Summary for ontology term: united states of america

Number of annotations with term: 2072

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCATGATAAGTCTGATGTGAAAACCCAAGGCTCAACCATGGGACTGCATTGGAAACTGTCGTGCTGGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.003885
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Sutterellaceae;g__ParasutterellaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGGGTGCGCAGGCGGTTGAGTAAGACAGATGTGAAATCCCCGAGCTTAACTCGGGAATGGCATATGTGACTGCTCGACTAGAGTGTGTCAGAGGGAGGTGGAATTCCACG0.003885
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGCAGCAAGTCTGATGTGAAAGGCAGGGGCTTAACCCCTGGACTGCATTGGAAACTGCTGTGCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.003400
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__FusicatenibacterTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGATGTGAAAACCCAGGGCTTAACCCTGGGACTGCATTGGAAACTGTCTGGCTCGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.003400
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.003400
d__BacteriaTACGTAGGGAGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTCTGAAAAGTCGGATGTGAAATCCCCGTGCTTAACATGGGAGCTGCATTCGAAACTTTCGGACTTGAGTGTCGGAGAGGTAAGCGGAATTCCCGG0.003400
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Lachnospiracea_incertae_sedisTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAGTGCAAGTCAGATGTGAAAGGCCGGGGCTCAACCCCGGAGCTGCATTTGAAACTGCTCGGCTAGAGTACAGGAGAGGCAGGCGGAATTCCTAG0.003400
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__Clostridium IVTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGTGTAGGCGGGATATCAAGTCAGAAGTGAAAATTACGGGCTCAACTCGTAACCTGCTTTTGAAACTGACATTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCTAG0.003400
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGCAAGGCAAGTCAGATGTGAAAGCCCGGGGCTCAACCCCGGTATTGCATTTGAAACTGTTTAGCTAGAGTGCAGGAGAGGTAAGTGGAATTCCTAG0.003400
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__SubdoligranulumAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGATTGGCAAGTTGGGAGTGAAATCTATGGGCTCAACCCATAAATTGCTTTCAAAACTGTCAGTCTTGAGTGGTGTAGAGGTAGGCGGAATTCCCGG0.003400

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.533333
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.533333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGATGCTCAACATCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.533333
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__HoldemanellaTACGTAGGTGGCGAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGTAGGTGGCAGATCAAGTCTGGAGTAAAAGGTATGGGCTCAACCCGTACTGGCTCTGGAAACTGATCAGCTAGAGAACAGAAGAGGACGGCGGAACTCCATGT0.466667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGTGAGGTAAGCGTGTTGTGAAATGTAGGCGCCCAACGTCTGCACTGCAGCGCGAACTGCCCCACTTGAGTGCGCGCAACGCCGGCGGAACTCGTCG0.400000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__PhascolarctobacteriumTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGTTTTTTAAGTCTGGAGTGAAAATGCGGGGCTCAACCCCGTATGGCTCTGGATACTGGAAGACTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__IntestinimonasTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAGTGCAAGTCAGATGTGAAAATTATGGGCTCAACCCATAACCTGCATTTGAAACTGTACTTCTTGAGTACTGGAGAGGCAGGCGGAATTCCGTG0.400000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTCTTAAGTCCATCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGATGGAAACTGAGAGGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.400000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAGAGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTTTTTCTAGAGTGTCGGAGAGGTAAGCGGAATTCCTAG0.400000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__HoldemanellaTACGTAGGTGGCGAGCGTTATCCGGAATGATTGGGCGTAAAGGGTGCGTAGGTGGCAGAACAAGTCTGGAGTAAAAGGTATGGGCTCAACCCGTACTGGCTCTGGAAACTGTTCAGCTAGAGAACAGAAGAGGACGGCGGAACTCCATGT0.400000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__Enterobacteriaceae;g__Escherichia/ShigellaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTTTGTTAAGTCAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCTGATACTGGCAAGCTTGAGTCTCGTAGAGGGGGGTAGAATTCCAGG0.208936
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.192163
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGATGGATGTTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGATATCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.174471
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.173947
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.167352
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__RomboutsiaTACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGAGGTGAAAGGCTACGGCTCAACCGTAGTAAGCCTTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.164994
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.158966
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGTGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGAAACTGGCAGTCTTGAGTACAGTAGAGGTGGGCGGAATTCGTGG0.156189
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTGTGGCAAGTCTGATGTGAAAGGCATGGGCTCAACCTGTGGACTGCATTGGAAACTGTCATACTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.149644
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__"Enterobacteriales";f__EnterobacteriaceaeTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGTCTGTCAAGTCGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCGAAACTGGCAGGCTAGAGTCTTGTAGAGGGGGGTAGAATTCCAGG0.142807

Annotations:

common ontology terms
term enrichment score
TermScore
united states of america0.984250
feces0.325006
research facility0.296018
homo sapiens0.257928
mus musculus0.192738
adult0.186848
mouse0.184242
state of california0.130357
soil0.107670
water0.106315
control0.091112
state of new york0.090827
female0.079864
canis lupus familiaris0.073012
LOWER IN control0.071429
skin0.069606
child0.065672
saliva0.065010
state of michigan0.063966
dentition0.061030
fresh water0.059431
macaca mulatta0.057827
state of wisconsin0.057550
c57bl/60.056466
zoological garden0.056239
state of florida0.056174
dog0.055350
state of texas0.053342
ant0.053286
caecum0.052960
costa rica0.052677
freshwater lake0.052607
rhizosphere0.050004
state of illinois0.048255
foodon product type0.046419
bog lake0.044280
captive0.043821
state of minnesota0.043203
state of tennessee0.042067
commonwealth of pennsylvania0.040570
supragingival plaque0.039985
state of colorado0.038807
mouth0.038585
supragingival dental plaque0.038361
monkey0.037677
kalamazoo loam0.037175
mesic type hapludalf0.037175
kellogg biological station0.037175
larval stage0.036166
state of georgia0.035804
colon0.035712
river0.034247
bos taurus0.034146
female organism0.033613
drinking water0.033210
sus scrofa0.032919
adult organism0.032757
farm0.032634
sea water0.032491
puerto rico0.032289
pig0.030309
cow0.029873
felis catus0.029851
c57bl/6j0.029235
cultivated environment0.029091
diet0.028740
pacific ocean0.027990
mississippi river0.027479
digestive system0.027289
stomach0.027279
commonwealth of massachusetts0.026565
subgingival plaque0.026144
oral cavity0.026144
wild0.026093
atlantic ocean0.025741
state of washington0.025727
depth (soil) 0-5cm0.025562
high fat diet0.025492
state of rhode island0.025400
male0.025352
human adult stage0.025225
commonwealth of virginia0.024482
ph 60.024482
cat0.024383
sediment0.024270
state of nebraska0.023749
pair of nares0.023563
state of north carolina0.022770
populus0.022642
rhesus macaque0.022642
epilimnion0.022642
hypolimnion0.022642
ph 4.5-50.022642
state of wyoming0.021957
beach0.021719
vagina0.021672
bird0.021429
intestine0.020989
jackson laboratories0.020924
beagle dog0.020903
Fraction of dbbact annotations with this term covered by the query
TermScore
state of colorado1.000000
state of washington1.000000
puerto rico1.000000
state of wyoming1.000000
4-year-old human stage1.000000
LOWER IN 4-year-old human stage1.000000
glacier peak wilderness1.000000
depth (snow) 0-5cm1.000000
medicine bow - routt national forest1.000000
arapaho national forest1.000000
LOWER IN medicine bow - routt national forest1.000000
LOWER IN arapaho national forest1.000000
LOWER IN glacier peak wilderness1.000000
bufo marinus1.000000
municipality of bayamon1.000000
cane toad1.000000
no dental caries1.000000
united states of america0.992278
commonwealth of pennsylvania0.900000
state of texas0.875000
macaca mulatta0.857143
state of minnesota0.800000
state of ohio0.800000
commonwealth of massachusetts0.777778
state of new york0.769231
inguinal region0.750000
LOWER IN biopsy site0.750000
biopsy site0.750000
oropharynx0.750000
mississippi river0.750000
state of wisconsin0.750000
snow0.750000
state of nebraska0.750000
state of utah0.750000
state of arizona0.750000
state of georgia0.750000
state of alabama0.750000
african american0.750000
LOWER IN caucasian0.750000
caucasian0.750000
jackson laboratories0.714286
LOWER IN metronidazole0.714286
metronidazole0.714286
periplaneta americana0.666667
vaccination0.666667
beagle dog0.666667
LOWER IN animal product diet0.666667
animal product diet0.666667
allium cepa0.666667
LOWER IN selenium0.666667
selenium0.666667
vitis vinifera0.666667
grape0.666667
atlanta0.666667
particles0.666667
LOWER IN particles0.666667
early timepoints0.666667
LOWER IN fasting0.666667
danio rerio0.666667
flower structure0.666667
LOWER IN mussel0.666667
upper mississippi river0.666667
mussel0.666667
LOWER IN low fat diet0.666667
low fat diet0.666667
state of oregon0.666667
state of oklahoma0.666667
ictalurus punctatus0.666667
channel catfish0.666667
bioreactor0.666667
floor0.666667
radish0.666667
days 1-20.666667
osteopilus septentrionalis0.666667
state of connecticut0.666667
saline marsh0.666667
macaque0.666667
swiss webster0.666667
diceros bicornis0.666667
black rhinoceros0.666667
state of north carolina0.666667
tracheal aspirate0.666667
chicago0.666667
rhinoceros unicornis0.666667
greater one-horned rhinoceros0.666667
LOWER IN rhinoceros unicornis0.666667
LOWER IN greater one-horned rhinoceros0.666667
depth (soil) 0-5cm0.666667
state of montana0.666667
asian0.666667
LOWER IN asian0.666667
sandy loam0.666667
c57bl/6j0.636364
state of illinois0.625000
supragingival dental plaque0.625000
mouse0.622951
mus musculus0.611940
state of florida0.611111
axilla0.600000
zebra fish0.600000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.976351
feces0.317085
homo sapiens0.234073
research facility0.226834
adult0.138996
mus musculus0.114382
mouse0.108108
soil0.079151
state of california0.073842
water0.062259
control0.053089
state of new york0.048263
female0.045367
LOWER IN control0.040541
canis lupus familiaris0.039093
skin0.038610
child0.037162
saliva0.035714
state of michigan0.033784
dentition0.032819
fresh water0.032336
foodon product type0.029923
state of wisconsin0.029923
c57bl/60.029923
zoological garden0.029923
macaca mulatta0.029923
state of florida0.029440
dog0.029440
costa rica0.029440
caecum0.028958
ant0.028958
rhizosphere0.027992
state of texas0.027510
freshwater lake0.027510
state of illinois0.025097
captive0.024131
bog lake0.023166
state of minnesota0.022201
state of tennessee0.022201
supragingival plaque0.020753
commonwealth of pennsylvania0.020753
mouth0.020270
monkey0.020270
state of colorado0.019788
supragingival dental plaque0.019788
larval stage0.019305
kalamazoo loam0.019305
mesic type hapludalf0.019305
kellogg biological station0.019305
colon0.018822
state of georgia0.018340
river0.017857
bos taurus0.017857
farm0.017857
female organism0.017857
drinking water0.017375
sea water0.017375
sus scrofa0.017375
adult organism0.017375
puerto rico0.016409
pacific ocean0.015927
pig0.015927
felis catus0.015444
cow0.015444
cultivated environment0.015444
diet0.014961
c57bl/6j0.014961
digestive system0.014479
stomach0.014479
mississippi river0.013996
atlantic ocean0.013996
wild0.013996
male0.013514
subgingival plaque0.013514
oral cavity0.013514
commonwealth of massachusetts0.013514
human adult stage0.013514
high fat diet0.013031
sediment0.013031
state of washington0.013031
state of rhode island0.013031
depth (soil) 0-5cm0.013031
commonwealth of virginia0.012548
ph 60.012548
cat0.012548
pair of nares0.012066
state of nebraska0.012066
state of north carolina0.011583
populus0.011583
tree0.011583
bird0.011583
rhesus macaque0.011583
epilimnion0.011583
hypolimnion0.011583
ph 4.5-50.011583
intestine0.011100
vagina0.011100
beach0.011100
state of wyoming0.011100
equus caballus0.010618
Exp. ID User ID Description Date Region Flag Sequences
14amnonhighest in the right colon ( high in right colon compared to caecum in united states of america gastrointestinal system mus musculus )2016-11-08v4No1 / 1
14amnonhighest in feces compared to colon ( high in feces compared to colon in united states of america gastrointestinal system mus musculus )2016-11-08v4No1 / 1
14amnonmuch higher in right and transverse colon compared to other GI tract ( high in transverse colon right colon compared to caecum left colon in united states of america gastrointestinal system mus musculus )2016-11-08v4No1 / 1
23amnonhuman DNA (other feces, homo sapiens, united states of america)2016-11-29v4No1 / 1
59amnon high in united states of america australia state of texas malaysia seoul compared to china in digestive system apis mellifera 2017-02-02v4No1 / 1
69amnondominant feces, united states of america, research facility, canis lupus familiaris, beagle dog2017-02-21v4No1 / 1
74amnondominant united states of america, cheese curd, foodon product type, cheddar cheese food product2017-02-27v4No1 / 1
101amnondominant united states of america, vitis vinifera, state of new york, merlot, grapevine, root2017-04-03v4No1 / 1
108amnonquail mitochondria (other united states of america, research facility, colon, state of texas, quail, coturnix coturnix)2017-04-07v4No1 / 1
114amnondominant united states of america, research facility, intestine, adult, state of wisconsin, digesta, rana pipiens, northern leopard frog2017-04-10v4No1 / 1
114amnon high in control compared to contaminated water polychlorinated biphenyl 126 pcb in united states of america research facility intestine tadpole state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 1
117amnonhigher in sox10 mutant fish with high neutrophil count ( high in neutrophil hirschsprung disease high neutrophils compared to control low neutrophils in united states of america research facility larval stage intestine danio rerio zebra fish )2017-04-10v4No1 / 1
117amnonlower in sox10 mutant fish with high neutrophil count ( high in control low neutrophils compared to neutrophil hirschsprung disease high neutrophils in united states of america research facility larval stage intestine danio rerio zebra fish )2017-04-10v4No1 / 1
124amnonhigher in interferon gamma knockout mice ( high in interferon gamma knockout compared to control united states of america in feces caecum mus musculus c57bl/6j mouse )2017-04-14v4No1 / 1
157amnonhigh in nares of calves fed alfalfa not fortified with selenium compared to slenium fortified alfalfa ( high in control low selenium compared to selenium in united states of america nasal cavity pair of nares juvenile organism bos taurus calve )2017-07-04v4No1 / 1
158amnon high in pair of nares compared to saliva mouth in united states of america felis catus cat 2017-07-06v4No1 / 1
171amnonhigh freq. in soil with rice growth irrigation protocol (dominant united states of america, soil, state of california, depth 5cm)2017-07-25v4No1 / 1
176amnonhigh freq. in skin of hairless mice (dominant united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 1
228amnonhigh in sinus brush of CF patients compared to other sinusitis ( high in cystic fibrosis compared to sinusitis in homo sapiens united states of america mucosa paranasal sinus sinusoidal space )2017-10-31v4No1 / 1
230amnondominant united states of america, research facility, upper respiratory tract, mus musculus, mouse2017-11-02v4No1 / 1
301amnonhost 18S dna (dog or cat or human) (other united states of america, duodenum, canis lupus familiaris, dog)2018-03-05v4No1 / 1
311amnonhighest in days 1-2 (middle) in kimchi fermentation ( high in days 1-2 compared to day 0 day 3 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 1
311amnonlower in vegan compared to non-vegan kimchi ( high in non vegan kimchi non vegan compared to vegan kimchi vegan in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 1
325amnonhigher in mice supplemented with inulin in diet compared to normal diet ( high in diet inulin compared to mouse chow in feces united states of america research facility humanized mouse )2018-04-29v4No1 / 1
351amnondominant bacteria in sea urchin gut (dominant digestive system, united states of america, research facility, state of florida, eagle harbor, lytechinus variegatus, sea urchin)2018-07-30v4No1 / 1
408amnon high in stomach compared to larval stage in united states of america costa rica ant pseudomyrmex flavicornis 2018-11-22v4No1 / 1
409amnon high in right colon compared to left colon in homo sapiens united states of america colon biopsy site biopsy 2018-11-22v4No1 / 1
456amnonvery abundant (>90%) in tongues of one group of mice but not present in others (other tongue, united states of america, female, research facility, mus musculus, c57bl/6, mouse)2019-01-10v4No1 / 1
460amnonhigher in occupied indoor air compared to outdoor air ( high in indoor office compared to outdoor in united states of america air state of california )2019-01-12v4No1 / 1
525amnonSarcocystis parasite (other united states of america, state of colorado, sarcocystis, foodon product type, ground beef food product)2019-07-10v4No1 / 1
558amnon high in duodenum compared to gizzard in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 1
600sheryoDominant in unammended soil after 82 days (dominant united states of america, soil, state of new york, ph 6, coarse-loamy soil, day 82, depth (soil) 0-5cm)2020-03-27v4No1 / 1
689amnon high in non c. diff diarrhea compared to clostridium difficile colitis clostridium difficile infection in feces homo sapiens united states of america hospital diarrhea adult tucson 2028-03-11v4No1 / 1
702amnon high in control compared to clostridium difficile infection in feces united states of america canis lupus familiaris state of north carolina dog 2028-04-02v4No1 / 1
784amnondominant united states of america, estuary, saline marsh, rhizosphere, topsoil, state of connecticut, long island sound, phragmites australis, common reed, depth (soil) 0-5cm2021-05-16v4No1 / 1
806amnon high in nicotine dependence smoker cigarette smoking compared to non-smoker in homo sapiens united states of america mouth mucosa adult state of new york buccal mucosa 2021-06-19v3No1 / 1
813amnondominant united states of america, soil, state of washington, forested area, olympic national park, temperate rainforest2021-06-22v4No1 / 1
907amnondominant united states of america, wastewater treatment plant, bioreactor, state of minnesota2022-05-19v4No1 / 1
74amnondominant united states of america, caerphilly cheese, curd, foodon product type, cheese food product2017-02-27v4No1 / 2
76amnonhigh freq. in seleniferous soil (dominant united states of america, soil, rhizosphere, selenium, state of florida, seleniferous)2017-02-28v4No1 / 2
101amnondominant united states of america, leaf, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 2
101amnondominant united states of america, vitis vinifera, state of new york, merlot, grapevine, grape, botanical fruit food product2017-04-03v4No1 / 2
102amnon high in hiv infection compared to control in homo sapiens united states of america cheek atlanta mouth 2017-04-04v4No1 / 2
114amnon high in contaminated water polychlorinated biphenyl 126 pcb compared to control in united states of america research facility intestine tadpole state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 2
123amnon high in olanzapine compared to control in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v4No1 / 2
166amnonhigh freq. in river sediment (5cm) with mussels (dominant united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river, mussel, unionidae)2017-07-18v4No1 / 2
167amnonlower in late timepoints in mice with induced eae compared to control ( high in control compared to experimental autoimmune encephalomyelitis in feces united states of america female research facility mus musculus nod mouse mouse )2017-07-18v4No1 / 2
171amnondominant united states of america, soil, rhizosphere, oryza sativa, state of california, rice2017-07-25v4No1 / 2
171amnondominant united states of america, oryza sativa, state of california, rice, root2017-07-25v4No1 / 2
198amnon high in water compared to sediment in united states of america geothermal field yellowstone national park high temperature environment 2017-09-14v4No1 / 2
234amnoncandidate contaminant (high in blank) (contamination)2017-11-07v4No1 / 2
239amnon high in control compared to carcinoma colorectal adenocarcinoma colorectal cancer in feces homo sapiens united states of america 2017-11-08v4No1 / 2
304amnondominant united states of america, beach, sand, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 2
311amnonhigher in vegan compared to non-vegan kimchi ( high in vegan kimchi vegan compared to non vegan kimchi non vegan in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 2
326amnonhigher in lpr- mice supplemented with linoleic acid compared to control high fat diet ( high in linoleic acid diet compared to control in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v4No1 / 2
344amnon high in control compared to hiv infection in feces homo sapiens united states of america state of colorado denver gay homosexual msm 2018-05-31v4No1 / 2
408amnoncommon united states of america, stomach, costa rica, camponotus, ant2018-11-22v4No1 / 2
408amnon high in larval stage compared to stomach in united states of america costa rica camponotus ant 2018-11-22v4No1 / 2
408amnon high in larval stage compared to stomach in united states of america costa rica ant pseudomyrmex nigropilosus 2018-11-22v4No1 / 2
468amnonhigher in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in control compared to lower respiratory tract disease in homo sapiens united states of america trachea child tracheal aspirate respiratory technology dependent )2019-01-14v4No1 / 2
549amnoncoral mitochondria (other mitochondrion, puerto rico, isla palominos, coral, acropora cervicornis)2019-08-17v4No1 / 2
592amnondominant feces, united states of america, ovis aries, commonwealth of pennsylvania, wild, sheep2020-02-18v1No1 / 2
600sheryodecearses after 12 days of unammendment in soil ( high in day 1 compared to day 12 in united states of america soil state of new york ph 6 coarse-loamy soil depth (soil) 0-5cm )2020-03-27v4No1 / 2
702amnondominant feces, united states of america, equus caballus, state of north carolina, horse2028-04-02v4No1 / 2
747amnonanti-correlated in soy bean root nodules (other united states of america, farm, glycine max, root nodule, state of missouri, soy bean)2021-03-10v4No1 / 2
821sheryoDominant in soil of restored prairie at 0-10cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth (soil) 0-10cm, ph 6.5, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 2
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt compared to control in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 3
74amnondominant united states of america, salami, foodon product type2017-02-27v4No1 / 3
74amnondominant united states of america, string cheese, foodon product type, cheese food product2017-02-27v4No1 / 3
76amnonhigh freq in non-seleniferous soil (dominant united states of america, soil, rhizosphere, state of florida, non-seleniferous)2017-02-28v4No1 / 3
127amnonhigh in young (0-3 days) compared to old (28 day) chickens ( high in age young age compared to old age in united states of america caecum gallus gallus chicken )2017-04-14v4No1 / 3
186amnonlower in rats chronically infected with helminth ( high in control compared to parasitic helminthiasis infectious disease hymenolepis diminuta in united states of america research facility caecum sprague dawley rattus rat )2017-08-23v4No1 / 3
191amnondecreases during pregnancy ( high in first trimester compared to last trimester in homo sapiens united states of america female pregnancy vagina )2017-09-05v4No1 / 3
231amnonhigher in female compared to male in dog genitalia ( high in female compared to male in united states of america reproductive system reproductive organ canis lupus familiaris dog genitalia )2017-11-02v4No1 / 3
278amnon high in control compared to periodontitis in homo sapiens united states of america saliva adult state of california 2018-01-23v4No1 / 3
311amnondominant united states of america, state of rhode island, food (fermented), miso food product2018-04-09v4No1 / 3
311amnondominant united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 3
311amnondominant united states of america, state of rhode island, kimchi, food (fermented)2018-04-09v4No1 / 3
399amnon high in crohn's disease compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v4No1 / 3
408amnoncommon united states of america, larval stage, costa rica, camponotus, ant2018-11-22v4No1 / 3
462amnondominant united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment, depth (soil) 0-20cm, depth (soil) 0-30 cm2019-01-13v4No1 / 3
462amnondominant united states of america, state of tennessee, stem, populus, populus deltoides, tree, cultivated environment2019-01-13v4No1 / 3
487amnonlower in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in control diet compared to starch diet resistant starch type 4 diet in feces homo sapiens united states of america metabolic syndrome x metabolic syndrome )2019-02-24v4No1 / 3
525amnonhigher in ground beef with no antimicrobial treatment ( high in no antimicrobial treatment compared to antimicrobial treatment in united states of america state of colorado foodon product type ground beef food product )2019-07-10v4No1 / 3
549amnondominant puerto rico, isla palominos, coral, acropora cervicornis2019-08-17v4No1 / 3
600sheryoDominant in biochar ammended soil after 82 days (dominant united states of america, soil, state of new york, ph 6, biochar, coarse-loamy soil, day 82, depth (soil) 0-5cm)2020-03-27v4No1 / 3
689amnon high in clostridium difficile colitis clostridium difficile infection compared to non c. diff diarrhea in feces homo sapiens united states of america hospital diarrhea adult tucson 2028-03-11v4No1 / 3
719amnonlower in diet containing fiber compared to non fiber containing diet ( high in control diet compared to fiber diet in united states of america research facility dentition mus musculus state of georgia mouse charles river laboratories icr/cd-1 mice )2028-05-23v4No1 / 3
784amnondominant united states of america, estuary, saline marsh, rhizosphere, spartina alterniflora, topsoil, state of connecticut, long island sound, sporobolus alterniflorus, smooth cordgrass, depth (soil) 0-5cm2021-05-16v4No1 / 3
786sheryoDominant in flood plain soil near cosumnes river, california, at 30-60cm depth (dominant united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 30-60cm)2021-05-18v3No1 / 3
803amnon high in control compared to type 2 diabetes mellitus in feces homo sapiens united states of america adult commonwealth of massachusetts caribbean latino human late adulthood stage 2021-06-18v4No1 / 3
806amnon high in mouth mucosa buccal mucosa compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 3
821sheryoDominant in soil of continuous corn field at 0-10cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth (soil) 0-10cm, corn, ph 5.9, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 3
821sheryoDominant in soil of miscanthus field at 0-10cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth (soil) 0-10cm, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v4No1 / 3
902amnondominant feces, control, united states of america, equus caballus, horse, adult organism2022-05-02v4No1 / 3
74amnondominant united states of america, cauliflower, foodon product type2017-02-27v4No1 / 4
74amnoncommon united states of america, cheese curd, foodon product type, cheddar cheese food product2017-02-27v4No1 / 4
74amnondominant united states of america, allium cepa, foodon product type2017-02-27v4No1 / 4
74amnondominant united states of america, pisum sativum, foodon product type2017-02-27v4No1 / 4
74amnondominant united states of america, daucus carota, carrot, foodon product type2017-02-27v4No1 / 4
74amnondominant united states of america, spinacia oleracea, foodon product type2017-02-27v4No1 / 4
74amnondominant united states of america, solanum lycopersicum, foodon product type2017-02-27v4No1 / 4
79amnondominant united states of america, skin, steno bredanensis, rough-toothed dolphin2017-03-03v4No1 / 4
102amnon high in hiv infection compared to control in homo sapiens united states of america dentition atlanta mouth 2017-04-04v4No1 / 4
108amnondecreases during fasting in nile tilapia colon ( high in early timepoints compared to fasting late timepoints in united states of america research facility colon oreochromis niloticus state of texas nile tilapia )2017-04-07v4No1 / 4
158amnoncommon united states of america, conjunctiva, felis catus, cat2017-07-06v4No1 / 4
208amnonlower in TNBS induced colitis compared to controls ( high in control compared to colitis in feces united states of america mus musculus balb/c state of texas mouse )2017-10-06v4No1 / 4
211amnoncorrelated with BMI growth rate ( high in body mass index high growth compared to low growth in feces united states of america research facility mus musculus high fat diet mouse )2017-10-25v4No1 / 4
211amnonanti-correlated with BMI growth rate ( high in low growth compared to body mass index high growth in feces united states of america research facility mus musculus high fat diet mouse )2017-10-25v4No1 / 4
260amnonhigher in natiral tooth compared to dental implant ( high in natural tooth compared to implant in homo sapiens united states of america dentition state of nebraska subgingival plaque mouth )2017-12-05v4No1 / 4
285amnonlower in individuals with muc5ac ( high in muc5ac deficient compared to muc5ac in homo sapiens united states of america middle ear acute transudative otitis media child state of washington obsolete_juvenile stage )2018-01-27v4No1 / 4
311amnondominant united states of america, state of rhode island, ginger, foodon product type2018-04-09v4No1 / 4
311amnondominant united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 4
311amnondominant united states of america, allium cepa, state of rhode island, onion, foodon product type2018-04-09v4No1 / 4
325amnonhigher in c. diff infeceted humanized mice compared to non-infected controls ( high in clostridium difficile colitis clostridium difficile intestinal infectious disease compared to control in feces united states of america research facility humanized mouse )2018-04-29v4No1 / 4
413amnoncandidate contaminant (higher in blanks compared to samples) (contamination)2018-11-26v4No1 / 4
446amnonhigher in zebrafish larvae exposed to subclinical concentration of streptomycin compared to controls ( high in antibiotic streptomycin compared to control in united states of america research facility danio rerio fish zebrafish larvae age 15d )2019-01-08v4No1 / 4
462amnondominant united states of america, state of tennessee, soil, silt loam, cultivated environment, depth (soil) 0-20cm, depth (soil) 0-30 cm2019-01-13v4No1 / 4
483amnondominant united states of america, water, sea water, hawaii, pearl harbor, depth 1-2m2019-02-13v4No1 / 4
525amnonhigh freq. in ground beef (dominant united states of america, state of colorado, foodon product type, ground beef food product)2019-07-10v4No1 / 4
600sheryoDominant in stover ammended soil after 82 days (dominant united states of america, soil, state of new york, ph 6, coarse-loamy soil, day 82, stover ammendment , depth (soil) 0-5cm)2020-03-27v4No1 / 4
710amnon high in stomach small intestine compared to feces in united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 4
747amnondominant in soy bean root nodules (dominant united states of america, farm, glycine max, root nodule, state of missouri, soy bean)2021-03-10v4No1 / 4
821sheryoDominant in soil of continuous corn field at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm)2021-07-28v4No1 / 4
821sheryoDominant in soil of continuous corn field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-07-28v4No1 / 4
821sheryoDominant in soil of restored prairie at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm, restored prairie)2021-07-28v4No1 / 4
821sheryoDominant in soil of miscanthus field at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm, restored prairie)2021-08-02v4No1 / 4
