otitis media compared to control in nasopharynx child australia age 1-3 years perth 2-year-old human stage 1-year-old human stage 2020-04-07v3No1 / 149
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
379amnoncommon feces, gallus gallus, chicken, age 15 - 35 days, united kingdom2018-09-14v4No1 / 160
909amnoncommon feces, research facility, mus musculus, mouse, age 18 weeks, united kingdom, manchester2022-05-20v3No1 / 161
909amnoncommon research facility, colonic mucosa, mus musculus, mouse, age 18 weeks, united kingdom, manchester2022-05-20v3No1 / 161
909amnoncommon feces, research facility, mus musculus, mouse, age 6 weeks, united kingdom, manchester2022-05-20v3No1 / 168
909amnoncommon research facility, colonic mucosa, mus musculus, mouse, age 6 weeks, united kingdom, manchester2022-05-20v3No1 / 168
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 0-15cm in an old growth forest in Ontario, Canada ( high in depth 15-30cm compared to depth 0-15cm in soil canada province of ontario forested area luvisol forest cambridge fagus grandifolia acer saccharum subsp. nigrum acer saccharum quercus rubra quercus alba quercus velutina rare charitable research reserve grand river watershed old growth forest )2021-11-14v3No1 / 173
579amnoncommon in pond water of mud crab aquaculture (common fish farm, saline water, saline water aquarium, scylla paramamosain, china, pond, mud crab, spring)2020-01-14v3No1 / 173
842sheryoCommon in soil depth of 15-30cm in a mature forest in Ontario, Canada (common soil, canada, province of ontario, forested area, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 15-30cm, brunisol, mature forest)2021-11-14v3No1 / 182
396amnon high in cyprinus carpio common carp compared to oncorhynchus mykiss rainbow trout in digestive system intestine england fish 2018-11-14v4No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in child obsolete_juvenile stage crohn's disease compared to control adult in feces homo sapiens glasgow )2017-02-26v4No1 / 185
842sheryoHigher in soil depth of 30-45cm compared to soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 30-45cm compared to depth 15-30cm in soil canada province of ontario daucus carota meadow ecosystem luvisol cambridge solidago apocynum dipsacus fullonum rare charitable research reserve grand river watershed decomissioned agricultural field )2021-11-14v3No1 / 185
738amnoncommon caecum, gallus gallus, chicken, age 30 days, united kingdom2021-01-30v3No1 / 202
256amnonlower in control diet compared to diet enriched with sucram in pig gut ( high in diet sucram compared to standard feed in gastrointestinal system sus scrofa pig united kingdom )2017-11-26v4No1 / 227
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common soil, canada, province of ontario, forested area, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 30-45cm, brunisol, mature forest)2021-11-14v3No1 / 227
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 15-30cm compared to depth 30-45cm in soil canada province of ontario daucus carota meadow ecosystem luvisol cambridge solidago apocynum dipsacus fullonum rare charitable research reserve grand river watershed decomissioned agricultural field )2021-11-14v3No1 / 253
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common soil, canada, province of ontario, forested area, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, brunisol, mature forest)2021-11-14v3No1 / 261
698amnon high in disease ph 5-6 acute oak decline plant disease compared to control ph 6-7 in park rhizosphere united kingdom quercus oak depth (soil) 0-20cm depth (soil) 0-30 cm 2028-04-01v3No1 / 266
379amnonpositively correlated with age 8-35 days in chickens ( high in age old age compared to young age in feces gallus gallus chicken united kingdom )2018-09-14v4No1 / 271
225amnoncommon in polgA mutants (accelerated aging) (common feces, research facility, mus musculus, mouse, polga mutant, united kingdom)2017-10-29v4No1 / 281
622amnon high in caecum compared to ileum in research facility gallus gallus chicken great britain liverpool age 42 days 2020-05-08v4No1 / 307
828sheryoHigher at 0-20cm depth compared to 20-40cm depth in gleysol soil of poplar plantation, sihong, china ( high in depth (soil) 0-20cm compared to depth 20-40cm in soil jiangsu province clay loam ph 6-7 gleysol china sihong county poplar poplar plantation chenwei forest )2021-08-25v4No1 / 312
828sheryoHigher at 20-40cm depth compared to 0-20cm depth in gleysol soil of poplar plantation, sihong, china ( high in depth 20-40cm compared to depth (soil) 0-10cm in soil jiangsu province clay loam ph 6-7 gleysol china sihong county poplar poplar plantation chenwei forest )2021-08-25v4No1 / 321