821sheryoDominant in soil of miscanthus field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-02v4No1 / 4
821sheryoDominant in soil of switchgrass field at 0-10cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth (soil) 0-10cm, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v4No1 / 4
821sheryoDominant in soil of switchgrass field at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm, restored prairie)2021-08-02v4No1 / 4
74amnondominant united states of america, squash, foodon product type2017-02-27v4No1 / 5
74amnoncommon united states of america, cauliflower, foodon product type2017-02-27v4No1 / 5
74amnoncommon united states of america, salami, foodon product type2017-02-27v4No1 / 5
74amnondominant united states of america, curd, foodon product type2017-02-27v4No1 / 5
74amnondominant united states of america, allium sativum, foodon product type2017-02-27v4No1 / 5
79amnondominant united states of america, skin, peponocephala electra2017-03-03v4No1 / 5
158amnonhigh in skin of healthy cats compared to cats with skin allergy ( high in control compared to atopic dermatitis allergy in united states of america skin felis catus cat )2017-07-05v4No1 / 5
186amnonhigher in rats chronically infected with helminth ( high in parasitic helminthiasis infectious disease hymenolepis diminuta compared to control in united states of america research facility caecum sprague dawley rattus rat )2017-08-23v4No1 / 5
189amnondominant united states of america, stem, vitis vinifera, state of california, grape, endosphere2017-08-30v4No1 / 5
205amnonhigh freq. in Ely Greenstone rock piles (dominant united states of america, quarry, rock, state of minnesota, ph 7, greenschist)2017-10-03v4No1 / 5
215amnonlower in people with Roux-en-Y gastric bypass compared to controls ( high in control compared to gastric bypass in feces homo sapiens united states of america )2017-10-23v4No1 / 5
255amnondominant digestive system, united states of america, research facility, ictalurus punctatus, state of minnesota, catfish, channel catfish2017-11-24v4No1 / 5
300amnon high in exercise high physical activity compared to sedentary low physical activity in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks low capacity running strain 2018-02-27v4No1 / 5
301amnon high in duodenum ileum compared to rectum colon in united states of america canis lupus familiaris dog 2018-03-05v4No1 / 5
308amnonhigh freq. in spacecraft assembly cleanroom floor (dominant united states of america, dust, state of california, floor, cleanroom)2018-03-31v4No1 / 5
326amnonhigher in lpr- mice in caloric restriction compared to control high fat diet ( high in diet caloric restriction diet compared to control in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v4No1 / 5
399amnonhigher in clindamycin treated mice compared to controls ( high in antibiotic clindamycin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 5
399amnonhigher in metronidazole treated mice compared to controls ( high in antibiotic metronidazole compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 5
399amnonhigher in vancomycin treated mice compared to controls ( high in antibiotic vancomycin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 5
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 5
408amnon high in stomach compared to larval stage in united states of america costa rica ant pseudomyrmex spinicola 2018-11-22v4No1 / 5
408amnoncommon united states of america, stomach, costa rica, ant, pheidole2018-11-22v4No1 / 5
408amnondominant united states of america, larval stage, costa rica, camponotus, ant2018-11-22v4No1 / 5
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 5
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex cubaensis2018-11-22v4No1 / 5
410amnonhigher in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in homo sapiens united states of america rectum biopsy site child biopsy )2018-11-22v4No1 / 5
528amnoncommon homo sapiens, united states of america, female, pregnancy, vagina2019-07-14v1No1 / 5
644amnonhigher in younger adults (total age range 20-80) ( high in young age compared to old age in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 5
731amnonhigher in oropharingeal otic fluid drainage compared to buccal mucosa ( high in oropharynx compared to mouth mucosa buccal mucosa in homo sapiens united states of america adult state of michigan )2021-01-09v4No1 / 5
786sheryoDominant in flood plain soil near cosumnes river, california, at 0-30cm depth (dominant united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 0-20cm, depth (soil) 0-30 cm)2021-05-18v3No1 / 5
786sheryoDominant in flood plain soil near cosumnes river, california, at 60-100cm depth (dominant united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 60-100cm)2021-05-18v3No1 / 5
806amnon high in hard palate compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 5
821sheryoDominant in soil of restored prairie at 10-25cm depth, Michigan USA (dominant united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm, restored prairie)2021-07-28v4No1 / 5
866amnon high in irritable bowel syndrome irritable bowel syndrome compared to control in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 5
4amnondominant periplaneta americana, digestive system, united states of america2016-10-13v4No1 / 6
26amnon high in axilla inguinal region compared to mucus pair of nares in homo sapiens united states of america 2016-12-05v4No1 / 6
74amnoncommon united states of america, curd, foodon product type2017-02-27v4No1 / 6
74amnoncommon united states of america, string cheese, foodon product type, cheese food product2017-02-27v4No1 / 6
74amnondominant united states of america, prosciutto, foodon product type2017-02-27v4No1 / 6
74amnoncommon united states of america, spinacia oleracea, foodon product type2017-02-27v4No1 / 6
108amnondominant united states of america, research facility, colon, oreochromis niloticus, state of texas, nile tilapia2017-04-07v4No1 / 6
108amnondominant united states of america, research facility, colon, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 6
113amnondominant united states of america, research facility, intestine, adult, danio rerio, zebra fish2017-04-10v4No1 / 6
63amnon high in diet plant based diet compared to animal product diet in feces homo sapiens united states of america 2017-04-12v4No1 / 6
146amnondominant united states of america, soil, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 6
231amnonhigh freq. in dog urine (dominant united states of america, urine, canis lupus familiaris, dog)2017-11-02v4No1 / 6
239amnon high in carcinoma colorectal adenocarcinoma colorectal cancer compared to control in feces homo sapiens united states of america 2017-11-08v4No1 / 6
242amnonlower in native-americans compared to non native-american ( high in american compared to cheyenne native american arapaho in feces homo sapiens united states of america state of oklahoma )2017-11-14v4No1 / 6
266amnonhigh freq. in soil from JAM garden (dominant united states of america, soil, state of idaho, ph 5.5)2017-12-18v4No1 / 6
266amnonhigh freq. in roots in SIL garden (dominant united states of america, state of idaho, plant, brassicaceae, boechera stricta, root)2017-12-19v4No1 / 6
282amnondominant united states of america, mangrove swamp, soil, state of florida, mangrove, avicennia germinans, rhizophora mangle2018-01-25v4No1 / 6
307amnonlower in mice infeceted with chagas disease compared to healthy controls ( high in control compared to chagas disease in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 6
311amnonhigh freq. in salted cabbage (dominant united states of america, state of rhode island, cabbage, foodon product type)2018-04-09v4No1 / 6
311amnondominant united states of america, state of rhode island, garlic, foodon product type2018-04-09v4No1 / 6
311amnonhigher in fermneted kimchi days>1 compared to day 0 ( high in late timepoints days 1-9 compared to early timepoints day 0 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 6
344amnon high in hiv infection compared to control in feces homo sapiens united states of america state of colorado denver gay homosexual msm 2018-05-31v4No1 / 6
408amnondominant united states of america, stomach, costa rica, eciton, ant2018-11-22v4No1 / 6
415amnondominant united states of america, orchard, soil, rhizosphere, citrus, cultivated environment2018-11-27v4No1 / 6
462amnondominant united states of america, state of tennessee, rhizosphere, populus, tree, silt clay loam, depth 30-75cm, cultivated environment, depth (soil) 20-60cm2019-01-13v4No1 / 6
487amnonhigher in metabolic syndrome patients following resistant starch diet compared to control flour diet ( high in diet starch diet resistant starch type 4 diet compared to control diet in feces homo sapiens united states of america metabolic syndrome x metabolic syndrome )2019-02-24v4No1 / 6
582amnondominant united states of america, external acoustic meatus, ear canal, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 6
592amnondominant feces, united states of america, farm, bos taurus, commonwealth of pennsylvania, cow2020-02-18v1No1 / 6
612amnondominant united states of america, water, fresh water, state of florida, spring water, location 12020-04-22v4No1 / 6
646amnondominant homo sapiens, united states of america, mucus, lung, cystic fibrosis, adult, mild disease course, state of new hampshire, protected brush sampling2020-09-06v4No1 / 6
665amnondominant united states of america, state of california, influent, late time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 6
702amnon high in clostridium difficile infection compared to control in feces united states of america canis lupus familiaris state of north carolina dog 2028-04-02v4No1 / 6
788amnondominant united states of america, soil, state of georgia, mesocosm2021-05-31v4No1 / 6
813amnondominant united states of america, soil, state of washington, olympic national park, canopy soil, intact branch, epiphytic material2021-06-22v4No1 / 6
813amnondominant united states of america, soil, state of washington, olympic national park, canopy soil, severed branch, epiphytic material2021-06-22v4No1 / 6
821sheryoDominant in soil of continuous corn field at 50-100cm depth, Michigan USA (dominant united states of america, soil, state of michigan, corn, depth 50-100m, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 6
821sheryoDominant in soil of switchgrass field at 50-100cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-03v4No1 / 6
18amnondominant feces, united states of america, equus caballus2016-11-09v4No1 / 7
74amnondominant united states of america, rind, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 7
74amnondominant united states of america, curd, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 7
79amnondominant united states of america, skin, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 7
102amnon high in control compared to periodontitis in homo sapiens united states of america atlanta mouth 2017-04-04v4No1 / 7
103amnondominant united states of america, river, aquatic biome, fresh water, mississippi river, particles2017-04-05v4No1 / 7
103amnondominant united states of america, river, aquatic biome, fresh water, mississippi river, free floating2017-04-05v4No1 / 7
145amnondominant united states of america, soil, rhizosphere, oryza sativa, rice, ph 5.62017-04-19v4No1 / 7
179amnondominant united states of america, research facility, oral cavity, mus musculus, balb/c, mouse, mouth2017-08-13v4No1 / 7
182amnondominant united states of america, body proper, linepithema humile, argentine ant2017-08-15v4No1 / 7
191amnonincreases during pregnancy ( high in last trimerster compared to first trimester in homo sapiens united states of america female pregnancy vagina )2017-09-05v4No1 / 7
220amnonlower in mice supplemented with lactobacillus plantarum probiotics ( high in control diet compared to lactobacillus plantarum probiotics in feces united states of america female research facility mus musculus balb/c mouse )2017-10-24v4No1 / 7
304amnondominant united states of america, beach, air, aerosol, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 7
305amnonhigh freq. in low volume algae production photobioreactor (dominant united states of america, water, bioreactor, state of colorado, algae production system)2018-03-12v4No1 / 7
305amnonhigh freq. in medium volume algae production photobioreactor (dominant united states of america, water, bioreactor, state of colorado, algae production system)2018-03-12v4No1 / 7
305amnonhigh freq. in large volume algae production photobioreactor (dominant united states of america, water, bioreactor, state of colorado, algae production system)2018-03-12v4No1 / 7
354amnon high in saliva oral wash compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 7
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex gracilis2018-11-22v4No1 / 7
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 7
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 7
408amnondominant united states of america, stomach, costa rica, camponotus, ant2018-11-22v4No1 / 7
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 7
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 7
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex cubaensis2018-11-22v4No1 / 7
435amnon high in zinc deficiency low zinc diet compared to control in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse age 9 weeks 2018-12-23v4No1 / 7
435amnondominant feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 4 weeks2018-12-23v4No1 / 7
435amnondominant feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 9 weeks2018-12-23v4No1 / 7
483amnondominant united states of america, research facility, tubeworm tube, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 7
535amnoncommon in healthy adult vaginal samples (common homo sapiens, control, united states of america, female, vagina, adult, state of arizona, phoenix)2019-07-25v4No1 / 7
558amnoncommon united states of america, crop, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 7
632amnondominant united states of america, research facility, caecum, adult, equus caballus, state of texas, cecal content, horse2020-06-10v4No1 / 7
644amnonpositively correalted with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 7
646amnoncommon homo sapiens, united states of america, mucus, lung, cystic fibrosis, bronchoalveolar lavage, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 7
665amnondominant united states of america, state of california, influent, early time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 7
665amnondominant united states of america, state of california, late time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland, outlet2020-09-23v4No1 / 7
747amnoncommon in soy bean root nodules (common united states of america, farm, glycine max, root nodule, state of missouri, soy bean)2021-03-10v4No1 / 7
806amnon high in oral cavity oral wash compared to saliva in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 7
821sheryoDominant in soil of switchgrass field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-03v4No1 / 7
821sheryoDominant in soil of switchgrass field at 25-50cm depth, Michigan USA (dominant united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-03v4No1 / 7
829sheryoDominant in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (dominant united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, depth 0-12cm, alfisol, hapludalf, sandy loam)2021-08-26v3No1 / 7
829sheryoDominant in soil depth of 12-44m in Alfisol soil, Dekalb, Illinois, united states of america (dominant united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 12-44cm)2021-08-26v3No1 / 7
841amnon high in iga negative fraction compared to iga positive fraction in homo sapiens united states of america saliva adult state of texas human adult stage 2021-11-08v4No1 / 7
892amnon high in 4-year-old human stage compared to 2-year-old human stage in homo sapiens united states of america saliva child 2022-04-07v4No1 / 7
5amnondominant periplaneta americana, digestive system, united states of america, wild type2016-10-13v4No1 / 8
74amnondominant united states of america, rind, foodon product type, cheddar cheese food product2017-02-27v4No1 / 8
74amnondominant united states of america, spice, foodon product type, spice or herb2017-02-27v4No1 / 8
74amnoncommon united states of america, caerphilly cheese, curd, foodon product type, cheese food product2017-02-27v4No1 / 8
74amnoncommon united states of america, pisum sativum, foodon product type2017-02-27v4No1 / 8
167amnondominant feces, united states of america, female, research facility, mus musculus, nod mouse, mouse2017-07-18v4No1 / 8
182amnoncommon united states of america, body proper, linepithema humile, argentine ant2017-08-15v4No1 / 8
228amnonhigher in chronic sinositis compared to healthy controls in sinus brushing ( high in sinusitis compared to control in homo sapiens united states of america mucosa paranasal sinus sinusoidal space )2017-10-31v4No1 / 8
230amnoncommon united states of america, research facility, upper respiratory tract, mus musculus, mouse2017-11-02v4No1 / 8
255amnoncommon digestive system, united states of america, research facility, ictalurus punctatus, state of minnesota, catfish, channel catfish2017-11-24v4No1 / 8
266amnonhigh freq. in soil from MIL garden (dominant united states of america, soil, state of idaho, ph 6.5)2017-12-18v4No1 / 8
266amnonhigh freq. in soil from PAR garden (dominant united states of america, soil, state of idaho, ph 5.5)2017-12-18v4No1 / 8
266amnonhigh freq. in soil from SIL garden (dominant united states of america, soil, state of idaho, ph 6)2017-12-18v4No1 / 8
376amnondominant united states of america, saline marsh, sediment, rhizosphere, spartina alterniflora, atlantic ocean2018-09-11v4No1 / 8
394amnon high in ulcerative colitis compared to control in feces homo sapiens united states of america adult state of california 2018-11-06v4No1 / 8
399amnonhigher in ampicillin treated mice compared to controls ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 8
406amnondominant feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 8
406amnondominant feces, united states of america, zoological garden, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 8
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex gracilis2018-11-22v4No1 / 8
408amnoncommon united states of america, stomach, costa rica, crematogaster, ant2018-11-22v4No1 / 8
408amnondominant united states of america, larval stage, costa rica, crematogaster, ant2018-11-22v4No1 / 8
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex cubaensis2018-11-22v4No1 / 8
411amnondominant feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 8
435amnon high in control compared to zinc deficiency low zinc diet in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse age 9 weeks 2018-12-23v4No1 / 8
462amnondominant united states of america, state of tennessee, soil, silt clay loam, depth 30-75cm, cultivated environment, depth (soil) 20-60cm2019-01-13v4No1 / 8
483amnondominant united states of america, research facility, adult, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 8
483amnondominant united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 8
516amnoncommon homo sapiens, united states of america, urine, adult, state of ohio2019-05-29v4No1 / 8
518amnondominant feces, united states of america, bos taurus, state of georgia, cow, post-weaning, angus steer2019-06-11v4No1 / 8
592amnondominant feces, united states of america, research facility, oryctolagus cuniculus, commonwealth of pennsylvania, rabbit2020-02-18v1No1 / 8
620amnondominant feces, united states of america, zoological garden, gorilla gorilla, saint louis, saint louis zoo2020-05-06v4No1 / 8
646amnondominant homo sapiens, united states of america, mucus, lung, cystic fibrosis, bronchoalveolar lavage, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 8
702amnon high in canis lupus familiaris dog compared to felis catus cat in feces united states of america state of north carolina 2028-04-02v4No1 / 8
722amnondominant united states of america, estuary, sediment, marine sediment, state of new york, new york city, sediment surface, hunts point2021-01-02v4No1 / 8
722amnondominant united states of america, estuary, sediment, marine sediment, state of new york, new york city, sediment surface, soundview, oyster reef2021-01-02v4No1 / 8
821sheryoDominant in soil of miscanthus field at 50-100cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 50-100m, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-02v4No1 / 8
829sheryoDominanmt in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (dominant united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 108-140cm)2021-08-26v3No1 / 8
47amnonsmj: higher in mice immunized with placebo than with M. vaccae ( high in control immunized with vehicle bbs compared to immunized heat killed mycobacterium vaccae in feces united states of america research facility mus musculus male c57bc/6ncrl )2017-01-13v4No1 / 9
74amnondominant united states of america, rind, foodon product type2017-02-27v4No1 / 9
101amnoncommon united states of america, leaf, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 9
108amnondominant united states of america, research facility, caecum, oreochromis niloticus, state of texas, nile tilapia2017-04-07v4No1 / 9
301amnondominant united states of america, duodenum, canis lupus familiaris, dog2018-03-05v4No1 / 9
304amnondominant united states of america, beach, sand, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 9
308amnondominant feces, united states of america, research facility, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 9
341amnonhigh freq. in week old water (dominant united states of america, water, drinking water, tap water, state of illinois)2018-05-28v4No1 / 9
399amnondominant feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 9
399amnondominant feces, united states of america, state of tennessee, zoological garden, ailurus fulgens, red panda2018-11-16v4No1 / 9
408amnondominant united states of america, stomach, costa rica, ant, pheidole2018-11-22v4No1 / 9
408amnoncommon united states of america, stomach, costa rica, eciton, ant2018-11-22v4No1 / 9
456amnondominant tongue, united states of america, female, research facility, mus musculus, c57bl/6, mouse2019-01-10v4No1 / 9
462amnondominant united states of america, state of tennessee, populus, tree, cultivated environment, root2019-01-13v4No1 / 9
466amnondominant feces, united states of america, farm, bos taurus, state of georgia, cow2019-01-14v4No1 / 9
479amnondominant united states of america, rhizosphere, state of california, ph 6-7, heteromeles arbutifolia2019-02-05v4No1 / 9
479amnondominant united states of america, rhizosphere, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 9
535amnon high in dysplasia of cervix compared to control in homo sapiens united states of america female vagina adult state of arizona phoenix 2019-07-25v4No1 / 9
559amnondominant feces, united states of america, zoological garden, diceros bicornis, black rhinoceros, captive2019-11-03v4No1 / 9
626amnoncommon feces, united states of america, commonwealth of massachusetts, bird, captive, buteo jamaicensis, red-tailed hawk2020-05-16v1No1 / 9
658amnon high in caucasian european compared to african american in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 9
658amnon high in caucasian european compared to hispanic or latin american hispanic in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 9
665amnondominant united states of america, state of california, early time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland, outlet2020-09-23v4No1 / 9
711amnondominant homo sapiens, united states of america, oral cavity, child, state of colorado, mouth, age 8-12 years2028-05-21v4No1 / 9
786sheryoDominant in flood plain soil near cosumnes river, california, at 166-200cm depth (dominant united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve)2021-05-18v3No1 / 9
821sheryoDominant in soil of restored prairie at 50-100cm depth, Michigan USA (dominant united states of america, soil, state of michigan, depth 50-100m, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 9
866amnon high in ulcerative colitis ulcerative colitis compared to control in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 9
885amnon high in c57bl/6 compared to c57bl/6 t1r2-ko in feces united states of america research facility mus musculus state of ohio mouse 2022-03-26v3No1 / 9
26amnondominant united states of america, mucus, pair of nares, canis lupus familiaris2016-12-05v4No1 / 10
46amnonsmj: lower in female mice feces than treated with antibiotics ( high in control compared to antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 10
69amnondominant united states of america, research facility, nasal cavity, canis lupus familiaris, beagle dog2017-02-21v4No1 / 10
74amnondominant united states of america, capsicum annuum, foodon product type2017-02-27v4No1 / 10
74amnoncommon united states of america, allium sativum, foodon product type2017-02-27v4No1 / 10
74amnoncommon united states of america, solanum lycopersicum, foodon product type2017-02-27v4No1 / 10
79amnondominant united states of america, skin, harbor seal, phoca vitulina2017-03-03v4No1 / 10
79amnondominant united states of america, skin, balaenoptera acutorostrata, minke whale2017-03-03v4No1 / 10
79amnondominant united states of america, skin, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 10
79amnondominant united states of america, skin, phocoena phocoena, harbor porpoise2017-03-03v4No1 / 10
99amnondominant united states of america, mucus, skin, commonwealth of virginia, rana catesbeiana, bullfrog2017-04-02v4No1 / 10
113amnondominant united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 10
117amnondominant united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 10
170amnonlower in low phosphorus river water ( high in phosphorus high phosporus compared to low phosphorus in united states of america river stream water fresh water depth (water) 10cm )2017-07-24v4No1 / 10
234amnoncommon homo sapiens, united states of america, lung2017-11-07v4No1 / 10
255amnoncommon in fish feed (dominant united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 10
298amnondominant united states of america, desert, soil, state of utah, depth 1cm, soil crust2018-02-20v4No1 / 10
304amnondominant united states of america, beach, air, aerosol, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 10
304amnondominant united states of america, beach, sand, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 10
307amnonhigher in middle time points (2-3 weeks) in mice infeceted with chagas disease ( high in chagas disease compared to control in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 10
307amnondecreases with aging (4 week period) ( high in young age compared to age aging old age in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 10
308amnondominant united states of america, research facility, foot, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 10
311amnonhigh freq. in floor of kimchi production facility (dominant united states of america, food processing factory, state of rhode island, floor)2018-04-09v4No1 / 10
321amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, mouse2018-04-22v4No1 / 10
354amnondominant homo sapiens, united states of america, nasal cavity, pair of nares, adult, nasal brush2018-07-30v4No1 / 10
408amnon high in stomach compared to larval stage in united states of america costa rica cephalotes ant 2018-11-22v4No1 / 10
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 10
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex elongatus2018-11-22v4No1 / 10
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex cubaensis2018-11-22v4No1 / 10
443amnondominant united states of america, river, water, fresh water, mississippi river, particles, upstream, depth (water) 1m, filtered 2.7um, uppper mississippi river2019-01-07v4No1 / 10
481amnondominant united states of america, fishpond, research facility, water, fresh water, pond water, state of alabama2019-02-12v4No1 / 10
514amnondominant united states of america, desert, sandstone, state of utah, grand staircase-escalante national park, depth (soil) 0-1cm2019-03-25v4No1 / 10
523amnondominant united states of america, building, air, state of illinois, chicago, bedroom2019-07-03v4No1 / 10
544amnondominant united states of america, commonwealth of massachusetts, vaccinium macrocarpon, american cranberry, botanical fruit food product2019-08-04v4No1 / 10
559amnondominant feces, united states of america, zoological garden, ceratotherium simum, white rhinoceros, captive2019-11-03v4No1 / 10
632amnondominant feces, united states of america, research facility, adult, equus caballus, state of texas, horse2020-06-10v4No1 / 10
646amnoncommon homo sapiens, united states of america, mucus, lung, cystic fibrosis, adult, mild disease course, state of new hampshire, protected brush sampling2020-09-06v4No1 / 10
647amnondominant in skin of columbia spotted frog (dominant united states of america, lake, skin, frog, state of montana, rana luteiventris, columbia spotted frog)2020-09-06v4No1 / 10
647amnon high in skin frog rana luteiventris columbia spotted frog compared to lake water freshwater lake in united states of america state of montana 2020-09-06v4No1 / 10
665amnondominant united states of america, state of california, late time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 10
711amnondominant homo sapiens, united states of america, oral cavity, adult, state of colorado, mouth2028-05-21v4No1 / 10
786sheryoDominant in flood plain soil near cosumnes river, california, at 400-700cm depth (dominant united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 400-700cm)2021-05-18v3No1 / 10
806amnon high in dentition supragingival plaque supragingival dental plaque compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 10
829sheryoDominant in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (dominant united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 0-27cm)2021-08-26v3No1 / 10
829sheryoDominant in soil depth of 116-140cm in Mollisol soil, Dekalb, Illinois, united states of america (dominant united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 116-140cm)2021-08-26v3No1 / 10
921amnondominant skin, puerto rico, skin epidermis, bufo marinus, municipality of bayamon, cane toad2022-07-24v4No1 / 10
26amnonhigh freq. in combined swab of inguinal region and axilla (dominant homo sapiens, united states of america, sebum, axilla, inguinal region)2016-12-05v4No1 / 11
74amnondominant united states of america, rind, caerphilly cheese, foodon product type, cheese food product2017-02-27v4No1 / 11
99amnondominant united states of america, mucus, skin, commonwealth of virginia, anaxyrus americanus, american toad2017-04-02v4No1 / 11
146amnondominant united states of america, rhizosphere, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 11
171amnonhigh in draught soil compared to soil with rice growth irrigation protocol ( high in drought environment compared to control flooded soil in united states of america soil state of california depth 5cm )2017-07-25v4No1 / 11
191amnondominant homo sapiens, united states of america, female, pregnancy, vagina2017-09-05v4No1 / 11
228amnonhigh freq. in sinus brush of healthy participants (dominant homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space)2017-10-31v4No1 / 11
266amnonhigh freq. in soil from MAH garden (dominant united states of america, soil, state of idaho, ph 6)2017-12-18v4No1 / 11
308amnonhigh freq. in neonatal intensive care unit floor (dominant united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 11
311amnondominant united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 11
316amnondominant united states of america, soil, topsoil, state of ohio, ph 5, depth (soil) 0-10cm, forest ecosystem2018-04-10v4No1 / 11
351amnoncommon digestive system, united states of america, research facility, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 11
354amnondominant homo sapiens, sputum, united states of america, adult, induced sputum2018-07-30v4No1 / 11
388amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 11
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 11
399amnondominant feces, united states of america, state of tennessee, zoological garden, gorilla gorilla2018-11-16v4No1 / 11
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 11
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 11
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 11
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 11
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex pallidus2018-11-22v4No1 / 11
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex pallidus2018-11-22v4No1 / 11
446amnondominant united states of america, research facility, danio rerio, fish, zebrafish, larvae, age 15d2019-01-08v4No1 / 11
525amnoncommon in ground beef (common united states of america, state of colorado, foodon product type, ground beef food product)2019-07-10v4No1 / 11
535amnonhigh freq. in healthy adult vaginal samples (dominant homo sapiens, control, united states of america, female, vagina, adult, state of arizona, phoenix)2019-07-25v4No1 / 11
535amnoncommon in adult vaginal samples with ICC (common homo sapiens, united states of america, female, vagina, cervical carcinoma, adult, state of arizona, phoenix, invasive carcinoma, invasive cervical carcinoma)2019-07-25v4No1 / 11
535amnonhcommon in adult vaginal samples with cervical dysplasia (common homo sapiens, united states of america, female, vagina, adult, state of arizona, phoenix, dysplasia of cervix)2019-07-25v4No1 / 11
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in research facility dentition adult macaca mulatta puerto rico subgingival plaque monkey age 12-23 years )2019-08-01v4No1 / 11
544amnondominant united states of america, commonwealth of massachusetts, flower, vaccinium macrocarpon, american cranberry2019-08-04v4No1 / 11
558amnondominant united states of america, crop, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 11
620amnondominant feces, united states of america, zoological garden, gorilla gorilla, chicago, lincoln park zoo2020-05-06v4No1 / 11
644amnonhigher in older adults (total age range 20-80) ( high in age old age compared to young age in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 11
702amnondominant feces, united states of america, ovis aries, state of north carolina, sheep2028-04-02v4No1 / 11
806amnon high in palatine tonsil compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 11
829sheryoDominant in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (dominant united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 27-56cm)2021-08-26v3No1 / 11
829sheryoDominant in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (dominant united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 44-108cm)2021-08-26v3No1 / 11
26amnondominant united states of america, mucus, pair of nares, felis catus2016-12-05v4No1 / 12
26amnondominant homo sapiens, united states of america, mucus, pair of nares2016-12-05v4No1 / 12
74amnoncommon united states of america, daucus carota, carrot, foodon product type2017-02-27v4No1 / 12
74amnoncommon united states of america, curd, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 12
108amnoncommon united states of america, research facility, caecum, oreochromis niloticus, state of texas, nile tilapia2017-04-07v4No1 / 12
109amnondominant united states of america, water, drinking water, site c2017-04-08v4No1 / 12
123amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, mouse2017-04-13v4No1 / 12
137amnondominant feces, united states of america, state of florida, gopherus polyphemus, gopher tortoise2017-04-17v4No1 / 12
146amnondominant united states of america, flower structure, solanum lycopersicum, tomato, blossom2017-04-20v4No1 / 12
161amnonhigh freq. in barn swallows in colorado (dominant feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 12
231amnonhigh freq. in dog genitalia (dominant united states of america, reproductive system, reproductive organ, canis lupus familiaris, dog, genitalia)2017-11-02v4No1 / 12
266amnonhigh freq. in roots in JAM garden (dominant united states of america, state of idaho, plant, brassicaceae, boechera stricta, root)2017-12-19v4No1 / 12
266amnonhigh freq. in roots in MAH garden (dominant united states of america, state of idaho, plant, brassicaceae, boechera stricta, root)2017-12-19v4No1 / 12
301amnondominant united states of america, ileum, canis lupus familiaris, dog2018-03-05v4No1 / 12
307amnondominant feces, united states of america, research facility, mus musculus, c3h/hej, male, mouse2018-03-19v4No1 / 12
308amnondominant feces, united states of america, research facility, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 12
323amnondominant united states of america, water, surface water, sea water, atlantic ocean, state of florida, south florida, depth (soil) 0-20cm, depth (water) 0cm2018-04-24v4No1 / 12
323amnonhigh freq. in shark cloaca (dominant united states of america, anal canal, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 12
326amnonlower in lpr- mice in caloric restriction compared to control high fat diet ( high in control diet compared to caloric restriction diet in united states of america research facility mus musculus high fat diet c57bl/6 state of washington mouse ldlr- )2018-04-29v4No1 / 12
335amnonhigh freq. in mouthwash (dominant homo sapiens, united states of america, oral cavity, oral wash, mouth)2018-05-16v4No1 / 12
351amnonhigh freq. in aquarium artificial sea water where sea urchins were grown (dominant united states of america, research facility, sea water, aquarium, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 12
354amnondominant homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v4No1 / 12
399amnondominant feces, united states of america, research facility, mus musculus, mouse2018-11-18v4No1 / 12
408amnondominant united states of america, larval stage, costa rica, cephalotes, ant2018-11-22v4No1 / 12
408amnondominant united states of america, stomach, costa rica, ant, pseudomyrmex gracilis2018-11-22v4No1 / 12
408amnoncommon united states of america, stomach, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 12
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 12
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 12
460amnonhigh freq. in outdoor air (dominant united states of america, air, state of california, outdoor)2019-01-12v4No1 / 12
462amnondominant united states of america, state of tennessee, stem, populus, tree, populus trichocarpa x deltoides, cultivated environment2019-01-13v4No1 / 12
536amnondominant united states of america, skin, snake, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 12
556amnondominant feces, homo sapiens, united states of america, adult2019-09-14v1No1 / 12
559amnondominant feces, united states of america, zoological garden, captive, rhinoceros unicornis, greater one-horned rhinoceros2019-11-03v4No1 / 12
582amnondominant united states of america, wild, external ear, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 12
589amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, state of georgia, mouse, jackson laboratories, high fat diet + inulin2020-02-10v4No1 / 12
592amnondominant feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v1No1 / 12
647amnondominant united states of america, lake, water, state of montana, freshwater lake2020-09-06v4No1 / 12
684amnondominant homo sapiens, united states of america, nasal cavity, nasal cavity mucosa, adult, commonwealth of pennsylvania, nose, middle nasal meatus2028-03-05v1No1 / 12
689amnoncommon feces, homo sapiens, united states of america, hospital, adult, non c. diff diarrhea, tucson2028-03-11v4No1 / 12
699amnondominant united states of america, saline water, sea water, atlantic ocean, state of north carolina, florida, state of south carolina2028-04-01v4No1 / 12
718amnondominant united states of america, state of wisconsin, meromictic lake, epilimnion, bog lake, freshwater lake, ph 5.5-6, "mary lake"2028-05-23v4No1 / 12
786sheryoDominant in flood plain soil near cosumnes river, california, at 133-166cm depth (dominant united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 133-166cm)2021-05-18v3No1 / 12
806amnondominant homo sapiens, united states of america, adult, state of new york, gingiva, keratinized gingiva2021-06-19v3No1 / 12
806amnon high in saliva compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 12
817amnondominant united states of america, research facility, lung, bronchoalveolar lavage, commonwealth of pennsylvania, captive, macaca fascicularis, cynomolgus macaque2021-07-08v4No1 / 12
873amnondominant feces, homo sapiens, united states of america, adult, commonwealth of pennsylvania, human adult stage, urban community2022-03-03v1No1 / 12
47amnonsmj: higher in bullied immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in feces united states of america research facility mus musculus male immunization immunization mycobacterium vaccae c57bc/6ncrl )2017-01-13v4No1 / 13
74amnoncommon united states of america, allium cepa, foodon product type2017-02-27v4No1 / 13
108amnon high in colon compared to caecum in united states of america research facility mus musculus state of texas mouse 2017-04-07v4No1 / 13
150amnonlow in healthy dogs compared to EPI dogs without treatment ( high in exocrine pancreatic insufficiency compared to control in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 13
157amnonhigh freq. in naers of weened calves (dominant united states of america, nasal cavity, pair of nares, juvenile organism, bos taurus, calve)2017-07-04v4No1 / 13
158amnondominant united states of america, lower back, felis catus, cat2017-07-06v4No1 / 13
198amnon high in sediment compared to water in united states of america geothermal field yellowstone national park high temperature environment 2017-09-14v4No1 / 13
199amnonhigh freq. on shower wall tile (dominant united states of america, building, urban biome, bathroom, shower, tile, building wall)2017-10-01v4No1 / 13
214amnondominant feces, united states of america, research facility, mus musculus, mouse, mouse chow, strain 129s2017-10-23v4No1 / 13
220amnonhigher in mice supplemented with lactobacillus plantarum probiotics ( high in diet lactobacillus plantarum probiotics compared to control in feces united states of america female research facility mus musculus balb/c mouse )2017-10-24v4No1 / 13
243amnondominant digestive system, united states of america, beetle, anoplophora glabripennis2017-11-15v4No1 / 13
308amnondominant united states of america, research facility, foot, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 13
323amnonhigh freq. in shark skin (dominant united states of america, skin, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 13
389amnondominant united states of america, farm, vagina, sus scrofa, state of michigan, pig2018-11-04v4No1 / 13
399amnondominant feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 13
399amnondominant feces, united states of america, state of tennessee, zoological garden, ovis aries, sheep2018-11-16v4No1 / 13
405amnondominant feces, united states of america, research facility, mus musculus, mouse, ketogenic diet, swiss webster2018-11-20v4No1 / 13
408amnondominant united states of america, stomach, costa rica, crematogaster, ant2018-11-22v4No1 / 13
441amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, mouse, jackson laboratories2019-01-06v4No1 / 13
459amnonhigh freq. in surface in aquaculture biofilter sand (dominant united states of america, surface, fish farm, water, fresh water, sand, biofilter, state of wisconsin)2019-01-12v4No1 / 13
460amnonhigh freq. in occupied office air (dominant united states of america, air, state of california, indoor, office)2019-01-12v4No1 / 13
461amnondominant united states of america, water, surface water, sea water, coastal water, atlantic ocean, commonwealth of massachusetts2019-01-12v4No1 / 13
468amnonlower in kids who did not develop LRI in trachea of children with respiratory technology dependence ( high in lower respiratory tract disease compared to control in homo sapiens united states of america trachea child tracheal aspirate respiratory technology dependent )2019-01-14v4No1 / 13
502amnon high in schizophrenia compared to control in feces homo sapiens united states of america adult 2019-03-12v4No1 / 13
508amnondominant united states of america, lake sediment, sediment, state of minnesota, manganika lake, hypereutrophic lake, sulfidic bottom water2019-03-17v4No1 / 13
516amnondominant homo sapiens, united states of america, urine, adult, state of ohio2019-05-29v4No1 / 13
536amnondominant united states of america, skin, snake, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v4No1 / 13
536amnondominant united states of america, skin, pantherophis obsoletus, snake, southern united states, black rat snake, arboreal snake2019-07-28v4No1 / 13
625amnondominant feces, united states of america, zoological garden, gorilla gorilla, state of minnesota, como zoo2020-05-16v4No1 / 13
636amnoncommon homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, respiratory failure, acute respiratory failure, trachea, endotracheal aspirate2020-08-08v4No1 / 13
644amnondominant feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 13
647amnoncommon in skin of columbia spotted frog (common united states of america, lake, skin, frog, state of montana, rana luteiventris, columbia spotted frog)2020-09-06v4No1 / 13
710amnondominant united states of america, research facility, mus musculus, state of california, mouse, mouse chow, swiss webster, control diet2028-05-20v4No1 / 13
718amnondominant united states of america, state of wisconsin, meromictic lake, hypolimnion, bog lake, freshwater lake, "hells kitchen" lake2028-05-23v4No1 / 13
731amnondominant homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v4No1 / 13
748amnondominant feces, united states of america, research facility, bos taurus, cow, female organism, state of mississippi, jersey cow2021-03-10v4No1 / 13
748amnondominant feces, united states of america, research facility, bos taurus, cow, female organism, state of mississippi, holstein dairy cow2021-03-10v4No1 / 13
788amnondominant feces, united states of america, state of georgia, mesocosm, cherokia georgiana georgiana, millipede2021-05-31v4No1 / 13
806amnondominant homo sapiens, united states of america, oral cavity, adult, state of new york, oral wash, mouth2021-06-19v3No1 / 13
866amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, stress, state of illinois, mouse, restraint stress2022-02-08v4No1 / 13
902amnondominant feces, united states of america, antibiotic, salmonella gastroenteritis, equus caballus, horse, adult organism, salmonellosis2022-05-02v4No1 / 13
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v4No1 / 14
79amnondominant united states of america, skin, stenella longirostris, spinner dolphin2017-03-03v4No1 / 14
158amnondominant united states of america, conjunctiva, felis catus, cat2017-07-06v4No1 / 14
158amnondominant united states of america, pair of nares, felis catus, cat2017-07-06v4No1 / 14
170amnondominant united states of america, river, stream, water, fresh water, depth (water) 10cm2017-07-24v4No1 / 14
185amnoncommon in patients with c. diff infection before treatment (common feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
186amnondominant united states of america, research facility, caecum, sprague dawley, rattus, rat2017-08-23v4No1 / 14
214amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, mouse, mouse chow2017-10-23v4No1 / 14
220amnondominant feces, united states of america, female, research facility, mus musculus, balb/c, diet, high fat diet, mouse2017-10-24v4No1 / 14
224amnondominant united states of america, glacier, snow field, stratovolcano, state of oregon, snow2017-10-26v4No1 / 14
231amnonlower in urine compared to genitalia in dogs ( high in reproductive system reproductive organ compared to urine in united states of america canis lupus familiaris dog )2017-11-02v4No1 / 14
285amnonhigh freq. in effluent from middle ear (dominant homo sapiens, united states of america, middle ear, acute transudative otitis media, child, state of washington, obsolete_juvenile stage)2018-01-27v4No1 / 14
304amnoncandidate contaminants - higher in blanks (contamination)2018-03-12v4No1 / 14
308amnondominant united states of america, research facility, shell, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 14
311amnondominant united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 14
388amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 14
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 8 hours2018-11-04v4No1 / 14
393amnondominant feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 14
399amnondominant feces, united states of america, research facility, oryctolagus cuniculus, rabbit2018-11-16v4No1 / 14
406amnondominant feces, united states of america, zoological garden, giraffa camelopardalis, giraffe2018-11-21v4No1 / 14
408amnon high in larval stage compared to stomach in united states of america costa rica cephalotes ant 2018-11-22v4No1 / 14
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 14
456amnon high in tongue compared to caecum in united states of america female research facility mus musculus c57bl/6 mouse 2019-01-10v4No1 / 14
458amnonhigh freq. in mice strains from jackson laboratories (dominant feces, united states of america, female, research facility, mus musculus, mouse, jackson laboratories)2019-01-11v4No1 / 14
469amnondominant homo sapiens, united states of america, lung, bronchoalveolar lavage, adult, state of new york, idiopathic pulmonary fibrosis2019-01-14v4No1 / 14
502amnon high in control compared to schizophrenia in feces homo sapiens united states of america adult 2019-03-12v4No1 / 14
508amnondominant united states of america, lake, water, fresh water, state of minnesota, mcquade lake, lake water2019-03-17v4No1 / 14
536amnondominant united states of america, skin, snake, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 14
560amnondominant united states of america, female, zoological garden, ceratotherium simum, white rhinoceros, captive, san diego zoo, ceratotherium simum simum2019-11-04v4No1 / 14
592amnondominant digestive system, united states of america, state of florida, carcharhinus plumbeus, snadbar shark2020-02-18v1No1 / 14
626amnoncommon feces, united states of america, commonwealth of massachusetts, bird, captive, strix varia, barred owl2020-05-16v1No1 / 14
646amnondominant homo sapiens, sputum, united states of america, cystic fibrosis, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 14
648amnon high in antibiotic metronidazole compared to control in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 14
665amnondominant united states of america, state of california, early time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 14
684amnoncommon homo sapiens, united states of america, nasal cavity, nasal cavity mucosa, adult, commonwealth of pennsylvania, nose, middle nasal meatus2028-03-05v1No1 / 14
718amnondominant united states of america, state of wisconsin, epilimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "trout bog" lake2028-05-23v4No1 / 14
718amnondominant united states of america, state of wisconsin, meromictic lake, hypolimnion, bog lake, freshwater lake, ph 5.5-6, "mary lake"2028-05-23v4No1 / 14
748amnondominant united states of america, research facility, rumen, bos taurus, cow, female organism, ruminal fluid, state of mississippi, jersey cow2021-03-10v4No1 / 14
759amnondominant feces, united states of america, sus scrofa, state of alabama, wild, wild boar2021-04-04v4No1 / 14
770amnondominant feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 14
770amnondominant macaca mulatta, age > 1 year, penis, male organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 14
770amnondominant vagina, macaca mulatta, age > 1 year, female organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 14
786sheryoDominant in flood plain soil near cosumnes river, california, at 100-133cm depth (dominant united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 100-133cm)2021-05-18v3No1 / 14
876amnondominant feces, united states of america, research facility, juvenile organism, macaca mulatta, state of washington, monkey, age 20 months2022-03-06v4No1 / 14
876amnondominant feces, united states of america, research facility, macaca mulatta, state of washington, age 1 week, monkey, neonate2022-03-06v4No1 / 14
51amnondominant feces, homo sapiens, united states of america2017-01-19v4No1 / 15
69amnondominant united states of america, research facility, bronchoalveolar lavage, canis lupus familiaris, beagle dog2017-02-21v4No1 / 15
74amnondominant feces, homo sapiens, united states of america2017-02-27v4No1 / 15
79amnondominant united states of america, skin, balaenoptera physalus, fin whale2017-03-03v4No1 / 15
79amnoncommon united states of america, skin, tursiops truncatus, bottlenosed dolphin2017-03-03v4No1 / 15
99amnondominant united states of america, mucus, skin, notophthalmus viridescens, commonwealth of virginia, newt2017-04-02v4No1 / 15
102amnon high in control compared to hiv infection in homo sapiens united states of america cheek atlanta mouth 2017-04-04v4No1 / 15
107amnondominant united states of america, research facility, colon, state of texas, eublepharis macularius, leopard gecko2017-04-07v4No1 / 15
158amnondominant united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 15
158amnoncommon united states of america, lower back, felis catus, cat2017-07-06v4No1 / 15
200amnonhighfreq. in river downstream of wastewater treatment plant (dominant united states of america, river, water, fresh water, wastewater treatment plant, effluent)2017-10-01v4No1 / 15
228amnonhigh freq. in sinus brush of sinusitis patients (dominant homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space, sinusitis)2017-10-31v4No1 / 15
276amnondominant feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 15
300amnondominant united states of america, female, research facility, caecum, rattus norvegicus, rat, ovariectomy, age 38 weeks2018-02-27v4No1 / 15
304amnondominant united states of america, beach, water, sea water, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 15
308amnonhigh freq. in water of aquarium with red abalone (dominant united states of america, research facility, water, sea water, aquarium, state of california, red abalone, haliotis rufescens)2018-03-30v4No1 / 15
308amnondominant united states of america, research facility, shell, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 15
323amnonhigh freq. in shark gills (dominant united states of america, gill, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 15
326amnondominant united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of washington, mouse, ldlr-2018-04-29v4No1 / 15
335amnondominant homo sapiens, united states of america, bronchial epithelium2018-05-16v4No1 / 15
341amnonlower in fresh drinking water compared to week old water ( high in stagnant water compared to fresh water in united states of america water drinking water tap water state of illinois )2018-05-28v4No1 / 15
341amnondominant united states of america, water, fresh water, drinking water, tap water, state of illinois2018-05-28v4No1 / 15
341amnoncommon in week old water (common united states of america, water, drinking water, tap water, state of illinois)2018-05-28v4No1 / 15
354amnondominant homo sapiens, united states of america, bronchus, bronchial epithelium, adult, bronchial brush2018-07-30v4No1 / 15
383amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, mouse, ketogenic diet, f3666 diet2018-10-22v4No1 / 15
405amnondominant feces, united states of america, research facility, mus musculus, mouse, swiss webster, control diet2018-11-20v4No1 / 15
406amnondominant feces, united states of america, zoological garden, switzerland, diceros bicornis, black rhinoceros2018-11-21v4No1 / 15
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex flavicornis2018-11-22v4No1 / 15
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex viduus2018-11-22v4No1 / 15
409amnon high in left colon compared to right colon in homo sapiens united states of america colon biopsy site biopsy 2018-11-22v4No1 / 15
409amnondominant homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 15
432amnondominant united states of america, stem, state of north carolina, plant, tsuga dumosa, himalayan hemlock2018-12-19v4No1 / 15
435amnoncommon feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 4 weeks2018-12-23v4No1 / 15
441amnonlower in mice treated with indomethacin NSAID compared to non-treated controls ( high in control compared to non-steroidal anti-inflammatory drug indomethacin in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 15
456amnondominant united states of america, female, research facility, caecum, mus musculus, c57bl/6, mouse2019-01-10v4No1 / 15
456amnoncommon tongue, united states of america, female, research facility, mus musculus, c57bl/6, mouse2019-01-10v4No1 / 15
462amnondominant united states of america, state of tennessee, leaf, populus, tree, cultivated environment2019-01-13v4No1 / 15
476amnonhigher in mice supplied with fluoxetine compared to control ( high in fluoxetine compared to control in feces united states of america research facility mus musculus state of iowa mouse cf-1 )2019-01-28v4No1 / 15
502amnondominant feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 15
508amnondominant united states of america, lake, water, fresh water, state of minnesota, lake water, manganika lake, hypereutrophic lake, sulfidic bottom water2019-03-17v4No1 / 15
536amnondominant united states of america, skin, snake, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 15
542amnonhigher in ligature induced periodontitis compared to control timepoints ( high in induced periodontitis periodontitis compared to control in research facility dentition macaca mulatta child puerto rico subgingival plaque monkey age 1-7 years )2019-08-01v4No1 / 15
559amnondominant feces, united states of america, zoological garden, captive, dicerorhinus sumatrensis, sumatran rhinoceros2019-11-03v4No1 / 15
560amnondominant united states of america, female, zoological garden, captive, san diego zoo, rhinoceros unicornis, greater one-horned rhinoceros2019-11-04v4No1 / 15
612amnondominant united states of america, water, fresh water, state of florida, spring water, location 52020-04-22v4No1 / 15
620amnondominant feces, united states of america, zoological garden, pan troglodytes, chimpanzee, saint louis, saint louis zoo2020-05-06v4No1 / 15
651amnondominant feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 15
651amnondominant feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 15
658amnon high in african american compared to caucasian european in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 15
658amnon high in hispanic or latin american hispanic compared to asian burmese in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 15
671amnondominant feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 15
690amnondominant in squamous esophagos samples from patients undergoing endoscopy (dominant homo sapiens, united states of america, hospital, esophagus, new york city, esophageal disease, squamous esophagus)2028-03-11v4No1 / 15
702amnoncommon feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-02v4No1 / 15
708amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, mouse, state of montana2028-05-16v4No1 / 15
770amnondominant feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 15
788amnondominant united states of america, state of georgia, mesocosm, plant litter2021-05-31v4No1 / 15
802amnondominant homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 15
806amnondominant homo sapiens, united states of america, dentition, adult, state of new york, supragingival plaque, supragingival dental plaque2021-06-19v3No1 / 15
806amnondominant homo sapiens, united states of america, adult, state of new york, dorsum of tongue2021-06-19v3No1 / 15
846amnondominant homo sapiens, united states of america, saliva, adult, commonwealth of massachusetts, human adult stage, stimulated saliva2021-11-20v3No1 / 15
892amnon high in 2-year-old human stage compared to 4-year-old human stage in homo sapiens united states of america saliva child 2022-04-07v4No1 / 15
19amnonhigh freq in biopsies of children (IBD study) (dominant homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 16
46amnonsmj: higher in female mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 16
51amnondominant homo sapiens, united states of america, biopsy site, biopsy2017-01-19v4No1 / 16
74amnoncommon united states of america, rind, foodon product type, cheese food product, camembert cheese food product2017-02-27v4No1 / 16
79amnondominant united states of america, skin, stenella attenuata2017-03-03v4No1 / 16
108amnondominant united states of america, research facility, colon, state of texas, anaxyrus terrestris, southern toad2017-04-07v4No1 / 16
150amnonlow in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in enzyme supplementation exocrine pancreatic insufficiency compared to control in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 16
158amnondominant united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 16
162amnon high in control compared to periodontitis in homo sapiens united states of america dentition san diego subgingival plaque periodontal pocket mouth 2017-07-13v4No1 / 16
198amnondominant united states of america, hot spring, geothermal field, water, yellowstone national park, high temperature environment2017-09-13v4No1 / 16
211amnonHigh freq. in multiple mouse strains feces (dominant feces, united states of america, research facility, mus musculus, high fat diet, mouse)2017-10-22v4No1 / 16
214amnondominant feces, united states of america, research facility, mus musculus, c57bl/6j, high fat diet, mouse2017-10-23v4No1 / 16
226amnondominant united states of america, lake, freshwater lake, water, fresh water, lake erie2017-10-29v4No1 / 16
304amnondominant united states of america, beach, water, sea water, state of california, pacific ocean, santa cruz county2018-03-12v4No1 / 16
317amnondominant united states of america, water, sea water, state of california, pacific ocean, depth (water) 300m, depth (water) 75m, depth (water) 150m2018-04-15v4No1 / 16
319amnondominant homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 16
343amnonhigh freq. in apple flowers (dominant united states of america, flower structure, malus x domestica, state of connecticut, flower, apple)2018-05-28v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child inflammatory bowel disease crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
399amnondominant feces, united states of america, state of tennessee, zoological garden, pan troglodytes, chimpanzee2018-11-16v4No1 / 16
408amnoncommon united states of america, larval stage, costa rica, cephalotes, ant2018-11-22v4No1 / 16
416amnondominant united states of america, research facility, colon, termite, reticulitermes flaviceps2018-11-30v4No1 / 16
427amnondominant feces, united states of america, commonwealth of virginia, salamander, eastern red backed salamander, plethodon cinereus2018-12-08v4No1 / 16
443amnondominant united states of america, river, water, fresh water, mississippi river, particles, downstream, depth (water) 1m, filtered 2.7um, lower mississippi river2019-01-07v4No1 / 16
471amnondominant digestive system, united states of america, research facility, tadpole, state of florida, frog, osteopilus septentrionalis2019-01-14v4No1 / 16
476amnonlower in mice supplied with fluoxetine compared to control ( high in control compared to fluoxetine in feces united states of america research facility mus musculus state of iowa mouse cf-1 )2019-01-28v4No1 / 16
493amnondominant homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 16
528amnondominant homo sapiens, united states of america, female, pregnancy, vagina2019-07-14v1No1 / 16
535amnonhigh freq. in adult vaginal samples with cervical dysplasia (dominant homo sapiens, united states of america, female, vagina, adult, state of arizona, phoenix, dysplasia of cervix)2019-07-25v4No1 / 16
535amnon high in control compared to dysplasia of cervix in homo sapiens united states of america female vagina adult state of arizona phoenix 2019-07-25v4No1 / 16
536amnondominant united states of america, skin, snake, crotalus horridus, southern united states, timber rattlesnake2019-07-28v4No1 / 16