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 345
225amnoncommon in wild type cotrols (common feces, research facility, mus musculus, wild type genotype, mouse, united kingdom)2017-10-29v4No1 / 370
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
842sheryoCommon in soil depth of 30-45cm in an old growth forest in Ontario, Canada (common soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 30-45cm, old growth forest)2021-11-14v3No1 / 390
842sheryoCommon in soil depth of 30-45cm in a mature forest in Ontario, Canada (common soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 30-45cm, mature forest)2021-11-14v3No1 / 393
353amnoncommon in wild Lissotriton vulgaris newts skin (common skin, adult, cambridgeshire, newt, lissotriton vulgaris, united kingdom)2018-07-30v4No1 / 418
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 15-30cm compared to depth 0-15cm in soil canada province of ontario daucus carota meadow ecosystem cambridge solidago apocynum dipsacus fullonum rare charitable research reserve grand river watershed brunisol decomissioned agricultural field )2021-11-14v3No1 / 432
842sheryoCommon in soil depth of 15-30cm in a mature forest in Ontario, Canada (common soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 15-30cm, mature forest)2021-11-14v3No1 / 433
698amnon high in control ph 6-7 compared to disease ph 5-6 acute oak decline plant disease in park rhizosphere united kingdom quercus oak depth (soil) 0-20cm depth (soil) 0-30 cm 2028-04-01v3No1 / 452
353amnoncommon in wild Triturus cristatus newts skin (common skin, adult, cambridgeshire, newt, triturus cristatus, united kingdom)2018-07-30v4No1 / 456
842sheryoCommon in soil depth of 0-15cm in a mature forest in Ontario, Canada (common soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 0-15cm, mature forest)2021-11-14v3No1 / 460
738amnon high in age 30 days compared to age 1 week in caecum gallus gallus chicken united kingdom 2021-01-30v3No1 / 474
256amnoncommon caecum, left colon, right colon, sus scrofa, pig, united kingdom2017-11-26v4No1 / 490
842sheryoCommon in soil depth of 15-30cm in an old growth forest in Ontario, Canada (common soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 15-30cm, old growth forest)2021-11-14v3No1 / 507
448amnoncommon in healthy horse feces (common feces, control, farm, equus caballus, horse, united kingdom)2019-01-08v4No1 / 508
842sheryoHigher in soil depth 15-30cm compared soil depth of 0-15cm to in a zea mays agricultural field in Ontario, Canada ( high in depth 15-30cm compared to depth 0-15cm in soil zea mays canada province of ontario agricultural field luvisol cambridge rare charitable research reserve grand river watershed preston flats )2021-11-14v3No1 / 598
842sheryoHigher in soil depth of 0-15cm compared soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in soil canada province of ontario daucus carota meadow ecosystem cambridge solidago apocynum dipsacus fullonum rare charitable research reserve grand river watershed brunisol decomissioned agricultural field )2021-11-14v3No1 / 601
698amnoncommon park, rhizosphere, united kingdom, london, quercus, ph 4-4.5, oak, depth (soil) 0-20cm, depth (soil) 0-30 cm2028-04-01v3No1 / 623
842sheryoHigher in soil depth of 0-15cm compared to soil depth of 15-30cm in an old growth forest in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in soil canada province of ontario forested area luvisol forest cambridge fagus grandifolia acer saccharum subsp. nigrum acer saccharum quercus rubra quercus alba quercus velutina rare charitable research reserve grand river watershed old growth forest )2021-11-14v3No1 / 653
256amnonlower in small intestine compared to colon in pigs ( high in caecum left colon right colon compared to duodenum jejunum ileum in sus scrofa pig united kingdom )2017-11-26v4No1 / 740
842sheryoCommoon in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (common soil, canada, province of ontario, daucus carota, meadow ecosystem, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 30-45cm, brunisol, decomissioned agricultural field)2021-11-14v3No1 / 768
828sheryoCommon in gleysol soil of poplar plantation at 40-50cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 40-50cm)2021-08-25v4No1 / 790