582amnondominant united states of america, axilla, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 16
589amnondominant feces, united states of america, research facility, mus musculus, low fat diet, c57bl/6, state of georgia, mouse, mouse chow, jackson laboratories2020-02-10v4No1 / 16
612amnondominant united states of america, water, fresh water, state of florida, spring water, location 22020-04-22v4No1 / 16
612amnondominant united states of america, water, fresh water, state of florida, spring water, location 32020-04-22v4No1 / 16
620amnondominant feces, united states of america, zoological garden, pan troglodytes, chicago, chimpanzee, lincoln park zoo2020-05-06v4No1 / 16
625amnondominant feces, united states of america, zoological garden, state of minnesota, pongo abelii, sumatran orangutan, como zoo2020-05-16v4No1 / 16
683amnondominant during antibiotics treatment in feces (dominant feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 16
710amnondominant united states of america, research facility, mus musculus, state of california, mouse, ketogenic diet, swiss webster2028-05-20v4No1 / 16
718amnondominant united states of america, state of wisconsin, epilimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "south sparkling bog" lake2028-05-23v4No1 / 16
719amnondominant united states of america, research facility, dentition, mus musculus, state of georgia, mouse, charles river laboratories, icr/cd-1 mice2028-05-23v4No1 / 16
748amnondominant united states of america, research facility, rumen, bos taurus, cow, female organism, ruminal fluid, state of mississippi, holstein dairy cow2021-03-10v4No1 / 16
816amnondominant feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, late pregnancy2021-07-04v4No1 / 16
884amnondominant feces, homo sapiens, united states of america, adult, state of california, human adult stage2022-03-24v4No1 / 16
892amnondominant homo sapiens, united states of america, saliva, infant, 1-year-old human stage2022-04-07v4No1 / 16
893amnondominant united states of america, research facility, fertilized soil, rhizosphere, commonwealth of virginia, radish, greenhouse, raphanus sativus, silty clay loam2022-04-11v4No1 / 16
902amnondominant feces, united states of america, colitis, antibiotic, equus caballus, horse, adult organism, colitis, antibiotics induced colitis2022-05-02v4No1 / 16
922amnondominant homo sapiens, united states of america, saliva, infant, 1-year-old human stage, no dental caries2022-07-25v4No1 / 16
74amnoncommon united states of america, rind, foodon product type, cheddar cheese food product2017-02-27v4No1 / 17
108amnonincreases during fasting in nile tilapia caecum ( high in fasting late timepoints compared to early timepoints in united states of america research facility caecum oreochromis niloticus state of texas nile tilapia )2017-04-07v4No1 / 17
109amnondominant united states of america, water, drinking water, site a2017-04-08v4No1 / 17
158amnondominant united states of america, axilla, felis catus, cat2017-07-06v4No1 / 17
196amnonhigh freq. in biofilm in tap water (dominant united states of america, water, biofilm, drinking water, biofilm)2017-09-12v4No1 / 17
199amnonhigh freq. in kitchen sink (dominant united states of america, building, urban biome, kitchen, sink)2017-10-01v4No1 / 17
208amnondominant feces, united states of america, mus musculus, balb/c, state of texas, mouse2017-10-06v4No1 / 17
212amnondominant feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 17
212amnondominant feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 17
215amnonhigher in people with Roux-en-Y gastric bypass compared to controls ( high in gastric bypass compared to control in feces homo sapiens united states of america )2017-10-23v4No1 / 17
266amnonhigh freq. on perennial plant leaves (dominant united states of america, leaf, state of idaho, plant, brassicaceae, boechera stricta)2017-12-19v4No1 / 17
278amnondominant homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 17
289amnondominant feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 17
300amnon high in sedentary low physical activity compared to exercise high physical activity in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks low capacity running strain 2018-02-27v4No1 / 17
307amnonhigher in late time points in mice infeceted with chagas disease ( high in chagas disease compared to control in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 17
311amnoncommon united states of america, state of rhode island, kimchi, food (fermented)2018-04-09v4No1 / 17
317amnondominant united states of america, water, surface water, sea water, state of california, pacific ocean, depth (water) 5m2018-04-15v4No1 / 17
337amnonhigh freq. in feces of house mice from new york city (dominant united states of america, city, mus musculus, new york city, mouse, house mice)2018-05-18v4No1 / 17
351amnondominant united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 17
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 17
368amnondominant feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 17
389amnondominant united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 17
389amnondominant united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 17
389amnondominant united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v4No1 / 17
400amnonhigh freq. in feces of european american females (dominant feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 17
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex gracilis2018-11-22v4No1 / 17
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex nigrocinctus2018-11-22v4No1 / 17
432amnondominant united states of america, stem, state of north carolina, plant, tsuga chinensis, chinese hemlock2018-12-19v4No1 / 17
443amnondominant united states of america, river, water, fresh water, mississippi river, free floating, upstream, depth (water) 1m, filtered 0.2um, uppper mississippi river2019-01-07v4No1 / 17
460amnoncommon in occupied office air (common united states of america, air, state of california, indoor, office)2019-01-12v4No1 / 17
481amnondominant united states of america, research facility, intestine, ictalurus punctatus, state of alabama, channel catfish2019-02-12v4No1 / 17
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in research facility dentition macaca mulatta child puerto rico subgingival plaque monkey age 1-7 years )2019-08-01v4No1 / 17
589amnondominant in high fat diet supplemented with cellulose in mice feces (dominant feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v4No1 / 17
591amnondominant feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v4No1 / 17
636amnoncommon homo sapiens, united states of america, hospital, oropharynx, adult, commonwealth of pennsylvania, acute respiratory failure, respiratory failure, oropharyngeal swab2020-08-08v4No1 / 17
658amnondominant homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, asian, burmese, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 17
718amnondominant united states of america, state of wisconsin, hypolimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "trout bog" lake2028-05-23v4No1 / 17
719amnonhigher in diet containing fiber compared to non fiber containing diet ( high in fiber diet compared to control diet in united states of america research facility dentition mus musculus state of georgia mouse charles river laboratories icr/cd-1 mice )2028-05-23v4No1 / 17
759amnondominant feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 17
806amnon high in dorsum of tongue compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 17
816amnondominant feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, early pregnancy2021-07-04v4No1 / 17
829sheryoDominant in soil depth of 56-116cm in Mollisol soil, Dekalb, Illinois, united states of america (dominant united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 56-116cm)2021-08-26v3No1 / 17
892amnondominant homo sapiens, united states of america, saliva, child, 4-year-old human stage2022-04-07v4No1 / 17
922amnondominant homo sapiens, united states of america, saliva, child, 4-year-old human stage, no dental caries2022-07-25v4No1 / 17
26amnondominant united states of america, saliva, canis lupus familiaris, mouth2016-12-05v4No1 / 18
79amnondominant united states of america, skin, lagenorhynchus acutus2017-03-03v4No1 / 18
79amnondominant united states of america, skin, physeter catodon2017-03-03v4No1 / 18
102amnon high in control compared to hiv infection in homo sapiens united states of america dentition atlanta mouth 2017-04-04v4No1 / 18
158amnondominant united states of america, external acoustic meatus, felis catus, cat, ear canal2017-07-06v4No1 / 18
196amnondominant united states of america, water, drinking water2017-09-12v4No1 / 18
205amnonhigh freq. in rock piles from duluth complex (dominant united states of america, quarry, rock, state of minnesota, sulfide, duluth complex, ph 4-5)2017-10-03v4No1 / 18
214amnondominant feces, united states of america, research facility, mus musculus, high fat diet, mouse, strain 129s2017-10-23v4No1 / 18
215amnondominant feces, homo sapiens, united states of america2017-10-23v4No1 / 18
220amnondominant feces, united states of america, female, research facility, mus musculus, balb/c, diet, low fat diet, mouse, mouse chow2017-10-24v4No1 / 18
293amnondominant feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 18
304amnondominant united states of america, beach, air, aerosol, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 18
307amnonincreases with aging (4 week period) ( high in age aging old age compared to young age in feces united states of america research facility mus musculus c3h/hej male mouse )2018-03-19v4No1 / 18
308amnonhigh freq. in aquarium water with white abalone (dominant united states of america, research facility, water, sea water, aquarium, state of california, haliotis sorenseni, white abalone)2018-03-30v4No1 / 18
351amnondominant feces, united states of america, research facility, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 18
368amnondominant feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 18
408amnoncommon united states of america, stomach, costa rica, cephalotes, ant2018-11-22v4No1 / 18
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex nigropilosus2018-11-22v4No1 / 18
408amnondominant united states of america, larval stage, costa rica, ant, pseudomyrmex simplex2018-11-22v4No1 / 18
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in severe ulcerative colitis compared to mild in feces homo sapiens united states of america child )2018-11-22v4No1 / 18
430amnondominant feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 18
466amnonhigh freq. in cow feces left in field for 30-60 days (dominant feces, united states of america, farm, bos taurus, state of georgia, cow, late timepoints, 30-60 days)2019-01-14v4No1 / 18
536amnondominant united states of america, skin, snake, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 18
563amnondominant feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v4No1 / 18
582amnondominant united states of america, wild, lip, labial commissure, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 18
623amnoncommon homo sapiens, united states of america, skin, adult, commonwealth of pennsylvania, skin of body, umbilicus2020-05-10v3No1 / 18
625amnondominant feces, united states of america, zoological garden, state of minnesota, pithecia pithecia, white-faced saki, como zoo2020-05-16v4No1 / 18
625amnondominant feces, united states of america, zoological garden, state of minnesota, saguinus imperator, como zoo, emperor tamarin2020-05-16v4No1 / 18
636amnon high in tracheal aspirate trachea endotracheal aspirate compared to oropharynx oropharyngeal swab in homo sapiens united states of america hospital adult commonwealth of pennsylvania acute respiratory failure respiratory failure 2020-08-08v4No1 / 18
650amnondominant feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 18
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, age 6 months, captive, rhesus macaque2020-09-27v4No1 / 18
718amnondominant united states of america, state of wisconsin, hypolimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "north sparkling bog" lake2028-05-23v4No1 / 18
718amnondominant united states of america, state of wisconsin, hypolimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "south sparkling bog" lake2028-05-23v4No1 / 18
770amnondominant oral cavity, mouth mucosa, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 18
806amnondominant homo sapiens, united states of america, pair of nares, adult, state of new york, external naris2021-06-19v3No1 / 18
806amnondominant homo sapiens, united states of america, mouth mucosa, adult, state of new york, buccal mucosa2021-06-19v3No1 / 18
806amnondominant homo sapiens, united states of america, adult, state of new york, hard palate2021-06-19v3No1 / 18
817amnondominant united states of america, research facility, saliva, oral cavity, commonwealth of pennsylvania, oral wash, captive, cheek pouch, macaca fascicularis, cynomolgus macaque2021-07-07v4No1 / 18
841amnondominant homo sapiens, united states of america, saliva, adult, state of texas, human adult stage2021-11-08v4No1 / 18
874amnondominant homo sapiens, united states of america, female, state of new york, subgingival plaque, subgingival dental plaque, postmenopausal, buffalo, human late adulthood stage2022-03-04v3No1 / 18
885amnondominant feces, homo sapiens, united states of america, state of florida, human early adulthood stage2022-03-26v3No1 / 18
892amnondominant homo sapiens, united states of america, saliva, adult, human adult stage2022-04-07v4No1 / 18
892amnondominant homo sapiens, united states of america, saliva, child, 2-year-old human stage2022-04-07v4No1 / 18
922amnondominant homo sapiens, united states of america, saliva, adult, human adult stage2022-07-25v4No1 / 18
922amnondominant homo sapiens, united states of america, saliva, child, 2-year-old human stage, no dental caries2022-07-25v4No1 / 18
54amnondominant homo sapiens, united states of america, saliva2017-01-23v4No1 / 19
99amnondominant united states of america, mucus, skin, commonwealth of virginia, pseudacris crucifer, peeper2017-04-02v4No1 / 19
101amnoncommon united states of america, vitis vinifera, state of new york, merlot, grapevine, grape, botanical fruit food product2017-04-03v4No1 / 19
108amnonincreases during fasting in mouse caecum ( high in fasting late timepoints compared to early timepoints in united states of america research facility caecum mus musculus state of texas mouse )2017-04-07v4No1 / 19
109amnondominant united states of america, water, drinking water, site d2017-04-08v4No1 / 19
146amnondominant united states of america, solanum lycopersicum, tomato, botanical fruit food product2017-04-20v4No1 / 19
174amnonhigh freq. in debris covered glacier (dominant united states of america, glacier, surface, denali national park and preserve, alaska, debris)2017-07-27v4No1 / 19
261amnondominant united states of america, rumen, bos taurus, state of nebraska, cow2017-12-10v4No1 / 19
285amnoncommon in effluent from middle ear (common homo sapiens, united states of america, middle ear, acute transudative otitis media, child, state of washington, obsolete_juvenile stage)2018-01-27v4No1 / 19
301amnondominant united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 19
323amnonhigh freq. in shark teeth (dominant united states of america, dentition, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 19
401amnondominant feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 19
408amnoncommon united states of america, larval stage, costa rica, crematogaster, ant2018-11-22v4No1 / 19
443amnondominant united states of america, river, water, fresh water, mississippi river, free floating, downstream, depth (water) 1m, filtered 0.2um, lower mississippi river2019-01-07v4No1 / 19
477amnondominant feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 19
511amnondominant united states of america, state of colorado, depth 0-5cm, snow2019-03-20v4No1 / 19
516amnondominant feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 19
542amnondominant research facility, dentition, adult, macaca mulatta, puerto rico, subgingival plaque, monkey, age 12-23 years2019-08-01v4No1 / 19
542amnondominant research facility, dentition, macaca mulatta, child, puerto rico, subgingival plaque, monkey, age 1-7 years2019-08-01v4No1 / 19
558amnondominant united states of america, colon, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 19
558amnondominant united states of america, duodenum, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 19
573amnondominant feces, united states of america, juvenile stage, canis lupus familiaris, commonwealth of pennsylvania, dog2019-12-22v4No1 / 19
582amnondominant united states of america, pair of nares, wild, external naris, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 19
582amnondominant united states of america, rectum, wild, perianal skin, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 19
589amnon high in high fat diet + inulin compared to low fat diet mouse chow in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 19
592amnondominant digestive system, united states of america, wild, acheta domesticus, cricket2020-02-18v1No1 / 19
612amnondominant united states of america, water, fresh water, state of florida, spring water, location 42020-04-22v4No1 / 19
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 19
689amnoncommon feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 19
706amnondominant feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-10v4No1 / 19
803amnondominant feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, type 2 diabetes mellitus, caribbean latino, human late adulthood stage2021-06-18v4No1 / 19
806amnondominant homo sapiens, united states of america, adult, state of new york, palatine tonsil2021-06-19v3No1 / 19
866amnondominant feces, control, united states of america, research facility, mus musculus, c57bl/6, state of illinois, mouse2022-02-08v4No1 / 19
866amnon high in crohn's disease crohn's disease compared to control in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 19
885amnon high in c57bl/6 t1r2-ko compared to c57bl/6 in feces united states of america research facility mus musculus state of ohio mouse 2022-03-26v3No1 / 19
26amnondominant united states of america, saliva, felis catus, mouth2016-12-05v4No1 / 20
46amnonsmj: higher in mice feces with antiobiotics ( high in antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt compared to control in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 20
69amnondominant united states of america, research facility, oropharynx, canis lupus familiaris, beagle dog2017-02-21v4No1 / 20
79amnondominant united states of america, skin, balaenoptera borealis, sei whale2017-03-03v4No1 / 20
109amnon high in distribution system compared to water treatment plant in united states of america water drinking water site b 2017-04-08v4No1 / 20
158amnondominant united states of america, saliva, felis catus, cat, mouth2017-07-06v4No1 / 20
162amnonhigh freq. in periodontal pocket in humans (dominant homo sapiens, united states of america, dentition, san diego, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 20
167amnonhigher in late timepoints in mice with induced eae compared to control ( high in experimental autoimmune encephalomyelitis compared to control in feces united states of america female research facility mus musculus nod mouse mouse )2017-07-18v4No1 / 20
242amnonhigh freq. in native-americans (dominant feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 20
322amnondominant digestive system, united states of america, research facility, tadpole, state of florida, frog, osteopilus septentrionalis2018-04-23v4No1 / 20
344amnonhigh freq. in feces of homosexual males (dominant feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 20
368amnondominant feces, united states of america, research facility, mus musculus, mouse, nzb/w f12018-09-03v4No1 / 20
394amnondominant feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 20
399amnondominant feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 20
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
408amnondominant united states of america, stomach, costa rica, cephalotes, ant2018-11-22v4No1 / 20
409amnondominant homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 20
437amnondominant united states of america, research facility, intestine, juvenile organism, danio rerio, state of oregon, zebra fish, fish, age 21 days2018-12-26v4No1 / 20
468amnonhigh freq. in trachea of children with respiratory technology dependence (dominant homo sapiens, united states of america, trachea, child, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 20
476amnondominant feces, united states of america, research facility, mus musculus, state of iowa, mouse, cf-12019-01-28v4No1 / 20
484amnondominant feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 20
535amnonhigh freq. in adult vaginal samples with ICC (dominant homo sapiens, united states of america, female, vagina, cervical carcinoma, adult, state of arizona, phoenix, invasive carcinoma, invasive cervical carcinoma)2019-07-25v4No1 / 20
536amnondominant united states of america, skin, snake, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 20
536amnondominant united states of america, skin, snake, southern united states, fossorial snake, carphophis amoenus, worm snake2019-07-28v4No1 / 20
563amnondominant feces, homo sapiens, united states of america, hiv infection, homosexual, msm, male, rectal swab2019-11-18v4No1 / 20
591amnon high in parkinson's disease compared to control in feces homo sapiens united states of america adult human late adulthood stage 2020-02-17v4No1 / 20
592amnondominant digestive system, united states of america, commonwealth of pennsylvania, tenebrio molitor, mealworm, pet store2020-02-18v1No1 / 20
592amnoncommon digestive system, united states of america, state of florida, carcharhinus plumbeus, snadbar shark2020-02-18v1No1 / 20
614amnonincreases in picher plant fluid grown in lab ( high in research facility late time points days 57-60 compared to early time points wild days 0-3 in united states of america commonwealth of massachusetts plant fluid harvard forest sarracenia purpurea pitcher plant pitcher fluid )2020-04-26v4No1 / 20
619amnondominant feces, united states of america, research facility, mus musculus, mouse, cystic fibrosis, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 20
650amnondominant feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 20
671amnondominant feces, united states of america, research facility, macaca mulatta, age 1 month, monkey, captive, rhesus macaque2020-09-27v4No1 / 20
722amnondominant united states of america, estuary, surface water, sea water, state of new york, new york city2021-01-02v4No1 / 20
759amnondominant feces, united states of america, state of minnesota, canis lupus, wolf, wildlife sactuary2021-04-04v4No1 / 20
803amnondominant feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v4No1 / 20
826amnondominant united states of america, research facility, dentition, canis lupus familiaris, state of illinois, beagle dog, subgingival plaque, dog, female organism, adult organism, subgingival dental plaque, age 4 years2021-08-22v4No1 / 20
866amnon high in control compared to ulcerative colitis ulcerative colitis in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 20
892amnondominant homo sapiens, united states of america, infant, supragingival plaque, dental plaque, supragingival dental plaque, 1-year-old human stage2022-04-07v4No1 / 20
892amnondominant homo sapiens, united states of america, child, supragingival plaque, dental plaque, supragingival dental plaque, 4-year-old human stage2022-04-07v4No1 / 20
915amnondominant united states of america, state of washington, snow, glacier peak wilderness, depth (snow) 0-5cm2022-07-02v4No1 / 20
922amnondominant homo sapiens, united states of america, dentition, infant, supragingival plaque, supragingival dental plaque, 1-year-old human stage, no dental caries2022-07-25v4No1 / 20
922amnondominant homo sapiens, united states of america, dentition, child, supragingival plaque, supragingival dental plaque, 4-year-old human stage, no dental caries2022-07-25v4No1 / 20
47amnonsmj: higher in bullied, non-immunized mouse ( high in stress: chronic subordinate colony housing compared to no stress: single housed control in feces united states of america research facility mus musculus male no immunization: vehicle as control c57bc/6ncrl )2017-01-13v4No1 / 21
69amnondominant united states of america, research facility, oropharynx, canis lupus familiaris, beagle dog2017-02-21v4No1 / 21
72amnondominant feces, united states of america, canis lupus familiaris, iowa2017-02-25v4No1 / 21
108amnondominant united states of america, research facility, caecum, mus musculus, state of texas, mouse2017-04-07v4No1 / 21
108amnondominant united states of america, research facility, caecum, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 21
109amnondominant united states of america, water, drinking water, site e2017-04-08v4No1 / 21
124amnondominant feces, united states of america, caecum, mus musculus, c57bl/6j, mouse2017-04-14v4No1 / 21
162amnonhigh freq. in supragingival plaque in humans (dominant homo sapiens, united states of america, dentition, san diego, supragingival plaque, mouth)2017-07-13v4No1 / 21
224amnondominant united states of america, glacier, snow field, stratovolcano, sediment, state of oregon2017-10-26v4No1 / 21
249amnondominant feces, homo sapiens, united states of america2017-11-22v4No1 / 21
270amnondominant united states of america, ocean, marine water body, saline water, pacific ocean, state of florida, depth (water) 20m2018-01-09v4No1 / 21
278amnondominant homo sapiens, united states of america, adult, state of california, subgingival plaque2018-01-23v4No1 / 21
304amnondominant united states of america, beach, water, sea water, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 21
393amnondominant feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 21
399amnondominant feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 21
409amnondominant feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 21
458amnonhigh freq. in mice strains from harlan sprague dawley (dominant feces, united states of america, female, research facility, mus musculus, mouse, harlan sprague dawley)2019-01-11v4No1 / 21
460amnoncommon in outdoor air (common united states of america, air, state of california, outdoor)2019-01-12v4No1 / 21
483amnondominant united states of america, research facility, larval stage, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 21
511amnon high in kingdom of norway sweden finland lapland compared to united states of america state of colorado in depth 0-5cm snow 2019-03-20v4No1 / 21
536amnondominant united states of america, skin, snake, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 21
591amnondominant feces, homo sapiens, united states of america, adult, parkinson's disease, human late adulthood stage2020-02-17v4No1 / 21
614amnondominant united states of america, commonwealth of massachusetts, plant fluid, harvard forest, sarracenia purpurea, pitcher plant, pitcher fluid2020-04-26v4No1 / 21
626amnondominant feces, united states of america, commonwealth of massachusetts, bird, captive, buteo jamaicensis, red-tailed hawk2020-05-16v1No1 / 21
658amnon high in hispanic or latin american hispanic compared to caucasian european in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 21
658amnondominant homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, hispanic or latin american, hispanic, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 21
671amnondominant feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 21
718amnondominant united states of america, state of wisconsin, epilimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "north sparkling bog" lake2028-05-23v4No1 / 21
759amnondominant feces, united states of america, farm, sus scrofa, pig, state of vermont2021-04-04v4No1 / 21
759amnondominant feces, united states of america, research facility, rattus norvegicus, commonwealth of massachusetts, rat, city of boston2021-04-06v4No1 / 21
806amnondominant homo sapiens, united states of america, saliva, adult, state of new york2021-06-19v3No1 / 21
893amnondominant united states of america, research facility, fertilized soil, rhizosphere, commonwealth of virginia, radish, greenhouse, raphanus sativus, sandy loam2022-04-11v4No1 / 21
915amnondominant united states of america, state of wyoming, state of colorado, snow, medicine bow - routt national forest, arapaho national forest, depth (snow) 0-5cm2022-07-02v4No1 / 21
69amnondominant feces, united states of america, research facility, canis lupus familiaris, beagle dog2017-02-21v4No1 / 22
74amnoncommon united states of america, rind, foodon product type2017-02-27v4No1 / 22
158amnoncommon united states of america, external acoustic meatus, felis catus, cat, ear canal2017-07-06v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (dominant feces, homo sapiens, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
191amnonhigher in preterm birth vaginal samples ( high in premature birth compared to control in homo sapiens united states of america female pregnancy vagina )2017-09-05v4No1 / 22
278amnon high in periodontitis compared to control in homo sapiens united states of america saliva adult state of california 2018-01-23v4No1 / 22
293amnondominant feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 22
297amnon high in crohn's disease ulcerative colitis compared to control in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v4No1 / 22
297amnondominant feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 22
311amnoncommon united states of america, state of rhode island, food (fermented), miso food product2018-04-09v4No1 / 22
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 8 hours2018-11-04v4No1 / 22
395amnondominant feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 22
399amnoncommon feces, united states of america, state of tennessee, zoological garden, ailurus fulgens, red panda2018-11-16v4No1 / 22
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex spinicola2018-11-22v4No1 / 22
502amnondominant feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 22
619amnon high in control compared to cystic fibrosis cftr s489x in feces united states of america research facility mus musculus mouse seattle colonized germ free 2020-05-04v3No1 / 22
619amnondominant feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 22
625amnondominant feces, united states of america, zoological garden, state of minnesota, ateles geoffroyi, como zoo, black-handed spider monkey2020-05-16v4No1 / 22
650amnondominant feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 22
658amnondominant homo sapiens, united states of america, dentition, african american, child, state of nebraska, supragingival plaque, supragingival dental plaque, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 22
689amnondominant feces, homo sapiens, united states of america, hospital, clostridium difficile colitis, adult, clostridium difficile infection, tucson2028-03-11v4No1 / 22
718amnondominant united states of america, state of wisconsin, epilimnion, polymictic lake, bog lake, freshwater lake, ph 4-4.5, "crystal bog" lake2028-05-23v4No1 / 22
718amnondominant united states of america, state of wisconsin, hypolimnion, polymictic lake, bog lake, freshwater lake, "forestry bog" lake, ph 4.5-52028-05-23v4No1 / 22
731amnondominant in orophringeal otic secretion drainage (dominant homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v4No1 / 22
759amnondominant feces, united states of america, canis lupus familiaris, state of minnesota, dog, domestic2021-04-04v4No1 / 22
806amnoncommon homo sapiens, united states of america, adult, state of new york, gingiva, keratinized gingiva2021-06-19v3No1 / 22
61amnondominant united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 23
74amnoncommon united states of america, capsicum annuum, foodon product type2017-02-27v4No1 / 23
74amnoncommon united states of america, prosciutto, foodon product type2017-02-27v4No1 / 23
79amnoncommon united states of america, skin, balaenoptera acutorostrata, minke whale2017-03-03v4No1 / 23
109amnondominant united states of america, water, drinking water, site b2017-04-08v4No1 / 23
132amnondominant feces, homo sapiens, united states of america2017-04-16v4No1 / 23
198amnondominant united states of america, geothermal field, sediment, thermophilic sediment, yellowstone national park, high temperature environment2017-09-13v4No1 / 23
242amnonhigher in native-americans compared to non native-american ( high in cheyenne native american arapaho compared to american in feces homo sapiens united states of america state of oklahoma )2017-11-14v4No1 / 23
308amnoncommon in spacecraft assembly cleanroom floor (common united states of america, dust, state of california, floor, cleanroom)2018-03-31v4No1 / 23
344amnonhigh freq. in feces of heterosexuals (dominant feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 23
383amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, mouse, mouse chow, f1515 diet2018-10-22v4No1 / 23
394amnondominant feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 23
399amnondominant feces, united states of america, state of tennessee, zoological garden, panthera leo, lion2018-11-16v4No1 / 23
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex simplex2018-11-22v4No1 / 23
432amnondominant united states of america, stem, state of north carolina, plant, tsuga canadensis, eastern hemlock2018-12-19v4No1 / 23
432amnondominant united states of america, stem, state of north carolina, plant, tsuga sieboldii, southern japanese hemlock2018-12-19v4No1 / 23
435amnonlower in mice at end of experiment compared to initial sample ( high in age 4 weeks compared to age 9 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 23
487amnondominant feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 23
542amnon high in child age 1-7 years compared to adult age 12-23 years in research facility dentition macaca mulatta puerto rico subgingival plaque monkey 2019-08-01v4No1 / 23
558amnondominant united states of america, gizzard, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 23
623amnondominant homo sapiens, united states of america, skin, adult, commonwealth of pennsylvania, skin of body, umbilicus2020-05-10v3No1 / 23
626amnondominant feces, united states of america, commonwealth of massachusetts, bird, captive, strix varia, barred owl2020-05-16v1No1 / 23
636amnondominant homo sapiens, united states of america, hospital, adult, commonwealth of pennsylvania, tracheal aspirate, acute respiratory failure, respiratory failure, trachea, endotracheal aspirate2020-08-08v4No1 / 23
636amnondominant homo sapiens, united states of america, hospital, oropharynx, adult, commonwealth of pennsylvania, acute respiratory failure, respiratory failure, oropharyngeal swab2020-08-08v4No1 / 23
658amnondominant homo sapiens, united states of america, dentition, caucasian, child, state of nebraska, supragingival plaque, supragingival dental plaque, european, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 23
702amnondominant feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-02v4No1 / 23
718amnondominant united states of america, state of wisconsin, meromictic lake, epilimnion, bog lake, freshwater lake, "hells kitchen" lake2028-05-23v4No1 / 23
841amnondominant feces, homo sapiens, united states of america, adult, state of texas, human adult stage2021-11-08v4No1 / 23
892amnondominant homo sapiens, united states of america, child, supragingival plaque, dental plaque, supragingival dental plaque, 2-year-old human stage2022-04-07v4No1 / 23
922amnondominant homo sapiens, united states of america, dentition, child, supragingival plaque, supragingival dental plaque, 2-year-old human stage, no dental caries2022-07-25v4No1 / 23
47amnonsmj: higher in mice immunized with M. vaccae ( high in vaccination immunization heat killed mycobacterium vaccae compared to vehicle bbs in feces united states of america research facility mus musculus male c57bc/6ncrl )2017-01-13v4No1 / 24
150amnondominant feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 24
239amnondominant feces, homo sapiens, united states of america2017-11-08v4No1 / 24
260amnondominant homo sapiens, united states of america, dentition, state of nebraska, subgingival plaque, mouth2017-12-05v4No1 / 24
322amnondominant digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2018-04-23v4No1 / 24
354amnon high in sputum induced sputum compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 24
371amnonhigher in saliva of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens saliva )2018-09-06v4No1 / 24
395amnondominant feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 24
447amnondominant united states of america, research facility, caecum, mus musculus, c57bl/6, state of maryland, mouse, charles river laboratories2019-01-08v4No1 / 24
447amnondominant united states of america, research facility, caecum, mus musculus, fasting, c57bl/6, state of maryland, mouse, charles river laboratories, every other day fasting2019-01-08v4No1 / 24
459amnonhigh freq. in middle, bottom in aquaculture biofilter sand (dominant united states of america, fish farm, water, fresh water, sand, biofilter, state of wisconsin, middle, bottom)2019-01-12v4No1 / 24
469amnoncommon homo sapiens, united states of america, lung, bronchoalveolar lavage, adult, state of new york, idiopathic pulmonary fibrosis2019-01-14v4No1 / 24
471amnondominant digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2019-01-14v4No1 / 24
511amnon high in united states of america state of colorado compared to kingdom of norway sweden finland lapland in depth 0-5cm snow 2019-03-20v4No1 / 24
641amnoncommon feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
641amnondominant feces, united states of america, research facility, juvenile organism, state of georgia, green turtle, chelonia mydas, juvenile2020-08-23v3No1 / 24
683amnondominant feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 24
702amnondominant feces, united states of america, felis catus, state of north carolina, cat2028-04-02v4No1 / 24
718amnondominant united states of america, state of wisconsin, epilimnion, polymictic lake, bog lake, freshwater lake, "forestry bog" lake, ph 4.5-52028-05-23v4No1 / 24
745amnondominant feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 24
745amnon high in human late adulthood stage compared to 25-44 year-old human stage in feces homo sapiens united states of america adult midwest region 2021-02-25v3No1 / 24
826amnondominant united states of america, research facility, dentition, canis lupus familiaris, state of illinois, beagle dog, dog, supragingival plaque, female organism, adult organism, supragingival dental plaque, age 4 years2021-08-22v4No1 / 24
13amnon high in stomach esophagus duodenum ileum mouth compared to feces rectum caecum colon in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 25
59amnon high in united states of america austin compared to australia malaysia seoul china in digestive system apis mellifera 2017-02-02v4No1 / 25
108amnondominant united states of america, research facility, colon, mus musculus, state of texas, mouse2017-04-07v4No1 / 25
158amnoncommon united states of america, pair of nares, felis catus, cat2017-07-06v4No1 / 25
323amnonhigher in teeth compared to skin and gills in sharks ( high in dentition compared to gill skin in united states of america atlantic ocean state of florida south florida shark )2018-04-24v4No1 / 25
395amnoncommon feces, homo sapiens, united states of america, child, commonwealth of pennsylvania, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-14v4No1 / 25
436amnondominant feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 25
446amnonlower in zebrafish larvae exposed to subclinical concentration of streptomycin compared to controls ( high in control compared to antibiotic streptomycin in united states of america research facility danio rerio fish zebrafish larvae age 15d )2019-01-08v4No1 / 25
460amnonlower in occupied indoor air compared to outdoor air ( high in outdoor compared to indoor office in united states of america air state of california )2019-01-12v4No1 / 25
544amnoncommon united states of america, commonwealth of massachusetts, flower, vaccinium macrocarpon, american cranberry2019-08-04v4No1 / 25
619amnon high in cystic fibrosis cftr s489x compared to control in feces united states of america research facility mus musculus mouse seattle colonized germ free 2020-05-04v3No1 / 25
683amnoncommon during antibiotics treatment in feces (common feces, homo sapiens, united states of america, antibiotic, vancomycin, adult, state of california, metronidazole, neomycin)2028-03-04v4No1 / 25
718amnondominant united states of america, state of wisconsin, hypolimnion, polymictic lake, bog lake, freshwater lake, ph 4-4.5, "crystal bog" lake2028-05-23v4No1 / 25
718amnondominant united states of america, state of wisconsin, epilimnion, polymictic lake, bog lake, freshwater lake, ph 5-5.5, "west sparkling bog" lake2028-05-23v4No1 / 25
718amnondominant united states of america, state of wisconsin, hypolimnion, polymictic lake, bog lake, freshwater lake, ph 5-5.5, "west sparkling bog" lake2028-05-23v4No1 / 25
770amnondominant oral cavity, mouth mucosa, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 25
46amnonsmj: lower in control mice feces than treated with antibiotics ( high in control compared to antibiotic sub-therapeutic antibiotic treatment, penicillin v potassium salt in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 26
62amnondominant feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 26
74amnoncommon united states of america, rind, caerphilly cheese, foodon product type, cheese food product2017-02-27v4No1 / 26
101amnon high in rhizosphere compared to soil in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 26
114amnondominant united states of america, research facility, intestine, tadpole, state of wisconsin, digesta, rana pipiens, northern leopard frog2017-04-10v4No1 / 26
146amnoncommon united states of america, flower structure, solanum lycopersicum, tomato, blossom2017-04-20v4No1 / 26
157amnonlow in nares of calves fed alfalfa not fortified with selenium compared to slenium fortified alfalfa ( high in selenium compared to control low selenium in united states of america nasal cavity pair of nares juvenile organism bos taurus calve )2017-07-04v4No1 / 26
158amnonhigher in skin sites compared to mouth in cats ( high in skin compared to saliva mouth in united states of america felis catus cat )2017-07-06v4No1 / 26
212amnon high in lean body mass compared to obese body mass index status db/db mouse obesity in feces united states of america research facility mus musculus mouse 2017-10-22v4No1 / 26
301amnondominant united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 26
311amnoncommon united states of america, allium cepa, state of rhode island, onion, foodon product type2018-04-09v4No1 / 26
354amnoncommon homo sapiens, united states of america, nasal cavity, pair of nares, adult, nasal brush2018-07-30v4No1 / 26
410amnonlower in biopsies of severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens united states of america rectum biopsy site child biopsy )2018-11-22v4No1 / 26
536amnoncommon united states of america, skin, snake, southern united states, diadophis punctatus, ringneck snake, fossorial snake2019-07-28v4No1 / 26
558amnondominant united states of america, caecum, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 26
614amnoncommon united states of america, commonwealth of massachusetts, plant fluid, harvard forest, sarracenia purpurea, pitcher plant, pitcher fluid2020-04-26v4No1 / 26
650amnonpositively correlated with BMI ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america adult state of new york )2020-09-09v4No1 / 26
689amnondominant feces, homo sapiens, united states of america, hospital, adult, non c. diff diarrhea, tucson2028-03-11v4No1 / 26
802amnondominant feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 26
826amnondominant united states of america, research facility, saliva, canis lupus familiaris, state of illinois, beagle dog, dog, female organism, adult organism, age 4 years2021-08-22v4No1 / 26
74amnoncommon united states of america, squash, foodon product type2017-02-27v4No1 / 27
150amnonhigh in EPI dogs with enzyme supplement compared to no supplement ( high in enzyme supplement compared to no enzyme supplement in feces united states of america canis lupus familiaris dog exocrine pancreatic insufficiency )2017-04-26v4No1 / 27
158amnoncommon united states of america, inguinal region, felis catus, cat, groin2017-07-06v4No1 / 27
228amnoncommon in sinus brush of sinusitis patients (common homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space, sinusitis)2017-10-31v4No1 / 27
399amnondominant feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 27
399amnon high in crohn's disease compared to control in feces homo sapiens united states of america 2018-11-16v4No1 / 27
540amnondominant feces, united states of america, canis lupus familiaris, state of arizona, flagstaff, dog2019-07-31v4No1 / 27
838amnondominant united states of america, research facility, caecum, state of ohio, meleagris gallopavo, wild turkey2021-10-13v4No1 / 27
46amnonsmj: higher in mice feces treated with antibiotics ( high in antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate compared to control in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 28
47amnonsmj: lower in bullied immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in feces united states of america research facility mus musculus male immunization immunization mycobacterium vaccae c57bc/6ncrl )2017-01-13v4No1 / 28
127amnondominant united states of america, caecum, gallus gallus, chicken, age 14-28 days2017-04-14v4No1 / 28
270amnondominant united states of america, pacific ocean, state of florida, caribbean brown tube sponge, agelas tubulata2018-01-09v4No1 / 28
319amnondominant feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 28
399amnondominant feces, united states of america, state of tennessee, zoological garden, loxodonta africana, african elephant2018-11-16v4No1 / 28
462amnoncommon united states of america, state of tennessee, leaf, populus, tree, cultivated environment2019-01-13v4No1 / 28
540amnoncommon feces, united states of america, canis lupus familiaris, state of arizona, flagstaff, dog2019-07-31v4No1 / 28
651amnon high in female compared to male in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 28
710amnonsuspected contaminant (common in blanks) (contamination)2028-05-20v4No1 / 28
806amnon high in gingiva keratinized gingiva compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 28
817amnoncommon united states of america, research facility, lung, bronchoalveolar lavage, commonwealth of pennsylvania, captive, macaca fascicularis, cynomolgus macaque2021-07-08v4No1 / 28
841amnon high in iga positive fraction compared to iga negative fraction in homo sapiens united states of america saliva adult state of texas human adult stage 2021-11-08v4No1 / 28
26amnoncommon in combined swab of inguinal region and axilla (common homo sapiens, united states of america, sebum, axilla, inguinal region)2016-12-05v4No1 / 29
108amnondecreases during fasting in mouse caecum ( high in early timepoints compared to fasting late timepoints in united states of america research facility caecum mus musculus state of texas mouse )2017-04-07v4No1 / 29
193amnonlower in nares of people working in dairy farms ( high in control compared to farm bos taurus in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 29
231amnonhigh freq. in dog rectum (dominant feces, united states of america, rectum, canis lupus familiaris, dog)2017-11-02v4No1 / 29
293amnonlower in lean participants in human feces ( high in high bmi compared to low bmi in feces homo sapiens united states of america adult )2018-02-07v4No1 / 29
462amnoncommon united states of america, state of tennessee, stem, populus, populus deltoides, tree, cultivated environment2019-01-13v4No1 / 29
658amnon high in african american compared to asian burmese in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 29
711amnoncommon homo sapiens, united states of america, oral cavity, adult, state of colorado, mouth2028-05-21v4No1 / 29
806amnoncommon homo sapiens, united states of america, adult, state of new york, dorsum of tongue2021-06-19v3No1 / 29
817amnon high in lung bronchoalveolar lavage compared to saliva oral cavity oral wash cheek pouch in united states of america research facility commonwealth of pennsylvania captive macaca fascicularis cynomolgus macaque 2021-07-08v4No1 / 29
885amnondominant feces, united states of america, research facility, mus musculus, state of ohio, mouse, c57bl/6 t1r2-ko2022-03-26v3No1 / 29
892amnoncommon homo sapiens, united states of america, infant, supragingival plaque, dental plaque, supragingival dental plaque, 1-year-old human stage2022-04-07v4No1 / 29
922amnoncommon homo sapiens, united states of america, dentition, infant, supragingival plaque, supragingival dental plaque, 1-year-old human stage, no dental caries2022-07-25v4No1 / 29
79amnoncommon united states of america, skin, physeter catodon2017-03-03v4No1 / 30
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site b 2017-04-08v4No1 / 30
211amnon high in female compared to male in feces united states of america research facility mus musculus diet high fat diet mouse 2017-10-22v4No1 / 30
435amnoncommon feces, united states of america, female, research facility, mus musculus, c57bl/6, state of oregon, mouse, age 9 weeks2018-12-23v4No1 / 30
573amnoncommon feces, united states of america, juvenile stage, canis lupus familiaris, commonwealth of pennsylvania, dog2019-12-22v4No1 / 30
582amnoncommon united states of america, external acoustic meatus, ear canal, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 30
591amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult human late adulthood stage 2020-02-17v4No1 / 30
600sheryodecearses after 12 days of biochar ammendment in soil ( high in day 1 compared to day 12 in united states of america soil state of new york ph 6 biochar coarse-loamy soil depth (soil) 0-5cm )2020-03-27v4No1 / 30
658amnon high in caucasian european compared to asian burmese in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 30
876amnoncommon feces, united states of america, research facility, macaca mulatta, state of washington, age 1 week, monkey, neonate2022-03-06v4No1 / 30
79amnoncommon united states of america, skin, phocoena phocoena, harbor porpoise2017-03-03v4No1 / 31
108amnonincreases during fasting in mouse colon ( high in fasting late timepoints compared to early timepoints in united states of america research facility colon mus musculus state of texas mouse )2017-04-07v4No1 / 31
109amnoncommon united states of america, water, drinking water, site b2017-04-08v4No1 / 31
189amnonhigherin stems of grape vines with pierce disease compared to control ( high in xylella fastidiosa temecula1 pierce disease compared to control in united states of america stem vitis vinifera state of california grape endosphere )2017-08-30v4No1 / 31
191amnoncommon homo sapiens, united states of america, female, pregnancy, vagina2017-09-05v4No1 / 31
233amnon high in age age < 3 months compared to age > 3 months infant stage in feces homo sapiens united states of america infant 2017-11-05v4No1 / 31
305amnoncommon in low volume algae production photobioreactor (common united states of america, water, bioreactor, state of colorado, algae production system)2018-03-12v4No1 / 31
383amnonhigher in feces of ketogenic diet fed mice compared to normal mouse chow ( high in ketogenic diet f3666 diet compared to mouse chow f1515 diet in feces united states of america research facility mus musculus c57bl/6 mouse )2018-10-22v4No1 / 31
401amnonhigher in endospore enriched (lysis resistant) replicates ( high in endospore enriched fraction lysis compared to control in feces homo sapiens united states of america adult )2018-11-18v4No1 / 31
436amnonlower in cats with chronic kidney disease compared to healthy controls ( high in control compared to chronic kidney disease in feces united states of america felis catus state of colorado cat )2018-12-25v4No1 / 31
446amnoncommon united states of america, research facility, danio rerio, fish, zebrafish, larvae, age 15d2019-01-08v4No1 / 31
458amnonnegatively correlated with age ( high in age 3 weeks compared to age age 24 weeks in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 31
544amnoncommon united states of america, commonwealth of massachusetts, vaccinium macrocarpon, american cranberry, botanical fruit food product2019-08-04v4No1 / 31
651amnon high in male compared to female in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 31
806amnoncommon homo sapiens, united states of america, adult, state of new york, hard palate2021-06-19v3No1 / 31
26amnoncommon united states of america, mucus, pair of nares, canis lupus familiaris2016-12-05v4No1 / 32
101amnoncommon united states of america, leaf, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 32
63amnon high in diet animal product diet compared to plant based diet in feces homo sapiens united states of america 2017-04-12v4No1 / 32
354amnon high in sputum induced sputum compared to bronchus bronchial epithelium bronchial brush in homo sapiens united states of america adult 2018-07-30v4No1 / 32
490amnonobserved in amniotic fluid and buffer and water controls (contamination)2019-02-25v4No1 / 32
745amnon high in 25-44 year-old human stage compared to human late adulthood stage in feces homo sapiens united states of america adult midwest region 2021-02-25v3No1 / 32
806amnon high in pair of nares external naris compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 32
885amnondominant feces, united states of america, research facility, mus musculus, c57bl/6, state of ohio, mouse2022-03-26v3No1 / 32
108amnonincreases during fasting in quail caecum ( high in fasting late timepoints compared to early timepoints in united states of america research facility caecum state of texas quail coturnix coturnix )2017-04-07v4No1 / 33
354amnon high in saliva oral wash compared to bronchus bronchial epithelium bronchial brush in homo sapiens united states of america adult 2018-07-30v4No1 / 33
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in research facility dentition adult macaca mulatta puerto rico subgingival plaque monkey age 12-23 years )2019-08-01v4No1 / 33
646amnoncommon homo sapiens, sputum, united states of america, cystic fibrosis, adult, mild disease course, state of new hampshire2020-09-06v4No1 / 33
892amnoncommon homo sapiens, united states of america, saliva, infant, 1-year-old human stage2022-04-07v4No1 / 33
922amnoncommon homo sapiens, united states of america, saliva, infant, 1-year-old human stage, no dental caries2022-07-25v4No1 / 33
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 34
79amnoncommon united states of america, skin, stenella longirostris, spinner dolphin2017-03-03v4No1 / 34
127amnonhigher in vaccinated chickens ( high in vaccination salmune vaccination compared to control in united states of america caecum gallus gallus chicken )2017-04-14v4No1 / 34
311amnoncommon united states of america, state of rhode island, garlic, foodon product type2018-04-09v4No1 / 34
528amnon high in african american african compared to caucasian in homo sapiens united states of america female pregnancy vagina 2019-07-14v1No1 / 34
866amnon high in iga positive fraction compared to iga negative fraction in feces united states of america research facility mus musculus c57bl/6 state of illinois mouse 2022-02-08v4No1 / 34
79amnoncommon united states of america, skin, steno bredanensis, rough-toothed dolphin2017-03-03v4No1 / 35
108amnoncommon united states of america, research facility, colon, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 35
146amnoncommon united states of america, solanum lycopersicum, tomato, botanical fruit food product2017-04-20v4No1 / 35
536amnoncommon united states of america, skin, snake, southern united states, fossorial snake, carphophis amoenus, worm snake2019-07-28v4No1 / 35
759amnon high in dog food diet compared to raw meat diet in feces united states of america canis lupus familiaris state of minnesota dog 2021-04-06v4No1 / 35
51amnoncommon homo sapiens, united states of america, biopsy site, biopsy2017-01-19v4No1 / 36
79amnondominant united states of america, skin, delphinus delphis2017-03-03v4No1 / 36
196amnonhigher in heated tap water 60C compared to 40C ( high in temp 60c high temperature environment compared to control temp 40c in united states of america water drinking water )2017-09-12v4No1 / 36
212amnon high in obese body mass index status db/db mouse obesity compared to lean body mass in feces united states of america research facility mus musculus mouse 2017-10-22v4No1 / 36
228amnoncommon in sinus brush of healthy participants (common homo sapiens, united states of america, mucosa, paranasal sinus, sinusoidal space)2017-10-31v4No1 / 36
231amnonhigher in urine compared to genitalia in dogs ( high in urine compared to reproductive system reproductive organ genitalia in united states of america canis lupus familiaris dog )2017-11-02v4No1 / 36
311amnoncommon united states of america, state of rhode island, radish, foodon product type2018-04-09v4No1 / 36
399amnon high in ulcerative colitis compared to control in feces homo sapiens united states of america 2018-11-16v4No1 / 36
468amnoncommon in trachea of children with respiratory technology dependence (common homo sapiens, united states of america, trachea, child, tracheal aspirate, respiratory technology dependent)2019-01-14v4No1 / 36
51amnonhigher in stool compared to biopsies ( high in feces compared to biopsy site biopsy in homo sapiens united states of america )2017-01-19v4No1 / 37
102amnonlower in teeth compared to cheeks, saliva ( high in saliva cheek compared to dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 37
158amnoncommon united states of america, axilla, felis catus, cat2017-07-06v4No1 / 37
188amnondisappears in mice after dss treatment ( high in control compared to dextran sulfate sodium dss in feces united states of america research facility mus musculus mouse cba/j mice )2017-08-24v4No1 / 37
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens united states of america female pregnancy vagina )2017-09-05v4No1 / 37
233amnon high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens united states of america infant 2017-11-05v4No1 / 37
651amnon high in parkinson's disease compared to control in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 37
706amnoncommon feces, united states of america, canis lupus familiaris, state of north carolina, dog2028-04-10v4No1 / 37
711amnoncommon homo sapiens, united states of america, oral cavity, child, state of colorado, mouth, age 8-12 years2028-05-21v4No1 / 37
243amnoncommon digestive system, united states of america, beetle, anoplophora glabripennis2017-11-15v4No1 / 38
297amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v4No1 / 38
409amnonhigher in colon biopsies compared to stool and luminal content ( high in biopsy site biopsy compared to feces luminal content in homo sapiens united states of america )2018-11-22v4No1 / 38
528amnon high in caucasian compared to african american african in homo sapiens united states of america female pregnancy vagina 2019-07-14v1No1 / 38
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 3-month-old human stage 2020-09-27v4No1 / 38
806amnoncommon homo sapiens, united states of america, pair of nares, adult, state of new york, external naris2021-06-19v3No1 / 38
866amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 38
51amnon high in hiv infection compared to control in feces homo sapiens united states of america 2017-01-19v4No1 / 39
74amnonHigher in plant diet compared to animal product diet ( high in diet plant diet compared to animal product diet in feces homo sapiens united states of america )2017-02-27v4No1 / 39
74amnoncommon united states of america, spices, foodon product type, spice or herb2017-02-27v4No1 / 39
102amnonlower in saliva compared to teeth, cheek ( high in cheek dentition compared to saliva in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 39
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 39
427amnonhigher in salamanders kept at 20C compared to 10C ( high in temp 20c compared to temp 10c in feces united states of america commonwealth of virginia salamander eastern red backed salamander plethodon cinereus )2018-12-08v4No1 / 39
19amnoncommon in biopsies of children (IBD study) (common homo sapiens, united states of america, rectum, caecum, colon, sigmoid colon, terminal ileum, biopsy, children)2016-11-14v4No1 / 40
79amnoncommon united states of america, skin, peponocephala electra2017-03-03v4No1 / 40
79amnoncommon united states of america, skin, lagenorhynchus acutus2017-03-03v4No1 / 40
79amnoncommon united states of america, skin, stenella attenuata2017-03-03v4No1 / 40
113amnoncommon united states of america, research facility, intestine, adult, danio rerio, zebra fish2017-04-10v4No1 / 40
212amnonlower in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet ain-93g rodent diet compared to quinoa food product in feces united states of america research facility mus musculus obese body mass index status mouse db/db mouse obesity )2017-10-22v4No1 / 40
806amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of new york, buccal mucosa2021-06-19v3No1 / 40
866amnon high in control compared to irritable bowel syndrome irritable bowel syndrome in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 40
892amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 40
51amnoncommon feces, homo sapiens, united states of america2017-01-19v4No1 / 41
102amnonhigher in cheeks compared to teeth, saliva ( high in cheek compared to saliva dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 41
109amnon high in distribution system compared to water treatment plant in united states of america water drinking water site a 2017-04-08v4No1 / 41
117amnoncommon united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 41
305amnoncommon in medium volume algae production photobioreactor (common united states of america, water, bioreactor, state of colorado, algae production system)2018-03-12v4No1 / 41
389amnoncommon united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 41
400amnonhigher in children of hmong migrands born in the usa compared to non-migrant usa people ( high in hmong hmong 2nd generation compared to united states of america in feces homo sapiens )2018-11-18v4No1 / 41
401amnonlower in endospore enriched (lysis resistant) replicates ( high in control compared to endospore enriched fraction lysis in feces homo sapiens united states of america adult )2018-11-18v4No1 / 41
542amnoncommon research facility, dentition, macaca mulatta, child, puerto rico, subgingival plaque, monkey, age 1-7 years2019-08-01v4No1 / 41
647amnoncommon united states of america, lake, water, state of montana, freshwater lake2020-09-06v4No1 / 41
731amnonlower in oropharingeal otic fluid drainage compared to buccal mucosa ( high in mouth mucosa buccal mucosa compared to oropharynx in homo sapiens united states of america adult state of michigan )2021-01-09v4No1 / 41
806amnoncommon homo sapiens, united states of america, dentition, adult, state of new york, supragingival plaque, supragingival dental plaque2021-06-19v3No1 / 41
922amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in homo sapiens united states of america dentition supragingival plaque supragingival dental plaque no dental caries 2022-07-25v4No1 / 41
922amnon high in infant 1-year-old human stage compared to child 4-year-old human stage in homo sapiens united states of america saliva no dental caries 2022-07-25v4No1 / 41
14amnon high in stomach duodenum jejunum ileum compared to feces caecum transverse colon left colon right colon in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 42
79amnoncommon united states of america, skin, globicephala macrorhynchus, short finned pilot whale2017-03-03v4No1 / 42
158amnoncommon united states of america, interdigital region, felis catus, cat2017-07-06v4No1 / 42