842sheryoCommon in soil depth of 0-15cm in an old growth forest in Ontario, Canada (common soil, canada, province of ontario, forested area, luvisol, forest, cambridge, fagus grandifolia, acer saccharum subsp. nigrum, acer saccharum, quercus rubra, quercus alba, quercus velutina, rare charitable research reserve, grand river watershed, depth 0-15cm, old growth forest)2021-11-14v3No1 / 834
828sheryoCommon in gleysol soil of poplar plantation at 30-40cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest, depth 30-4cm)2021-08-25v4No1 / 844
698amnoncommon park, rhizosphere, disease, ph 5-6, united kingdom, quercus, oak, acute oak decline, plant disease, depth (soil) 0-20cm, depth (soil) 0-30 cm2028-04-01v3No1 / 848
842sheryoCommon in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (common soil, canada, province of ontario, daucus carota, meadow ecosystem, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 15-30cm, brunisol, decomissioned agricultural field)2021-11-14v3No1 / 905
842sheryoHigher in soil depth of 0-15cm compared to soil depth 15-30cm in a zea mays agricultural field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in soil zea mays canada province of ontario agricultural field luvisol cambridge rare charitable research reserve grand river watershed preston flats )2021-11-14v3No1 / 924
842sheryoCommon in soil depth of 30-45cm in a Decomissioned Agricultural Field in Ontario, Canada (common soil, canada, province of ontario, daucus carota, meadow ecosystem, luvisol, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 30-45cm, decomissioned agricultural field)2021-11-14v3No1 / 970
842sheryoCommon in soil depth of 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada (common soil, canada, province of ontario, daucus carota, meadow ecosystem, luvisol, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 15-30cm, decomissioned agricultural field)2021-11-14v3No1 / 974
828sheryoCommon in gleysol soil of poplar plantation at 20-30cm depth, sihong, china (common soil, jiangsu province, depth (soil) 20-30cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 989
842sheryoHigher in soil depth of 15-30cm compared to soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 15-30cm compared to depth 0-15cm in soil canada province of ontario daucus carota meadow ecosystem luvisol cambridge solidago apocynum dipsacus fullonum rare charitable research reserve grand river watershed decomissioned agricultural field )2021-11-14v3No1 / 1044
828sheryoCommon in gleysol soil of poplar plantation at 0-10cm depth, sihong, china (common soil, jiangsu province, depth (soil) 0-10cm, clay loam, ph 6-7, gleysol, china, sihong county, poplar, poplar plantation, chenwei forest)2021-08-25v4No1 / 1069
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common soil, canada, province of ontario, daucus carota, meadow ecosystem, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 0-15cm, brunisol, decomissioned agricultural field)2021-11-14v3No1 / 1082
448amnon high in control compared to equine grass sickness disease in feces farm equus caballus horse united kingdom 2019-01-08v4No1 / 1084
698amnoncommon control, park, rhizosphere, ph 6-7, united kingdom, quercus, oak, depth (soil) 0-20cm, depth (soil) 0-30 cm2028-04-01v3No1 / 1115
828sheryoCommon in gleysol soil of poplar plantation at 10-20cm depth, sihong, china (common soil, jiangsu province, clay loam, ph 6-7, gleysol, china, sihong county, poplar, depth 10-20cm, poplar plantation, chenwei forest)2021-08-25v4No1 / 1123
842sheryoCommon in soil depth of 0-15cm in a Decomissioned Agricultural Field in Ontario, Canada (common soil, canada, province of ontario, daucus carota, meadow ecosystem, luvisol, cambridge, solidago, apocynum, dipsacus fullonum, rare charitable research reserve, grand river watershed, depth 0-15cm, decomissioned agricultural field)2021-11-14v3No1 / 1281
842sheryoHigher in soil depth of 0-15cm compared to 15-30cm in a Decomissioned Agricultural Field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in soil canada province of ontario daucus carota meadow ecosystem luvisol cambridge solidago apocynum dipsacus fullonum rare charitable research reserve grand river watershed decomissioned agricultural field )2021-11-14v3No1 / 1723
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 1834
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162
84amnoncommon fen, soil, peat soil, temperate grassland biome, flooded grassland biome, depth 20cm, united kingdom2017-03-06v4No1 / 2866
84amnoncommon fen, soil, peat soil, temperate grassland biome, flooded grassland biome, depth 5cm, united kingdom2017-03-07v4No1 / 3434

Problems / suggestions? Please email info AT dbbact DOT org