383amnonlower in feces of ketogenic diet fed mice compared to normal mouse chow ( high in mouse chow f1515 diet compared to ketogenic diet f3666 diet in feces united states of america research facility mus musculus c57bl/6 mouse )2018-10-22v4No1 / 42
409amnonlower in colon biopsies compared to stool and luminal content ( high in feces luminal content compared to biopsy site biopsy in homo sapiens united states of america )2018-11-22v4No1 / 42
614amnondecreases in picher plant fluid grown in lab ( high in early time points wild days 0-3 compared to research facility late time points days 57-60 in united states of america commonwealth of massachusetts plant fluid harvard forest sarracenia purpurea pitcher plant pitcher fluid )2020-04-26v4No1 / 42
644amnonnegatively correalted with bmi ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 42
922amnoncommon homo sapiens, united states of america, dentition, child, supragingival plaque, supragingival dental plaque, 4-year-old human stage, no dental caries2022-07-25v4No1 / 42
108amnoncommon united states of america, research facility, colon, oreochromis niloticus, state of texas, nile tilapia2017-04-07v4No1 / 43
189amnoncommon united states of america, stem, vitis vinifera, state of california, grape, endosphere2017-08-30v4No1 / 43
231amnoncommon in dog genitalia (common united states of america, reproductive system, reproductive organ, canis lupus familiaris, dog, genitalia)2017-11-02v4No1 / 43
389amnoncommon united states of america, farm, vagina, sus scrofa, state of michigan, pig2018-11-04v4No1 / 43
876amnon high in age 1 week neonate compared to juvenile organism age 20 months in feces united states of america research facility macaca mulatta state of washington monkey 2022-03-06v4No1 / 43
892amnoncommon homo sapiens, united states of america, child, supragingival plaque, dental plaque, supragingival dental plaque, 4-year-old human stage2022-04-07v4No1 / 43
69amnoncommon united states of america, research facility, bronchoalveolar lavage, canis lupus familiaris, beagle dog2017-02-21v4No1 / 44
321amnonhigher in mice treated with Metronidazole compared to untreated mice ( high in antibiotic metronidazole compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 44
406amnoncommon feces, united states of america, zoological garden, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 44
866amnon high in stress restraint stress compared to control in feces united states of america research facility mus musculus c57bl/6 state of illinois mouse 2022-02-08v4No1 / 44
108amnonincreases during fasting in southern frog colon ( high in fasting late timepoints compared to early timepoints in united states of america research facility colon state of texas anaxyrus terrestris southern toad )2017-04-07v4No1 / 45
113amnoncommon united states of america, research facility, larval stage, intestine, danio rerio, zebra fish2017-04-10v4No1 / 45
300amnon high in high capacity running strain compared to low capacity running strain in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks 2018-02-27v4No1 / 45
558amnoncommon united states of america, duodenum, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 45
912amnon high in body proper whole body mussel dreissena polymorpha zebra mussel compared to fresh water aquarium water in united states of america research facility state of minnesota fresh water aquarium 2022-05-27v4No1 / 45
109amnon high in distribution system compared to water treatment plant in united states of america water drinking water site d 2017-04-08v4No1 / 46
171amnonlow in draught soil compared to soil with rice growth irrigation protocol ( high in control flooded soil compared to drought environment in united states of america soil state of california depth 5cm )2017-07-25v4No1 / 46
211amnon high in male compared to female in feces united states of america research facility mus musculus diet high fat diet mouse 2017-10-22v4No1 / 47
301amnoncommon united states of america, duodenum, canis lupus familiaris, dog2018-03-05v4No1 / 47
399amnon high in ulcerative colitis compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 47
408amnon high in larval stage compared to stomach in united states of america costa rica ant pseudomyrmex flavicornis 2018-11-22v4No1 / 47
408amnoncommon united states of america, larval stage, costa rica, ant, pseudomyrmex viduus2018-11-22v4No1 / 47
591amnoncommon feces, homo sapiens, united states of america, adult, parkinson's disease, human late adulthood stage2020-02-17v4No1 / 47
708amnonhigher in mice with iron deficient diet ( high in iron deficient diet low iron compared to iron iron supplemented diet in feces united states of america research facility mus musculus c57bl/6 mouse state of montana )2028-05-16v4No1 / 47
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin polymictic lake bog lake freshwater lake "forestry bog" lake ph 4.5-5 2028-05-23v4No1 / 47
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site a 2017-04-08v4No1 / 48
462amnoncommon united states of america, state of tennessee, stem, populus, tree, populus trichocarpa x deltoides, cultivated environment2019-01-13v4No1 / 48
558amnon high in gizzard compared to duodenum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 48
806amnoncommon homo sapiens, united states of america, adult, state of new york, palatine tonsil2021-06-19v3No1 / 48
806amnon high in oral cavity oral wash compared to hard palate in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 48
892amnoncommon homo sapiens, united states of america, child, supragingival plaque, dental plaque, supragingival dental plaque, 2-year-old human stage2022-04-07v4No1 / 48
922amnoncommon homo sapiens, united states of america, dentition, child, supragingival plaque, supragingival dental plaque, 2-year-old human stage, no dental caries2022-07-25v4No1 / 48
79amnoncommon united states of america, skin, harbor seal, phoca vitulina2017-03-03v4No1 / 49
651amnoncommon feces, homo sapiens, united states of america, adult, state of alabama, parkinson's disease2020-09-13v4No1 / 49
710amnon high in mouse chow control diet compared to ketogenic diet in feces united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 49
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in oral cavity mouth mucosa macaca mulatta cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 49
406amnoncommon feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 50
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 50
14amnon high in feces caecum transverse colon left colon right colon compared to stomach duodenum jejunum ileum in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 51
127amnoncommon united states of america, caecum, gallus gallus, chicken, age 14-28 days2017-04-14v4No1 / 51
196amnonlower in biofilms in water at 60C compared to 40C ( high in control temp 40c compared to temp 60c high temperature environment in united states of america water biofilm drinking water biofilm )2017-09-12v4No1 / 51
368amnonlower in sle model mice treated with dexamethasone (reduced symptoms) ( high in systemic lupus erythematosus compared to dexamethasone in feces united states of america research facility mus musculus mouse nzb/w f1 )2018-09-03v4No1 / 51
462amnoncommon united states of america, state of tennessee, populus, tree, cultivated environment, root2019-01-13v4No1 / 51
589amnon high in low fat diet mouse chow compared to high fat diet + inulin in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 51
702amnoncommon feces, united states of america, felis catus, state of north carolina, cat2028-04-02v4No1 / 51
278amnon high in periodontitis compared to control in homo sapiens united states of america adult state of california subgingival plaque 2018-01-23v4No1 / 52
300amnon high in low capacity running strain compared to high capacity running strain in united states of america female research facility caecum rattus norvegicus rat ovariectomy age 38 weeks 2018-02-27v4No1 / 52
321amnonhigher in mice treated with ampicillin compared to untreated mice ( high in antibiotic ampicillin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 52
335amnoncommon in mouthwash (common homo sapiens, united states of america, oral cavity, oral wash, mouth)2018-05-16v4No1 / 52
354amnoncommon homo sapiens, united states of america, saliva, adult, oral wash2018-07-30v4No1 / 52
400amnonlower in children of hmong migrands born in the usa compared to non-migrant usa people ( high in united states of america compared to hmong hmong 2nd generation in feces homo sapiens )2018-11-18v4No1 / 52
416amnon high in fasting compared to wood diet in united states of america research facility colon termite reticulitermes flaviceps 2018-11-30v4No1 / 52
650amnoncommon feces, homo sapiens, united states of america, adult, african american, state of new york2020-09-09v4No1 / 52
651amnon high in control compared to parkinson's disease in feces homo sapiens united states of america adult state of alabama 2020-09-13v4No1 / 52
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 3-month-old human stage 2020-09-27v4No1 / 52
102amnon high in periodontitis compared to control in homo sapiens united states of america atlanta mouth 2017-04-04v4No1 / 53
162amnon high in periodontitis compared to control in homo sapiens united states of america dentition san diego subgingival plaque periodontal pocket mouth 2017-07-13v4No1 / 53
408amnon high in pseudomyrmex nigrocinctus pseudomyrmex flavicornis pseudomyrmex spinicola acacia ants compared to pseudomyrmex gracilis generalist in united states of america costa rica pseudomyrmex ant 2018-11-22v4No1 / 53
892amnon high in supragingival plaque dental plaque supragingival dental plaque compared to saliva in homo sapiens united states of america child 4-year-old human stage 2022-04-07v4No1 / 53
109amnoncommon united states of america, water, drinking water, site a2017-04-08v4No1 / 54
196amnonlower in heated tap water 60C compared to 40C ( high in control temp 40c compared to temp 60c high temperature environment in united states of america water drinking water )2017-09-12v4No1 / 54
408amnon high in pseudomyrmex gracilis generalist compared to pseudomyrmex nigrocinctus pseudomyrmex flavicornis pseudomyrmex spinicola acacia ants in united states of america costa rica pseudomyrmex ant 2018-11-22v4No1 / 54
437amnoncommon united states of america, research facility, intestine, juvenile organism, danio rerio, state of oregon, zebra fish, fish, age 21 days2018-12-26v4No1 / 54
354amnon high in bronchus bronchial epithelium bronchial brush compared to sputum induced sputum in homo sapiens united states of america adult 2018-07-30v4No1 / 55
683amnonhigher in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in antibiotic vancomycin metronidazole neomycin compared to control in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 55
745amnoncommon feces, homo sapiens, united states of america, adult, midwest region2021-02-25v3No1 / 55
368amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of virginia, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
591amnoncommon feces, homo sapiens, control, united states of america, adult, human late adulthood stage2020-02-17v4No1 / 56
648amnon high in control compared to antibiotic metronidazole in feces united states of america canis lupus familiaris dog state of louisiana 2020-09-06v4No1 / 56
650amnoncommon feces, homo sapiens, united states of america, adult, caucasian, state of new york, european2020-09-09v4No1 / 56
817amnon high in saliva oral cavity oral wash cheek pouch compared to lung bronchoalveolar lavage in united states of america research facility commonwealth of pennsylvania captive macaca fascicularis cynomolgus macaque 2021-07-08v4No1 / 56
922amnoncommon homo sapiens, united states of america, saliva, child, 4-year-old human stage, no dental caries2022-07-25v4No1 / 56
26amnon high in mucus pair of nares compared to saliva mouth in united states of america canis lupus familiaris 2016-12-05v4No1 / 57
308amnoncommon in neonatal intensive care unit floor (common united states of america, dust, hospital, state of california, floor)2018-03-31v4No1 / 57
462amnon high in root compared to rhizosphere in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 57
650amnon high in female compared to male in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 57
759amnoncommon feces, united states of america, canis lupus familiaris, state of minnesota, dog, domestic2021-04-04v4No1 / 57
806amnon high in oral cavity oral wash compared to mouth mucosa buccal mucosa in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 57
892amnoncommon homo sapiens, united states of america, saliva, child, 4-year-old human stage2022-04-07v4No1 / 57
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site e 2017-04-08v4No1 / 58
523amnoncommon united states of america, building, air, state of illinois, chicago, bedroom2019-07-03v4No1 / 58
563amnon high in control compared to hiv infection in feces homo sapiens united states of america male homosexual msm rectal swab 2019-11-18v4No1 / 58
644amnon high in male compared to female in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 58
651amnoncommon feces, homo sapiens, control, united states of america, adult, state of alabama2020-09-13v4No1 / 58
759amnoncommon feces, united states of america, state of minnesota, canis lupus, wolf, wildlife sactuary2021-04-04v4No1 / 58
806amnon high in oral cavity oral wash compared to dentition supragingival plaque supragingival dental plaque in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 58
866amnon high in iga negative fraction compared to iga positive fraction in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 58
922amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in homo sapiens united states of america child 4-year-old human stage no dental caries 2022-07-25v4No1 / 58
108amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in united states of america research facility colon mus musculus state of texas mouse )2017-04-07v4No1 / 59
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 59
260amnoncommon homo sapiens, united states of america, dentition, state of nebraska, subgingival plaque, mouth2017-12-05v4No1 / 59
416amnon high in wood diet compared to fasting in united states of america research facility colon termite reticulitermes flaviceps 2018-11-30v4No1 / 59
523amnonhigher in houses with dogs ( high in canis lupus familiaris dog compared to no dog in united states of america building air state of illinois chicago bedroom )2019-07-03v4No1 / 59
770amnoncommon oral cavity, mouth mucosa, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 59
892amnoncommon homo sapiens, united states of america, saliva, child, 2-year-old human stage2022-04-07v4No1 / 59
922amnoncommon homo sapiens, united states of america, saliva, child, 2-year-old human stage, no dental caries2022-07-25v4No1 / 59
214amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, mouse, mouse chow2017-10-23v4No1 / 60
228amnonlower in chronic sinositis compared to healthy controls in sinus brushing ( high in control compared to sinusitis in homo sapiens united states of america mucosa paranasal sinus sinusoidal space )2017-10-31v4No1 / 60
371amnonlower in saliva of amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in homo sapiens saliva )2018-09-06v4No1 / 60
399amnonhigher in ciprofloxacin treated mice compared to controls ( high in ciprofloxacin antibiotic compared to control in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 60
600sheryoincearses after 12 days of unammendment in soil ( high in day 12 compared to day 1 in united states of america soil state of new york ph 6 coarse-loamy soil depth (soil) 0-5cm )2020-03-27v4No1 / 60
199amnonlower in bathroom shower compared to kitchen sink ( high in kitchen sink compared to bathroom shower tile building wall in united states of america building urban biome )2017-10-01v4No1 / 61
293amnonlower in caloric restriction (CRON) diet compared to american diet ( high in diet american diet compared to cron diet caloric restriction diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 61
335amnoncommon homo sapiens, united states of america, bronchial epithelium2018-05-16v4No1 / 61
523amnonhigher in houses with mold ( high in mold compared to no mold in united states of america building air state of illinois chicago bedroom )2019-07-03v4No1 / 61
619amnoncommon feces, control, united states of america, research facility, mus musculus, mouse, seattle, colonized germ free2020-05-04v3No1 / 61
51amnon high in control compared to hiv infection in feces homo sapiens united states of america 2017-01-19v4No1 / 62
196amnonhigher in biofilms in water at 60C compared to 40C ( high in temp 60c high temperature environment compared to control temp 40c in united states of america water biofilm drinking water biofilm )2017-09-12v4No1 / 62
214amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, high fat diet, mouse2017-10-23v4No1 / 62
311amnonlower in fermneted kimchi days>1 compared to day 0 ( high in early timepoints day 0 compared to days 1-9 in united states of america state of rhode island kimchi food (fermented) )2018-04-09v4No1 / 62
317amnoncommon united states of america, water, surface water, sea water, state of california, pacific ocean, depth (water) 5m2018-04-15v4No1 / 62
549amnoncommon puerto rico, isla palominos, coral, acropora cervicornis2019-08-17v4No1 / 62
102amnonhigher in teeth compared to cheeks, saliva ( high in dentition compared to saliva cheek in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 63
125amnonanti-correlated with diet induced metabolic disease in germ free transplantation ( high in cast/eij compared to c57bl/6j diet induced metabolic disease in feces united states of america mus musculus mouse )2017-04-14v4No1 / 63
311amnoncommon united states of america, state of rhode island, red pepper, foodon product type2018-04-09v4No1 / 63
354amnoncommon homo sapiens, sputum, united states of america, adult, induced sputum2018-07-30v4No1 / 63
502amnoncommon feces, homo sapiens, united states of america, adult, schizophrenia2019-03-12v4No1 / 63
536amnoncommon united states of america, skin, snake, southern united states, coluber constrictor, eastern racer snake2019-07-28v4No1 / 64
558amnon high in duodenum compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 64
619amnoncommon feces, united states of america, research facility, cystic fibrosis, mus musculus, mouse, seattle, cftr s489x, colonized germ free2020-05-04v3No1 / 64
671amnon high in age 1 month compared to 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 64
102amnonhigher in saliva compared to teeth, cheek ( high in saliva compared to cheek dentition in homo sapiens united states of america atlanta mouth )2017-04-03v4No1 / 65
242amnoncommon in native-americans (common feces, homo sapiens, united states of america, state of oklahoma, cheyenne, native american, arapaho)2017-11-14v4No1 / 65
326amnon high in diet high fat diet compared to mouse chow in united states of america research facility mus musculus c57bl/6 state of washington mouse ldlr- 2018-04-29v4No1 / 65
354amnoncommon homo sapiens, united states of america, bronchus, bronchial epithelium, adult, bronchial brush2018-07-30v4No1 / 65
270amnoncommon united states of america, ocean, marine water body, saline water, pacific ocean, state of florida, depth (water) 20m2018-01-09v4No1 / 66
341amnoncommon united states of america, water, fresh water, drinking water, tap water, state of illinois2018-05-28v4No1 / 66
558amnoncommon united states of america, colon, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 66
650amnoncommon feces, homo sapiens, united states of america, adult, state of new york, asian2020-09-09v4No1 / 66
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 66
109amnoncommon united states of america, water, drinking water, site d2017-04-08v4No1 / 67
114amnon high in adult compared to tadpole in united states of america research facility intestine state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 67
162amnoncommon in periodontal pocket in humans (common homo sapiens, united states of america, dentition, san diego, subgingival plaque, periodontal pocket, mouth)2017-07-13v4No1 / 67
874amnoncommon homo sapiens, united states of america, female, state of new york, subgingival plaque, subgingival dental plaque, postmenopausal, buffalo, human late adulthood stage2022-03-04v3No1 / 67
211amnonCommon in multiple mouse strains feces (common feces, united states of america, research facility, mus musculus, high fat diet, mouse)2017-10-22v4No1 / 68
311amnoncommon united states of america, state of rhode island, fish sauce, foodon product type2018-04-09v4No1 / 68
582amnoncommon united states of america, wild, lip, labial commissure, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 68
690amnoncommon in squamous esophagos samples from patients undergoing endoscopy (common homo sapiens, united states of america, hospital, esophagus, new york city, esophageal disease, squamous esophagus)2028-03-11v4No1 / 68
770amnoncommon oral cavity, mouth mucosa, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 68
902amnoncommon feces, united states of america, colitis, antibiotic, equus caballus, horse, adult organism, colitis, antibiotics induced colitis2022-05-02v4No1 / 68
915amnoncommon united states of america, state of washington, snow, glacier peak wilderness, depth (snow) 0-5cm2022-07-02v4No1 / 68
72amnoncommon feces, united states of america, canis lupus familiaris, iowa2017-02-25v4No1 / 69
170amnonhigher in high turbidity river water ( high in high turbidity turbidity compared to low turbidity in united states of america river stream water fresh water depth (water) 10cm )2017-07-24v4No1 / 69
231amnoncommon in dog urine (common united states of america, urine, canis lupus familiaris, dog)2017-11-02v4No1 / 69
301amnoncommon united states of america, ileum, canis lupus familiaris, dog2018-03-05v4No1 / 69
558amnon high in crop compared to gizzard in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 69
644amnon high in female compared to male in feces homo sapiens united states of america adult hispanic or latin american 2020-08-31v4No1 / 69
846amnoncommon homo sapiens, united states of america, saliva, adult, commonwealth of massachusetts, human adult stage, stimulated saliva2021-11-20v3No1 / 69
22amnon high in control compared to hiv infection in feces homo sapiens united states of america 2016-11-28v4No1 / 70
47amnonsmj: lower in non-bullied, non-immunized mouse ( high in no stress: single housed control compared to stress: chronic subordinate colony housing in feces united states of america research facility mus musculus male no immunization: vehicle as control c57bc/6ncrl )2017-01-13v4No1 / 70
405amnon high in control diet compared to ketogenic diet in feces united states of america research facility mus musculus mouse swiss webster 2018-11-20v4No1 / 70
803amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of massachusetts, type 2 diabetes mellitus, caribbean latino, human late adulthood stage2021-06-18v4No1 / 70
896amnon high in starch diet compared to glucose diet in feces united states of america female research facility mus musculus c57bl/6j state of utah mouse jackson laboratories age 2 months 2022-04-17v4No1 / 70
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 4 weeks2018-11-04v4No1 / 71
394amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america adult state of california 2018-11-06v4No1 / 71
644amnoncommon feces, homo sapiens, united states of america, adult, hispanic or latin american2020-08-31v4No1 / 71
114amnoncommon united states of america, research facility, intestine, adult, state of wisconsin, digesta, rana pipiens, northern leopard frog2017-04-10v4No1 / 72
127amnonhigher in non-vaccinated chickens ( high in control compared to vaccination salmune vaccination in united states of america caecum gallus gallus chicken )2017-04-14v4No1 / 72
389amnoncommon united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 72
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in non-steroidal anti-inflammatory drug indomethacin compared to control in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 72
483amnoncommon united states of america, water, sea water, hawaii, pearl harbor, depth 1-2m2019-02-13v4No1 / 72
817amnoncommon united states of america, research facility, saliva, oral cavity, commonwealth of pennsylvania, oral wash, captive, cheek pouch, macaca fascicularis, cynomolgus macaque2021-07-07v4No1 / 72
26amnoncommon homo sapiens, united states of america, mucus, pair of nares2016-12-05v4No1 / 73
171amnonlower in rice rhizosphere soil compared to bulk soil (no rice) ( high in soil compared to rhizosphere in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 73
435amnonhigher in mice at end of experiment compared to initial sample ( high in age 9 weeks compared to age 4 weeks in feces united states of america female research facility mus musculus c57bl/6 state of oregon mouse )2018-12-23v4No1 / 73
873amnon high in tanzania rural community botswana compared to united states of america commonwealth of pennsylvania urban community in feces homo sapiens adult human adult stage 2022-03-03v1No1 / 73
22amnon high in hiv infection compared to control in feces homo sapiens united states of america 2016-11-28v4No1 / 74
99amnoncommon united states of america, mucus, skin, notophthalmus viridescens, commonwealth of virginia, newt2017-04-02v4No1 / 74
589amnon high in low fat diet mouse chow compared to high fat diet in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 74
759amnon high in raw meat diet compared to dog food diet in feces united states of america canis lupus familiaris state of minnesota dog 2021-04-06v4No1 / 74
270amnoncommon united states of america, pacific ocean, state of florida, caribbean brown tube sponge, agelas tubulata2018-01-09v4No1 / 75
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 75
589amnon high in high fat diet compared to low fat diet mouse chow in feces united states of america research facility mus musculus c57bl/6 state of georgia mouse jackson laboratories 2020-02-10v4No1 / 75
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult state of new york )2020-09-09v4No1 / 75
719amnoncommon united states of america, research facility, dentition, mus musculus, state of georgia, mouse, charles river laboratories, icr/cd-1 mice2028-05-23v4No1 / 75
74amnoncommon feces, homo sapiens, united states of america2017-02-27v4No1 / 76
108amnondecreases during fasting in quail caecum ( high in early timepoints compared to fasting late timepoints in united states of america research facility caecum state of texas quail coturnix coturnix )2017-04-07v4No1 / 76
170amnonhigher in low phosphorus river water ( high in phosphorus low phosphorus compared to high phosphorus in united states of america river stream water fresh water depth (water) 10cm )2017-07-24v4No1 / 76
322amnoncommon digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2018-04-23v4No1 / 76
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee leaf populus tree cultivated environment 2019-01-13v4No1 / 76
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 76
866amnon high in iga negative fraction compared to iga positive fraction in feces united states of america research facility mus musculus c57bl/6 state of illinois mouse 2022-02-08v4No1 / 76
54amnoncommon homo sapiens, united states of america, saliva2017-01-23v4No1 / 77
69amnoncommon united states of america, research facility, mucus, nasal cavity, canis lupus familiaris, beagle dog2017-02-21v4No1 / 77
304amnonlower in seawater compared sea spray aerosol ( high in air aerosol compared to water sea water in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 77
516amnoncommon feces, homo sapiens, united states of america, adult, state of ohio2019-05-29v4No1 / 77
556amnoncommon feces, homo sapiens, united states of america, adult2019-09-14v1No1 / 77
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 77
731amnoncommon in orophringeal otic secretion drainage (common homo sapiens, united states of america, oropharynx, adult, state of michigan)2021-01-09v4No1 / 77
786sheryoHigher at 400-700cm depth compared to 166-200cm depth in flood plain soil near cosumnes river, california ( high in depth 400-700cm compared to depth 166-200cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-13v3No1 / 77
786sheryoHigher at 60-100cm depth compared to 30-60cm depth in flood plain soil near cosumnes river, california ( high in depth 60-100cm compared to depth 30-60cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-14v3No1 / 77
589amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, state of georgia, mouse, jackson laboratories, high fat diet + inulin2020-02-10v4No1 / 78
759amnon high in canis lupus wolf wildlife sactuary compared to canis lupus familiaris dog in feces united states of america state of minnesota 2021-04-06v4No1 / 78
301amnon high in rectum colon compared to duodenum ileum in united states of america canis lupus familiaris dog 2018-03-05v4No1 / 79
399amnoncommon feces, united states of america, state of tennessee, zoological garden, panthera leo, lion2018-11-16v4No1 / 79
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 79
671amnon high in age 6 months 3-month-old human stage compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 79
26amnoncommon united states of america, mucus, pair of nares, felis catus2016-12-05v4No1 / 80
108amnon high in caecum compared to colon in united states of america research facility oreochromis niloticus state of texas nile tilapia 2017-04-07v4No1 / 80
109amnoncommon united states of america, water, drinking water, site e2017-04-08v4No1 / 80
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v4No1 / 80
483amnoncommon united states of america, research facility, adult, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 80
108amnonincreases during fasting in nile tilapia colon ( high in fasting late timepoints compared to early timepoints in united states of america research facility colon oreochromis niloticus state of texas nile tilapia )2017-04-07v4No1 / 81
109amnon high in distribution system compared to water treatment plant in united states of america water drinking water site c 2017-04-08v4No1 / 81
383amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, mouse, ketogenic diet, f3666 diet2018-10-22v4No1 / 81
671amnoncommon feces, united states of america, research facility, macaca mulatta, age 1 month, monkey, captive, rhesus macaque2020-09-27v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
650amnon high in male compared to female in feces homo sapiens united states of america adult state of new york 2020-09-10v4No1 / 82
658amnoncommon homo sapiens, united states of america, dentition, caucasian, child, state of nebraska, supragingival plaque, supragingival dental plaque, european, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 82
826amnon high in supragingival plaque supragingival dental plaque compared to subgingival plaque subgingival dental plaque in united states of america research facility dentition canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 82
261amnondiet dependent in cow rumen ( high in diet corn diet 40mdgs diet compared to 27cds diet 55cs diet in united states of america rumen bos taurus state of nebraska cow )2017-12-10v4No1 / 83
298amnonhigher in wetted soil 18hrs compared to dried soil ( high in irrigated compared to dry in united states of america desert soil state of utah depth 1cm soil crust )2018-02-20v4No1 / 83
305amnoncommon in large volume algae production photobioreactor (common united states of america, water, bioreactor, state of colorado, algae production system)2018-03-12v4No1 / 83
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
648amnoncommon feces, united states of america, canis lupus familiaris, dog, state of louisiana2020-09-06v4No1 / 83
816amnon high in early pregnancy compared to late pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism 2021-07-04v4No1 / 83
921amnon high in costa rica compared to puerto rico in skin skin epidermis bufo marinus cane toad 2022-07-24v4No1 / 83
114amnoncommon united states of america, research facility, intestine, tadpole, state of wisconsin, digesta, rana pipiens, northern leopard frog2017-04-10v4No1 / 84
231amnoncommon in dog rectum (common feces, united states of america, rectum, canis lupus familiaris, dog)2017-11-02v4No1 / 84
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
592amnoncommon digestive system, united states of america, commonwealth of pennsylvania, tenebrio molitor, mealworm, pet store2020-02-18v1No1 / 84
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in oral cavity mouth mucosa macaca mulatta cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 84
150amnonhigh in healthy dogs compared to EPI dogs recieving enzyme supplementation ( high in control compared to enzyme supplementation exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 85
311amnoncommon in salted cabbage (common united states of america, state of rhode island, cabbage, foodon product type)2018-04-09v4No1 / 85
405amnon high in ketogenic diet compared to control diet in feces united states of america research facility mus musculus mouse swiss webster 2018-11-20v4No1 / 85
718amnoncommon united states of america, state of wisconsin, hypolimnion, polymictic lake, bog lake, freshwater lake, "forestry bog" lake, ph 4.5-52028-05-23v4No1 / 85
731amnoncommon homo sapiens, united states of america, mouth mucosa, adult, state of michigan, buccal mucosa2021-01-09v4No1 / 85
802amnoncommon homo sapiens, united states of america, saliva, adult, state of new york, cornell university2021-06-16v4No1 / 85
26amnon high in mucus pair of nares compared to saliva mouth in united states of america felis catus 2016-12-05v4No1 / 86
108amnon high in caecum compared to colon in united states of america research facility mus musculus state of texas mouse 2017-04-07v4No1 / 86
109amnoncommon united states of america, water, drinking water, site c2017-04-08v4No1 / 86
162amnoncommon in supragingival plaque in humans (common homo sapiens, united states of america, dentition, san diego, supragingival plaque, mouth)2017-07-13v4No1 / 86
249amnoncommon feces, homo sapiens, united states of america2017-11-22v4No1 / 86
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
600sheryoIncearses after 12 days of biochar ammendment in soil ( high in day 12 compared to day 1 in united states of america soil state of new york ph 6 biochar coarse-loamy soil depth (soil) 0-5cm )2020-03-27v4No1 / 86
806amnoncommon homo sapiens, united states of america, oral cavity, adult, state of new york, oral wash, mouth2021-06-19v3No1 / 86
841amnoncommon feces, homo sapiens, united states of america, adult, state of texas, human adult stage2021-11-08v4No1 / 86
224amnoncommon united states of america, glacier, snow field, stratovolcano, sediment, state of oregon2017-10-26v4No1 / 87
319amnoncommon homo sapiens, united states of america, saliva, state of texas2018-04-18v4No1 / 87
344amnoncommon in feces of homosexual males (common feces, homo sapiens, united states of america, state of colorado, denver, gay, homosexual, msm)2018-05-31v4No1 / 87
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 87
806amnon high in oral cavity oral wash compared to palatine tonsil in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 87
892amnoncommon homo sapiens, united states of america, saliva, adult, human adult stage2022-04-07v4No1 / 87
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
487amnoncommon feces, homo sapiens, united states of america, metabolic syndrome x, metabolic syndrome2019-02-24v4No1 / 88
582amnoncommon united states of america, rectum, wild, perianal skin, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 88
711amnon high in child age 8-12 years compared to adult in homo sapiens united states of america oral cavity state of colorado mouth 2028-05-21v4No1 / 88
884amnoncommon feces, homo sapiens, united states of america, adult, state of california, human adult stage2022-03-24v4No1 / 88
893amnonlower in soil fertilized with composted manure compared to soil fertilized with manure ( high in animal manure compared to composted animal manure in united states of america research facility fertilized soil rhizosphere commonwealth of virginia radish greenhouse raphanus sativus )2022-04-11v4No1 / 88
922amnoncommon homo sapiens, united states of america, saliva, adult, human adult stage2022-07-25v4No1 / 88
214amnoncommon feces, united states of america, research facility, mus musculus, high fat diet, mouse, strain 129s2017-10-23v4No1 / 89
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
399amnoncommon feces, united states of america, research facility, mus musculus, mouse2018-11-18v4No1 / 89
459amnonlower in surface compared to middle and bottom in aquaculture biofilter sand ( high in middle bottom compared to surface in united states of america fish farm water fresh water sand biofilter state of wisconsin )2019-01-12v4No1 / 89
803amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of massachusetts, caribbean latino, human late adulthood stage2021-06-18v4No1 / 89
79amnoncommon united states of america, skin, balaenoptera borealis, sei whale2017-03-03v4No1 / 90
114amnon high in tadpole compared to adult in united states of america research facility intestine state of wisconsin digesta rana pipiens northern leopard frog 2017-04-10v4No1 / 90
199amnoncommon on shower wall tile (common united states of america, building, urban biome, bathroom, shower, tile, building wall)2017-10-01v4No1 / 90
137amnon high in juvenile stage compared to adult in feces united states of america state of florida gopherus polyphemus gopher tortoise 2017-04-17v4No1 / 91
199amnonhigher in bathroom shower compared to kitchen sink ( high in bathroom shower tile building wall compared to kitchen sink in united states of america building urban biome )2017-10-01v4No1 / 91
508amnon high in lake water fresh water lake water compared to lake sediment sediment in united states of america state of minnesota manganika lake hypereutrophic lake sulfidic bottom water 2019-03-17v4No1 / 91
915amnoncommon united states of america, state of wyoming, state of colorado, snow, medicine bow - routt national forest, arapaho national forest, depth (snow) 0-5cm2022-07-02v4No1 / 91
26amnon high in mucus pair of nares compared to sebum axilla inguinal region in homo sapiens united states of america 2016-12-05v4No1 / 92
447amnonlower in mice with evert other day fasting compared to controls ( high in control compared to fasting every other day fasting in united states of america research facility caecum mus musculus c57bl/6 state of maryland mouse charles river laboratories )2019-01-08v4No1 / 92
582amnoncommon united states of america, pair of nares, wild, external naris, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 92
866amnon high in control compared to crohn's disease crohn's disease in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 92
592amnoncommon digestive system, united states of america, wild, acheta domesticus, cricket2020-02-18v1No1 / 93
658amnoncommon homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, hispanic or latin american, hispanic, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 93
46amnonsmj: lower in control female mice than treated with antiobiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces united states of america female research facility mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 94
354amnon high in bronchus bronchial epithelium bronchial brush compared to saliva oral wash in homo sapiens united states of america adult 2018-07-30v4No1 / 94
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, gay, homosexual, msm2018-11-06v4No1 / 94
471amnoncommon digestive system, united states of america, research facility, adult, state of florida, frog, osteopilus septentrionalis2019-01-14v4No1 / 94
759amnoncommon feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 94
838amnoncommon united states of america, research facility, caecum, state of ohio, meleagris gallopavo, wild turkey2021-10-13v4No1 / 94
214amnoncommon feces, united states of america, research facility, mus musculus, mouse, mouse chow, strain 129s2017-10-23v4No1 / 95
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
427amnonlower in salamanders kept at 20C compared to 10C ( high in temp 10c compared to temp 20c in feces united states of america commonwealth of virginia salamander eastern red backed salamander plethodon cinereus )2018-12-08v4No1 / 95
718amnoncommon united states of america, state of wisconsin, epilimnion, polymictic lake, bog lake, freshwater lake, "forestry bog" lake, ph 4.5-52028-05-23v4No1 / 95
770amnon high in penis male organism compared to vagina female organism in macaca mulatta age > 1 year cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 95
826amnon high in dentition subgingival plaque subgingival dental plaque compared to saliva in united states of america research facility canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 95
278amnoncommon homo sapiens, united states of america, adult, state of california, subgingival plaque2018-01-23v4No1 / 96
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in feces homo sapiens united states of america adult )2018-02-07v4No1 / 96
759amnon high in state of new york new york city wild compared to research facility commonwealth of massachusetts city of boston in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
558amnoncommon united states of america, gizzard, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 97
558amnon high in colon compared to caecum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 97
922amnon high in child 4-year-old human stage compared to adult human adult stage in homo sapiens united states of america saliva no dental caries 2022-07-25v4No1 / 97
127amnonhigh in old (14-28 days) compared to young (0-3 day) chickens ( high in age old age compared to young age in united states of america caecum gallus gallus chicken )2017-04-14v4No1 / 98
323amnonlower in teeth compared to skin and gills in sharks ( high in gill skin compared to dentition in united states of america atlantic ocean state of florida south florida shark )2018-04-24v4No1 / 98
658amnoncommon homo sapiens, united states of america, dentition, african american, child, state of nebraska, supragingival plaque, supragingival dental plaque, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 98
26amnoncommon united states of america, saliva, canis lupus familiaris, mouth2016-12-05v4No1 / 99
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, rana catesbeiana, bullfrog2017-04-02v4No1 / 99
441amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, mouse, jackson laboratories2019-01-06v4No1 / 99
458amnonpositively correlated with age ( high in age age 24 weeks compared to age 3 weeks in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 99
124amnonhigher in ifn-gamma knockout comapred to wt ( high in interferon gamma knockout compared to control in feces united states of america caecum mus musculus c57bl/6j mouse )2017-04-14v4No1 / 100
196amnonlower in water compared to biofilm ( high in biofilm biofilm compared to water in united states of america drinking water )2017-09-12v4No1 / 100
483amnoncommon united states of america, research facility, larval stage, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 100
563amnon high in hiv infection compared to control in feces homo sapiens united states of america homosexual msm male rectal swab 2019-11-18v4No1 / 100
702amnon high in felis catus cat compared to canis lupus familiaris dog in feces united states of america state of north carolina 2028-04-02v4No1 / 100
317amnoncommon united states of america, water, sea water, state of california, pacific ocean, depth (water) 300m, depth (water) 75m, depth (water) 150m2018-04-15v4No1 / 101
536amnoncommon united states of america, skin, snake, crotalus horridus, southern united states, timber rattlesnake2019-07-28v4No1 / 101
536amnoncommon united states of america, skin, snake, southern united states, fossorial snake, storeria dekayi, ground snake2019-07-28v4No1 / 101
826amnon high in dentition supragingival plaque supragingival dental plaque compared to saliva in united states of america research facility canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 102
922amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in homo sapiens united states of america child 4-year-old human stage no dental caries 2022-07-25v4No1 / 102
108amnon high in colon compared to caecum in united states of america research facility oreochromis niloticus state of texas nile tilapia 2017-04-07v4No1 / 103
198amnoncommon united states of america, hot spring, geothermal field, water, yellowstone national park, high temperature environment2017-09-13v4No1 / 103
477amnoncommon feces, homo sapiens, united states of america, adult2019-01-28v4No1 / 103
558amnon high in winter compared to summer in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 103
563amnoncommon feces, homo sapiens, control, united states of america, homosexual, msm, male, rectal swab2019-11-18v4No1 / 103
493amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2019-02-27v4No1 / 104
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin polymictic lake bog lake freshwater lake ph 4-4.5 "crystal bog" lake 2028-05-23v4No1 / 104
79amnoncommon united states of america, skin, balaenoptera physalus, fin whale2017-03-03v4No1 / 105
301amnoncommon united states of america, colon, canis lupus familiaris, dog2018-03-05v4No1 / 105
582amnon high in external acoustic meatus ear canal compared to lip labial commissure in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
226amnonlower in offshore station compared to near shore station ( high in near shore compared to offshore in united states of america lake freshwater lake water fresh water lake erie )2017-10-29v4No1 / 106
344amnonlower in gay (msm) individuals compared to heterosexual (msw) ( high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 106
447amnonhigher in mice with evert other day fasting compared to controls ( high in fasting every other day fasting compared to control in united states of america research facility caecum mus musculus c57bl/6 state of maryland mouse charles river laboratories )2019-01-08v4No1 / 106
806amnoncommon homo sapiens, united states of america, saliva, adult, state of new york2021-06-19v3No1 / 106
215amnoncommon feces, homo sapiens, united states of america2017-10-23v4No1 / 107
278amnon high in control compared to periodontitis in homo sapiens united states of america adult state of california subgingival plaque 2018-01-23v4No1 / 107
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water sea water depth (water) 0cm in united states of america atlantic ocean state of florida south florida )2018-04-24v4No1 / 107
393amnon high in heterosexual msw compared to gay homosexual msm in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 107
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
644amnonhigher in individuals born in latin america compared to indivuals born in usa ( high in non usa born compared to usa born in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 107
710amnon high in ketogenic diet compared to mouse chow control diet in feces united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 107
892amnon high in saliva compared to supragingival plaque dental plaque supragingival dental plaque in homo sapiens united states of america child 4-year-old human stage 2022-04-07v4No1 / 107
399amnoncommon feces, united states of america, canis lupus familiaris, dog2018-11-16v4No1 / 108
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
436amnoncommon feces, united states of america, felis catus, state of colorado, cat2018-12-25v4No1 / 108
461amnonearly colonizers in chitin beads incubated in ocean water (other united states of america, water, surface water, sea water, coastal water, atlantic ocean, commonwealth of massachusetts, chitin beads, middle timepoints)2019-01-12v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
536amnoncommon united states of america, skin, snake, southern united states, thamnophis sirtalis, common garter snake2019-07-28v4No1 / 110
770amnoncommon macaca mulatta, age > 1 year, penis, male organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 110
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site d 2017-04-08v4No1 / 111
477amnon high in nepal himalayas rural community compared to united states of america in feces homo sapiens adult 2019-01-28v4No1 / 111
536amnoncommon united states of america, skin, snake, southern united states, aquatic snake, nerodia sipedon, northern water snake2019-07-28v4No1 / 111
563amnoncommon feces, homo sapiens, united states of america, hiv infection, homosexual, msm, male, rectal swab2019-11-18v4No1 / 111
770amnon high in infant age < 1 year compared to age 10-15 years adult organism in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 111
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 112
466amnonlower in shaded compared to unshaded samples in cow feces left in field for 30-60 days ( high in unshaded sunlight compared to shaded in feces united states of america farm bos taurus state of georgia cow late timepoints 30-60 days )2019-01-14v4No1 / 112
718amnoncommon united states of america, state of wisconsin, epilimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "north sparkling bog" lake2028-05-23v4No1 / 112
718amnoncommon united states of america, state of wisconsin, hypolimnion, polymictic lake, bog lake, freshwater lake, ph 5-5.5, "west sparkling bog" lake2028-05-23v4No1 / 112
873amnoncommon feces, homo sapiens, united states of america, adult, commonwealth of pennsylvania, human adult stage, urban community2022-03-03v1No1 / 112
79amnoncommon united states of america, skin, delphinus delphis2017-03-03v4No1 / 113
198amnoncommon united states of america, geothermal field, sediment, thermophilic sediment, yellowstone national park, high temperature environment2017-09-13v4No1 / 113
214amnon high in c57bl/6j compared to strain s129 in feces united states of america research facility mus musculus high fat diet mouse jackson laboratories 2017-10-23v4No1 / 113
220amnon high in diet low fat diet mouse chow compared to high fat diet in feces united states of america female research facility mus musculus balb/c mouse 2017-10-24v4No1 / 113
261amnondiet dependent in cow rumen ( high in diet 27cds diet 55cs diet compared to corn diet 40mdgs diet in united states of america rumen bos taurus state of nebraska cow )2017-12-10v4No1 / 113
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 114
416amnon high in wood diet compared to mulch diet in united states of america research facility colon termite reticulitermes flaviceps 2018-11-30v4No1 / 115
536amnoncommon united states of america, skin, snake, southern united states, agkistrodon piscivorus, aquatic snake2019-07-28v4No1 / 115
301amnoncommon united states of america, rectum, canis lupus familiaris, dog2018-03-05v4No1 / 116
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, age 6 months, captive, rhesus macaque2020-09-27v4No1 / 117
343amnoncommon in apple flowers (common united states of america, flower structure, malus x domestica, state of connecticut, flower, apple)2018-05-28v4No1 / 118
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy site biopsy compared to feces in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 118
481amnonhigher in channel catfish intestine compared to the growing pond water ( high in intestine ictalurus punctatus fish channel catfish compared to pond water fresh water in united states of america research facility state of alabama )2019-02-12v4No1 / 118
658amnon high in asian burmese compared to hispanic or latin american hispanic in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 118
107amnondecreases during fasting in mouse colon ( high in early timepoints compared to fasting late timepoints in united states of america research facility colon mus musculus state of texas mouse )2017-04-07v4No1 / 120
113amnon high in adult compared to larval stage in united states of america research facility intestine danio rerio zebra fish 2017-04-10v4No1 / 120
205amnonhigher in depth 15cm compared to 2.5cm in rock piles in duluth complex ( high in depth depth (soil) 15cm compared to depth 2.5cm in united states of america quarry rock state of minnesota sulfide duluth complex ph 4-5 )2017-10-03v4No1 / 120
212amnoncommon feces, control, united states of america, research facility, mus musculus, lean body mass, mouse2017-10-22v4No1 / 120
383amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, mouse, mouse chow, f1515 diet2018-10-22v4No1 / 120
461amnonlate colonizers in chitin beads incubated in ocean water (other united states of america, water, surface water, sea water, coastal water, atlantic ocean, commonwealth of massachusetts, late timepoints, chitin beads)2019-01-12v4No1 / 120
718amnoncommon united states of america, state of wisconsin, hypolimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "north sparkling bog" lake2028-05-23v4No1 / 120
124amnonlower in ifn-gamma knockout comapred to wt ( high in control compared to interferon gamma knockout in feces united states of america caecum mus musculus c57bl/6j mouse )2017-04-14v4No1 / 121
196amnoncommon in biofilm in tap water (common united states of america, water, biofilm, drinking water, biofilm)2017-09-12v4No1 / 121
311amnoncommon united states of america, state of rhode island, scallion, foodon product type2018-04-09v4No1 / 121
393amnon high in gay homosexual msm compared to heterosexual msw in feces homo sapiens united states of america city adult state of colorado 2018-11-06v4No1 / 121
632amnonhigher following metronidazole treatment in horse feces ( high in metronidazole compared to control in feces united states of america research facility adult equus caballus state of texas horse )2020-06-10v4No1 / 121
718amnon high in hypolimnion compared to epilimnion in united states of america state of wisconsin polymictic lake bog lake freshwater lake "forestry bog" lake ph 4.5-5 2028-05-23v4No1 / 121
718amnoncommon united states of america, state of wisconsin, epilimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "trout bog" lake2028-05-23v4No1 / 121
108amnondecreases during fasting in nile tilapia caecum ( high in early timepoints compared to fasting late timepoints in united states of america research facility caecum oreochromis niloticus state of texas nile tilapia )2017-04-07v4No1 / 122
326amnoncommon united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of washington, mouse, ldlr-2018-04-29v4No1 / 122
636amnon high in oropharynx oropharyngeal swab compared to tracheal aspirate trachea endotracheal aspirate in homo sapiens united states of america hospital adult commonwealth of pennsylvania acute respiratory failure respiratory failure 2020-08-08v4No1 / 122
893amnonhigher in soil fertilized with composted manure compared to soil fertilized with manure ( high in composted animal manure compared to animal manure in united states of america research facility fertilized soil rhizosphere commonwealth of virginia radish greenhouse raphanus sativus )2022-04-11v4No1 / 122
323amnoncommon freq. in shark teeth (common united states of america, dentition, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 123
344amnonhigher in gay (msm) individuals compared to heterosexual (msw) ( high in gay homosexual msm compared to heterosexual msw in feces homo sapiens united states of america state of colorado denver )2018-05-31v4No1 / 124
582amnoncommon united states of america, wild, external ear, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 124
786sheryoHigher at 30-60cm depth compared to 60-100cm depth in flood plain soil near cosumnes river, california ( high in depth 30-60cm compared to depth 60-100cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-14v3No1 / 124
69amnoncommon feces, united states of america, research facility, canis lupus familiaris, beagle dog2017-02-21v4No1 / 125
427amnoncommon feces, united states of america, commonwealth of virginia, salamander, eastern red backed salamander, plethodon cinereus2018-12-08v4No1 / 125
150amnonhigh in healthy dogs compared to EPI dogs without treatment ( high in control compared to exocrine pancreatic insufficiency in feces united states of america canis lupus familiaris dog )2017-04-26v4No1 / 126
410amnonhigher in feces compared to rectal biopsies in children with treatment naive uc ( high in feces compared to rectum biopsy site biopsy in homo sapiens united states of america child ulcerative colitis )2018-11-22v4No1 / 126
806amnon high in dorsum of tongue compared to oral cavity oral wash in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 126
399amnonlower in metronidazole treated mice compared to controls ( high in control compared to antibiotic metronidazole in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 127
113amnon high in larval stage compared to adult in united states of america research facility intestine danio rerio zebra fish 2017-04-10v4No1 / 128
458amnoncommon in mice strains from jackson laboratories (common feces, united states of america, female, research facility, mus musculus, mouse, jackson laboratories)2019-01-11v4No1 / 129
841amnoncommon homo sapiens, united states of america, saliva, adult, state of texas, human adult stage2021-11-08v4No1 / 129
199amnoncommon in kitchen sink (common united states of america, building, urban biome, kitchen, sink)2017-10-01v4No1 / 130
125amnoncorrelated with diet induced metabolic disease in germ free transplantation ( high in c57bl/6j diet induced metabolic disease compared to cast/eij in feces united states of america mus musculus mouse )2017-04-14v4No1 / 131
462amnon high in soil compared to rhizosphere in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 131
718amnoncommon united states of america, state of wisconsin, hypolimnion, polymictic lake, bog lake, freshwater lake, ph 4-4.5, "crystal bog" lake2028-05-23v4No1 / 131
108amnoncommon united states of america, research facility, colon, state of texas, anaxyrus terrestris, southern toad2017-04-07v4No1 / 132
368amnonlower in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in control early timepoints age 10-18 weeks compared to late timepoints 23-33 weeks systemic lupus erythematosus in feces united states of america research facility mus musculus mouse nzb/w f1 )2018-09-03v4No1 / 132
625amnoncommon feces, united states of america, zoological garden, state of minnesota, saguinus imperator, como zoo, emperor tamarin2020-05-16v4No1 / 132
176amnoncommon in skin of hairless mice (common united states of america, female, research facility, dorsum, mus musculus, skin, mouse, skh-1 hairless mouse)2017-07-29v4No1 / 133
278amnoncommon homo sapiens, united states of america, saliva, adult, state of california2018-01-23v4No1 / 133
711amnon high in adult compared to child age 8-12 years in homo sapiens united states of america oral cavity state of colorado mouth 2028-05-21v4No1 / 133
46amnonsmj: lower in mice feces controls than antibiotics ( high in control compared to antibiotic pulsed antibiotic treatment, macrolide tylosin tartrate in feces united states of america research facility male mus musculoides nyulmc nod/shiltj (no. 001976, jackson labs) )2017-01-12v4No1 / 134
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
511amnoncommon united states of america, state of colorado, depth 0-5cm, snow2019-03-20v4No1 / 134
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 134
399amnonlower in ciprofloxacin treated mice compared to controls ( high in control compared to ciprofloxacin antibiotic in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
212amnoncommon feces, united states of america, research facility, mus musculus, obese body mass index status, mouse, db/db mouse, obesity2017-10-22v4No1 / 137
26amnon high in saliva mouth compared to mucus pair of nares in united states of america felis catus 2016-12-05v4No1 / 138
770amnon high in vagina female organism compared to penis male organism in macaca mulatta age > 1 year cayo santiago puerto rico indian rhesus macaque 2021-04-19v4No1 / 138
63amnonpositively correlated with bmi ( high in body mass index high bmi compared to low bmi in feces homo sapiens united states of america )2017-04-11v4No1 / 139
514amnoncommon united states of america, desert, sandstone, state of utah, grand staircase-escalante national park, depth (soil) 0-1cm2019-03-25v4No1 / 139
171amnonhigher in rice rhizosphere soil compared to bulk soil (no rice) ( high in rhizosphere compared to soil in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 140
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 140
582amnoncommon united states of america, axilla, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 140
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 140
718amnoncommon united states of america, state of wisconsin, epilimnion, polymictic lake, bog lake, freshwater lake, ph 5-5.5, "west sparkling bog" lake2028-05-23v4No1 / 140
893amnoncommon united states of america, research facility, fertilized soil, rhizosphere, commonwealth of virginia, radish, greenhouse, raphanus sativus, silty clay loam2022-04-11v4No1 / 140
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in feces homo sapiens united states of america )2017-04-12v4No1 / 141
255amnoncommon in fish feed (common united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 141
461amnonlower in early compared to late timepoints in chitin beads incubated in ocean water ( high in late timepoints compared to early timepoints in united states of america water surface water sea water coastal water atlantic ocean commonwealth of massachusetts chitin beads )2019-01-12v4No1 / 141
710amnoncommon united states of america, research facility, mus musculus, state of california, mouse, ketogenic diet, swiss webster2028-05-20v4No1 / 141
718amnoncommon united states of america, state of wisconsin, epilimnion, polymictic lake, bog lake, freshwater lake, ph 4-4.5, "crystal bog" lake2028-05-23v4No1 / 141
582amnon high in lip labial commissure compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 142
893amnoncommon united states of america, research facility, fertilized soil, rhizosphere, commonwealth of virginia, radish, greenhouse, raphanus sativus, sandy loam2022-04-11v4No1 / 142
109amnon high in distribution system compared to water treatment plant in united states of america water drinking water site e 2017-04-08v4No1 / 143
212amnonhigher in obese mice fed quinoa diet compared to ain-93g rodent diet ( high in diet quinoa food product compared to ain-93g rodent diet in feces united states of america research facility mus musculus obese body mass index status mouse db/db mouse obesity )2017-10-22v4No1 / 143
788amnon high in plant litter compared to soil in united states of america state of georgia mesocosm 2021-05-31v4No1 / 143
62amnon high in egypt compared to united states of america in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 144
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
278amnon high in saliva compared to subgingival plaque in homo sapiens united states of america adult state of california 2018-01-23v4No1 / 146
458amnonhigher in BALB/c strain compared to A/J and C57BL/6 strains ( high in balb/c compared to a/j c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 147
471amnoncommon digestive system, united states of america, research facility, tadpole, state of florida, frog, osteopilus septentrionalis2019-01-14v4No1 / 147
214amnon high in strain s129 compared to c57bl/6j in feces united states of america research facility mus musculus high fat diet mouse jackson laboratories 2017-10-23v4No1 / 148
307amnoncommon feces, united states of america, research facility, mus musculus, c3h/hej, male, mouse2018-03-19v4No1 / 148
759amnon high in canis lupus familiaris dog compared to canis lupus wolf wildlife sactuary in feces united states of america state of minnesota 2021-04-06v4No1 / 148
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in feces homo sapiens united states of america )2017-02-27v4No1 / 149
278amnon high in subgingival plaque compared to saliva in homo sapiens united states of america adult state of california 2018-01-23v4No1 / 149
300amnoncommon united states of america, female, research facility, caecum, rattus norvegicus, rat, ovariectomy, age 38 weeks2018-02-27v4No1 / 150
826amnon high in saliva compared to dentition subgingival plaque subgingival dental plaque in united states of america research facility canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 150
481amnoncommon united states of america, research facility, intestine, ictalurus punctatus, state of alabama, channel catfish2019-02-12v4No1 / 151
589amnoncommon feces, united states of america, research facility, mus musculus, low fat diet, c57bl/6, state of georgia, mouse, mouse chow, jackson laboratories2020-02-10v4No1 / 151
710amnoncommon united states of america, research facility, mus musculus, state of california, mouse, mouse chow, swiss webster, control diet2028-05-20v4No1 / 151
866amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, stress, state of illinois, mouse, restraint stress2022-02-08v4No1 / 152
885amnoncommon feces, homo sapiens, united states of america, state of florida, human early adulthood stage2022-03-26v3No1 / 152
214amnon high in c57bl/6j compared to strain 129s in feces united states of america research facility mus musculus mouse mouse chow jackson laboratories 2017-10-23v4No1 / 154
220amnon high in diet high fat diet compared to low fat diet mouse chow in feces united states of america female research facility mus musculus balb/c mouse 2017-10-24v4No1 / 154
826amnon high in subgingival plaque subgingival dental plaque compared to supragingival plaque supragingival dental plaque in united states of america research facility dentition canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 154
912amnon high in fresh water aquarium water compared to body proper whole body mussel dreissena polymorpha zebra mussel in united states of america research facility state of minnesota fresh water aquarium 2022-05-27v4No1 / 154
558amnoncommon united states of america, caecum, state of wyoming, bird, centrocercus urophasianus, greater sage-grouse2019-09-20v4No1 / 155
915amnon high in state of washington glacier peak wilderness compared to state of wyoming state of colorado medicine bow - routt national forest arapaho national forest in united states of america snow depth (snow) 0-5cm 2022-07-02v4No1 / 155
171amnoncommon united states of america, oryza sativa, state of california, rice, root2017-07-25v4No1 / 156
266amnoncommon on perennial plant leaves (common united states of america, leaf, state of idaho, plant, brassicaceae, boechera stricta)2017-12-19v4No1 / 156
108amnon high in colon compared to caecum in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v4No1 / 157
658amnoncommon homo sapiens, united states of america, dentition, child, state of nebraska, supragingival plaque, supragingival dental plaque, asian, burmese, 6-year-old human stage, 7-year-old human stage, 8-year-old human stage, 9-year-old human stage, 10-year-old human stage, 11-year-old human stage2020-09-17v3No1 / 157
108amnoncommon united states of america, research facility, colon, mus musculus, state of texas, mouse2017-04-07v4No1 / 158
902amnoncommon feces, united states of america, antibiotic, salmonella gastroenteritis, equus caballus, horse, adult organism, salmonellosis2022-05-02v4No1 / 158
461amnonhigher in early compared to late timepoints in chitin beads incubated in ocean water ( high in early timepoints compared to late timepoints in united states of america water surface water sea water coastal water atlantic ocean commonwealth of massachusetts chitin beads )2019-01-12v4No1 / 160
322amnoncommon digestive system, united states of america, research facility, tadpole, state of florida, frog, osteopilus septentrionalis2018-04-23v4No1 / 161
368amnoncommon feces, united states of america, research facility, mus musculus, mouse, nzb/w f12018-09-03v4No1 / 161
376amnoncommon united states of america, saline marsh, sediment, rhizosphere, spartina alterniflora, atlantic ocean2018-09-11v4No1 / 161
376amnonappear when transferred from high salinity to low salinity (other united states of america, saline marsh, sediment, rhizosphere, spartina alterniflora, atlantic ocean)2018-09-11v4No1 / 161
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
337amnonhigher in manhattan compared to queens in feces of house mice from new york city ( high in manhatten region compared to queens region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 162
26amnoncommon united states of america, saliva, felis catus, mouth2016-12-05v4No1 / 163
322amnon high in adult compared to tadpole in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2018-04-23v4No1 / 163
337amnoncommon in feces of house mice from new york city (common united states of america, city, mus musculus, new york city, mouse, house mice)2018-05-18v4No1 / 165
408amnon high in larval stage compared to stomach in united states of america costa rica ant pseudomyrmex spinicola 2018-11-22v4No1 / 165
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee stem populus tree cultivated environment 2019-01-13v4No1 / 166
600sheryolower in biochar ammendment soil ( high in unamended compared to biochar in united states of america soil state of new york ph 6 coarse-loamy soil day 82 depth (soil) 0-5cm )2020-03-27v4No1 / 166
658amnon high in asian burmese compared to african american in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 166
323amnoncommon in shark cloaca (common united states of america, anal canal, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 167
456amnoncommon united states of america, female, research facility, caecum, mus musculus, c57bl/6, mouse2019-01-10v4No1 / 167
718amnoncommon united states of america, state of wisconsin, epilimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "south sparkling bog" lake2028-05-23v4No1 / 167
922amnon high in child 4-year-old human stage compared to infant 1-year-old human stage in homo sapiens united states of america dentition supragingival plaque supragingival dental plaque no dental caries 2022-07-25v4No1 / 167
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
389amnon high in age 4 weeks compared to age 1-3 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 168
770amnoncommon vagina, macaca mulatta, age > 1 year, female organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 169
123amnon high in diet high fat diet compared to normal diet mouse chow in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v4No1 / 170
323amnoncommon in shark gills (common united states of america, gill, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 170
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 170
885amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, state of ohio, mouse2022-03-26v3No1 / 170
226amnonhigher in offshore station compared to near shore station ( high in offshore compared to near shore in united states of america lake freshwater lake water fresh water lake erie )2017-10-29v4No1 / 171
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common feces, united states of america, research facility, mus musculus, high fat diet, c57bl/6, state of georgia, mouse, jackson laboratories)2020-02-10v4No1 / 172
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, anaxyrus americanus, american toad2017-04-02v4No1 / 176
405amnoncommon feces, united states of america, research facility, mus musculus, mouse, ketogenic diet, swiss webster2018-11-20v4No1 / 177
921amnoncommon skin, puerto rico, bufo marinus, epidermis, municipality of bayamon, cane toad2022-07-24v4No1 / 177
196amnoncommon united states of america, water, drinking water2017-09-12v4No1 / 178
806amnon high in oral cavity oral wash compared to pair of nares external naris in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 178
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pithecia pithecia, white-faced saki, como zoo2020-05-16v4No1 / 179
718amnoncommon united states of america, state of wisconsin, meromictic lake, epilimnion, bog lake, freshwater lake, "hells kitchen" lake2028-05-23v4No1 / 179
759amnoncommon feces, united states of america, research facility, rattus norvegicus, commonwealth of massachusetts, rat, city of boston2021-04-06v4No1 / 179
311amnoncommon united states of america, state of rhode island, ginger, foodon product type2018-04-09v4No1 / 180
399amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v4No1 / 180
892amnon high in child 4-year-old human stage compared to adult organism human adult stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 180
214amnonhigher in mice from jackson laboratories compared to taconic farms ( high in jackson laboratories compared to taconic farms in feces united states of america research facility mus musculus mouse strain 129s )2017-10-23v4No1 / 181
671amnon high in age 8 months compared to female adult in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 182
107amnoncommon united states of america, research facility, colon, state of texas, eublepharis macularius, leopard gecko2017-04-07v4No1 / 183
179amnoncommon united states of america, research facility, oral cavity, mus musculus, balb/c, mouse, mouth2017-08-13v4No1 / 183
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
321amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, mouse2018-04-22v4No1 / 183
432amnoncommon united states of america, stem, state of north carolina, plant, tsuga sieboldii, southern japanese hemlock2018-12-19v4No1 / 183
399amnoncommon feces, united states of america, research facility, rattus norvegicus, rat2018-11-16v4No1 / 184
458amnoncommon in mice strains from harlan sprague dawley (common feces, united states of america, female, research facility, mus musculus, mouse, harlan sprague dawley)2019-01-11v4No1 / 184
536amnoncommon united states of america, skin, pantherophis obsoletus, snake, southern united states, black rat snake, arboreal snake2019-07-28v4No1 / 184
26amnon high in saliva mouth compared to mucus pair of nares in united states of america canis lupus familiaris 2016-12-05v4No1 / 187
885amnoncommon feces, united states of america, research facility, mus musculus, state of ohio, mouse, c57bl/6 t1r2-ko2022-03-26v3No1 / 188
158amnoncommon united states of america, saliva, felis catus, cat, mouth2017-07-06v4No1 / 189
326amnon high in diet mouse chow compared to high fat diet in united states of america research facility mus musculus c57bl/6 state of washington mouse ldlr- 2018-04-29v4No1 / 189
389amnon high in age 1-3 weeks compared to age 4 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 189
786sheryoHigher at 133-166cm depth compared to 60-100cm depth in flood plain soil near cosumnes river, california ( high in depth 133-166cm compared to depth 60-100cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-14v3No1 / 191
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site c 2017-04-08v4No1 / 193
321amnonlower in mice treated with Metronidazole compared to untreated mice ( high in control compared to antibiotic metronidazole in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 193
866amnoncommon feces, control, united states of america, research facility, mus musculus, c57bl/6, state of illinois, mouse2022-02-08v4No1 / 193
170amnoncommon united states of america, river, stream, water, fresh water, depth (water) 10cm2017-07-24v4No1 / 194
371amnonlower in skin of amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in homo sapiens skin )2018-09-06v4No1 / 195
826amnoncommon united states of america, research facility, dentition, canis lupus familiaris, state of illinois, beagle dog, dog, supragingival plaque, female organism, adult organism, supragingival dental plaque, age 4 years2021-08-22v4No1 / 195
508amnoncommon united states of america, lake, water, fresh water, state of minnesota, lake water, manganika lake, hypereutrophic lake, sulfidic bottom water2019-03-17v4No1 / 196
592amnoncommon feces, united states of america, research facility, oryctolagus cuniculus, commonwealth of pennsylvania, rabbit2020-02-18v1No1 / 196
600sheryoIncearses after 12 days of stover ammendment in soil ( high in day 12 compared to day 1 in united states of america soil state of new york ph 6 coarse-loamy soil stover ammendment soil depth (soil) 0-5cm )2020-03-27v4No1 / 196
718amnoncommon united states of america, state of wisconsin, hypolimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "trout bog" lake2028-05-23v4No1 / 196
866amnon high in control compared to stress restraint stress in feces united states of america research facility mus musculus c57bl/6 state of illinois mouse 2022-02-08v4No1 / 196
226amnonlower in algal bloom period in lake erie ( high in control compared to algal bloom in united states of america lake freshwater lake water fresh water lake erie )2017-10-29v4No1 / 198
316amnoncommon united states of america, soil, topsoil, state of ohio, ph 5, depth (soil) 0-10cm, forest ecosystem2018-04-10v4No1 / 199
372amnon high in high fat diet compared to mouse chow in feces united states of america research facility mus musculus mouse 2018-09-07v4No1 / 199
922amnon high in child 4-year-old human stage compared to infant 1-year-old human stage in homo sapiens united states of america saliva no dental caries 2022-07-25v4No1 / 200
443amnoncommon united states of america, river, water, fresh water, mississippi river, particles, upstream, depth (water) 1m, filtered 2.7um, uppper mississippi river2019-01-07v4No1 / 201
405amnoncommon feces, united states of america, research facility, mus musculus, mouse, swiss webster, control diet2018-11-20v4No1 / 203
224amnoncommon united states of america, glacier, snow field, stratovolcano, state of oregon, snow2017-10-26v4No1 / 204
718amnoncommon united states of america, state of wisconsin, meromictic lake, epilimnion, bog lake, freshwater lake, ph 5.5-6, "mary lake"2028-05-23v4No1 / 204
784amnoncommon united states of america, estuary, saline marsh, rhizosphere, topsoil, state of connecticut, long island sound, phragmites australis, common reed, depth (soil) 0-5cm2021-05-16v4No1 / 204
205amnoncommon in rock piles from duluth complex (common united states of america, quarry, rock, state of minnesota, sulfide, duluth complex, ph 4-5)2017-10-03v4No1 / 205
298amnonlower in wetted soil 18hrs compared to dried soil ( high in dry compared to irrigated in united states of america desert soil state of utah depth 1cm soil crust )2018-02-20v4No1 / 205
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin polymictic lake bog lake freshwater lake ph 5-5.5 "west sparkling bog" lake 2028-05-23v4No1 / 205
786sheryoHigher at 166-200cm depth compared to 400-700cm depth in flood plain soil near cosumnes river, california ( high in depth 166-200cm compared to depth 400-700cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-13v3No1 / 206
214amnon high in strain 129s compared to c57bl/6j in feces united states of america research facility mus musculus mouse mouse chow jackson laboratories 2017-10-23v4No1 / 207
702amnoncommon feces, united states of america, equus caballus, state of north carolina, horse2028-04-02v4No1 / 207
150amnoncommon feces, united states of america, canis lupus familiaris, dog2017-04-26v4No1 / 208
542amnoncommon research facility, dentition, adult, macaca mulatta, puerto rico, subgingival plaque, monkey, age 12-23 years2019-08-01v4No1 / 208
123amnon high in diet normal diet regular mouse chow compared to high fat diet in feces united states of america research facility mus musculus c57bl/6j mouse 2017-04-13v4No1 / 209
388amnon high in age 6-10 weeks compared to age 12-19 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 210
481amnoncommon united states of america, fishpond, research facility, water, fresh water, pond water, state of alabama2019-02-12v4No1 / 210
718amnoncommon united states of america, state of wisconsin, hypolimnion, dimictic lake, bog lake, freshwater lake, ph 4.5-5, "south sparkling bog" lake2028-05-23v4No1 / 211
826amnon high in saliva compared to dentition supragingival plaque supragingival dental plaque in united states of america research facility canis lupus familiaris state of illinois beagle dog dog female organism adult organism age 4 years 2021-08-22v4No1 / 211
658amnon high in asian burmese compared to caucasian european in homo sapiens united states of america dentition child state of nebraska supragingival plaque supragingival dental plaque 6-year-old human stage 7-year-old human stage 8-year-old human stage 9-year-old human stage 10-year-old human stage 11-year-old human stage 2020-09-17v3No1 / 212
171amnonhigher in roots compared to rhizosphere soil in rice ( high in root compared to rhizosphere in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 213
323amnoncommon in shark skin (common united states of america, skin, atlantic ocean, state of florida, south florida, shark)2018-04-24v4No1 / 213
508amnon high in lake water fresh water lake water compared to lake sediment sediment in united states of america state of minnesota mcquade lake 2019-03-17v4No1 / 214
826amnoncommon united states of america, research facility, dentition, canis lupus familiaris, state of illinois, beagle dog, subgingival plaque, dog, female organism, adult organism, subgingival dental plaque, age 4 years2021-08-22v4No1 / 215
108amnoncommon united states of america, research facility, caecum, state of texas, quail, coturnix coturnix2017-04-07v4No1 / 216
699amnon high in kingdom of spain mediterranean sea italy compared to united states of america atlantic ocean brazil in harbor clavelina oblonga sea squirts inner tunic 2028-04-01v4No1 / 216
892amnon high in child 4-year-old human stage compared to infant 1-year-old human stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 216
671amnon high in state of california compared to state of oregon in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 217
759amnon high in research facility commonwealth of massachusetts city of boston compared to state of new york new york city wild in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 217
443amnoncommon united states of america, river, water, fresh water, mississippi river, free floating, upstream, depth (water) 1m, filtered 0.2um, uppper mississippi river2019-01-07v4No1 / 219
466amnoncommon in cow feces left in field for 30-60 days (common feces, united states of america, farm, bos taurus, state of georgia, cow, late timepoints, 30-60 days)2019-01-14v4No1 / 221
196amnonhigher in water compared to biofilm ( high in water compared to biofilm biofilm in united states of america drinking water )2017-09-12v4No1 / 223
458amnonlower in BALB/c strain compared to A/J and C57BL/6 strains ( high in a/j c57bl/6 compared to balb/c in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 224
399amnonlower in vancomycin treated mice compared to controls ( high in control compared to antibiotic vancomycin in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 225
902amnon high in salmonella gastroenteritis salmonellosis compared to control in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 226
873amnon high in united states of america commonwealth of pennsylvania urban community compared to tanzania africa rural community botswana in feces homo sapiens adult human adult stage 2022-03-03v1No1 / 227
665amnoncommon united states of america, state of california, early time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 229
388amnon high in age 12-19 weeks compared to age 6-10 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-03v4No1 / 231
214amnonlower in mice from jackson laboratories compared to taconic farms ( high in taconic farms compared to jackson laboratories in feces united states of america research facility mus musculus mouse strain 129s )2017-10-23v4No1 / 232
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 232
708amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6, mouse, state of montana2028-05-16v4No1 / 232
351amnoncommon feces, united states of america, research facility, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 233
826amnoncommon united states of america, research facility, saliva, canis lupus familiaris, state of illinois, beagle dog, dog, female organism, adult organism, age 4 years2021-08-22v4No1 / 233
536amnoncommon united states of america, skin, snake, southern united states, agkistrodon contortrix, copperhead snake2019-07-28v4No1 / 236
458amnonlower in C57BL/6 strain compared to A/J and BALB/c strains ( high in balb/c a/j compared to c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 237
896amnon high in glucose diet compared to starch diet in feces united states of america female research facility mus musculus c57bl/6j state of utah mouse jackson laboratories age 2 months 2022-04-17v4No1 / 238
308amnoncommon in water of aquarium with red abalone (common united states of america, research facility, water, sea water, aquarium, state of california, red abalone, haliotis rufescens)2018-03-30v4No1 / 240
69amnoncommon united states of america, research facility, oropharynx, canis lupus familiaris, beagle dog2017-02-21v4No1 / 241
108amnoncommon united states of america, research facility, caecum, mus musculus, state of texas, mouse2017-04-07v4No1 / 241
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, diet, high fat diet, mouse2017-10-24v4No1 / 241
483amnoncommon united states of america, research facility, hawaii, pearl harbor, hydroides elegans, tubeworm, shelled egg2019-02-13v4No1 / 243
161amnoncommon in barn swallows in colorado (common feces, united states of america, state of colorado, hirundo rustica, barn swallow)2017-07-12v4No1 / 245
101amnon high in soil compared to rhizosphere in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 249
351amnoncommon united states of america, research facility, coelomic fluid, state of florida, eagle harbor, lytechinus variegatus, sea urchin2018-07-30v4No1 / 249
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee stem populus tree cultivated environment 2019-01-13v4No1 / 249
559amnon high in rhinoceros unicornis greater one-horned rhinoceros compared to ceratotherium simum white rhinoceros in feces united states of america zoological garden captive 2019-11-03v4No1 / 249
829sheryoHigher soil depth of 56-140cm compared to soil depth 0-56cm in Mollisol soil, Dekalb, Illinois, united states of america ( high in depth 56-140 compared to depth 0-56 in united states of america soil state of illinois mollisol silt loam dekalb county illinois )2021-08-26v3No1 / 249
432amnoncommon united states of america, stem, state of north carolina, plant, tsuga canadensis, eastern hemlock2018-12-19v4No1 / 251
399amnoncommon feces, united states of america, state of tennessee, zoological garden, loxodonta africana, african elephant2018-11-16v4No1 / 252
600sheryohigher in biochar ammendment soil ( high in biochar compared to unamended in united states of america soil state of new york ph 6 coarse-loamy soil day 82 depth (soil) 0-5cm )2020-03-27v4No1 / 252
665amnoncommon united states of america, state of california, early time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland, outlet2020-09-23v4No1 / 252
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 252
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee populus tree cultivated environment root 2019-01-13v4No1 / 254
699amnoncommon united states of america, saline water, sea water, atlantic ocean, state of north carolina, state of south carolina, florida2028-04-01v4No1 / 254
205amnoncommon in Ely Greenstone rock piles (common united states of america, quarry, rock, state of minnesota, ph 7, greenschist)2017-10-03v4No1 / 255
214amnon high in diet high fat diet compared to mouse chow nih 31m chow in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 255
321amnonlower in mice treated with ampicillin compared to untreated mice ( high in control compared to antibiotic ampicillin in feces united states of america research facility mus musculus c57bl/6j mouse )2018-04-22v4No1 / 255
103amnon high in upstream compared to downstream in united states of america river aquatic biome fresh water mississippi river particles 2017-04-05v4No1 / 256
625amnoncommon feces, united states of america, zoological garden, state of minnesota, ateles geoffroyi, como zoo, black-handed spider monkey2020-05-16v4No1 / 256
103amnon high in upstream compared to downstream in united states of america river aquatic biome fresh water mississippi river free floating 2017-04-05v4No1 / 257
368amnonhigher in sle model mice treated with dexamethasone (reduced symptoms) ( high in dexamethasone compared to systemic lupus erythematosus in feces united states of america research facility mus musculus mouse nzb/w f1 )2018-09-04v4No1 / 257
308amnoncommon feces, united states of america, research facility, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 258
759amnon high in farm pig state of vermont compared to state of alabama wild wild boar in feces united states of america sus scrofa 2021-04-04v4No1 / 258
282amnoncommon united states of america, mangrove swamp, soil, state of florida, mangrove, avicennia germinans, rhizophora mangle2018-01-25v4No1 / 259
788amnoncommon united states of america, state of georgia, mesocosm, plant litter2021-05-31v4No1 / 259
167amnoncommon feces, united states of america, female, research facility, mus musculus, nod mouse, mouse2017-07-18v4No1 / 260
304amnonhigher in seawater compared sea spray aerosol ( high in water sea water compared to air aerosol in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 260
432amnoncommon united states of america, stem, state of north carolina, plant, tsuga chinensis, chinese hemlock2018-12-19v4No1 / 260
220amnoncommon feces, united states of america, female, research facility, mus musculus, balb/c, diet, low fat diet, mouse, mouse chow2017-10-24v4No1 / 262
63amnon high in male compared to female in feces homo sapiens united states of america 2017-12-04v4No1 / 262
459amnoncommon in middle, bottom in aquaculture biofilter sand (common united states of america, fish farm, water, fresh water, sand, biofilter, state of wisconsin, middle, bottom)2019-01-12v4No1 / 262
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 263
399amnonlower in ampicillin treated mice compared to controls ( high in control compared to antibiotic ampicillin in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 263
915amnon high in state of wyoming state of colorado medicine bow - routt national forest arapaho national forest compared to state of washington glacier peak wilderness in united states of america snow depth (snow) 0-5cm 2022-07-02v4No1 / 263
205amnonlower in depth 15cm compared to 2.5cm in rock piles in duluth complex ( high in depth 2.5cm compared to depth depth (soil) 15cm in united states of america quarry rock state of minnesota sulfide duluth complex ph 4-5 )2017-10-03v4No1 / 265
368amnonhigher in nzb/w f1 mice late timepoints (SLE model) compared to early timepoints ( high in latetimepoints age 23-33 weeks systemic lupus erythematosus compared to control early timepoints 10-18 weeks in feces united states of america research facility mus musculus mouse nzb/w f1 )2018-09-03v4No1 / 265
261amnoncommon united states of america, rumen, bos taurus, state of nebraska, cow2017-12-10v4No1 / 266
458amnonlower in mice from hsd compared to jackson laboratories ( high in jackson laboratories compared to harlan spague dawley in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 267
559amnoncommon feces, united states of america, zoological garden, captive, dicerorhinus sumatrensis, sumatran rhinoceros2019-11-03v4No1 / 267
784amnon high in phragmites australis common reed compared to sporobolus pumilus saltmeadow cordgrass in united states of america estuary saline marsh rhizosphere topsoil state of connecticut long island sound depth (soil) 0-5cm 2021-05-16v4No1 / 267
759amnon high in state of alabama wild wild boar compared to farm pig state of vermont in feces united states of america sus scrofa 2021-04-04v4No1 / 268
558amnon high in summer compared to winter in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 274
441amnonhigher before antibiotic treatment ( high in control compared to antibiotic cefoperazone in feces united states of america research facility mus musculus c57bl/6j mouse )2019-01-06v4No1 / 275
892amnon high in adult human adult stage compared to child 4-year-old human stage in homo sapiens united states of america saliva 2022-04-07v4No1 / 275
137amnon high in adult compared to juvenile stage in feces united states of america state of florida gopherus polyphemus gopher tortoise 2017-04-17v4No1 / 277
784amnon high in sporobolus pumilus saltmeadow cordgrass compared to spartina alterniflora sporobolus alterniflorus smooth cordgrass in united states of america estuary saline marsh rhizosphere topsoil state of connecticut long island sound depth (soil) 0-5cm 2021-05-16v4No1 / 277
907amnoncommon united states of america, wastewater treatment plant, bioreactor, state of minnesota2022-05-19v4No1 / 279
770amnoncommon feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 280
718amnon high in hypolimnion compared to epilimnion in united states of america state of wisconsin polymictic lake bog lake freshwater lake ph 5-5.5 "west sparkling bog" lake 2028-05-23v4No1 / 281
171amnonhigher in roots of drought irrigated rice compared to irrigated conrols ( high in drought environment compared to control in united states of america oryza sativa state of california rice root )2017-07-25v4No1 / 282
171amnonlower in roots of drought irrigated rice compared to irrigated conrols ( high in control compared to drought environment in united states of america oryza sativa state of california rice root )2017-07-25v4No1 / 288
806amnon high in oral cavity oral wash compared to gingiva keratinized gingiva in homo sapiens united states of america adult state of new york 2021-06-19v3No1 / 288
718amnon high in hypolimnion compared to epilimnion in united states of america state of wisconsin polymictic lake bog lake freshwater lake ph 4-4.5 "crystal bog" lake 2028-05-23v4No1 / 289
922amnon high in adult human adult stage compared to child 4-year-old human stage in homo sapiens united states of america saliva no dental caries 2022-07-25v4No1 / 291
411amnoncommon feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 292
625amnoncommon feces, united states of america, zoological garden, gorilla gorilla, state of minnesota, como zoo2020-05-16v4No1 / 293
174amnoncommon in debris covered glacier (common united states of america, glacier, surface, denali national park and preserve, alaska, debris)2017-07-27v4No1 / 294
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
708amnonlower in mice with iron deficient diet ( high in iron iron supplemented diet compared to iron deficient diet low iron in feces united states of america research facility mus musculus c57bl/6 mouse state of montana )2028-05-16v4No1 / 295
476amnoncommon feces, united states of america, research facility, mus musculus, state of iowa, mouse, cf-12019-01-28v4No1 / 297
462amnon high in populus trichocarpa x deltoides compared to populus deltoides in united states of america state of tennessee populus tree cultivated environment root 2019-01-13v4No1 / 300
786sheryoHigher at 60-100cm depth compared to 133-166cm depth in flood plain soil near cosumnes river, california ( high in depth 60-100cm compared to depth 133-166cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-14v3No1 / 300
226amnonhigher in algal bloom period in lake erie ( high in algal bloom compared to control in united states of america lake freshwater lake water fresh water lake erie )2017-10-29v4No1 / 301
665amnoncommon united states of america, state of california, influent, early time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 301
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
722amnoncommon united states of america, estuary, surface water, sea water, state of new york, new york city2021-01-02v4No1 / 301
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 304
458amnonhigh in A/J strain compared to BALB/c and C57BL/6 strains ( high in a/j compared to balb/c c57bl/6 in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 306
748amnon high in jersey cow compared to holstein dairy cow in feces united states of america research facility bos taurus cow female organism state of mississippi 2021-03-10v4No1 / 308
432amnoncommon united states of america, stem, state of north carolina, plant, tsuga dumosa, himalayan hemlock2018-12-19v4No1 / 309
174amnonlower farther away from glacier terminus ( high in terminus of glacier compared to top of glacier in united states of america glacier surface denali national park and preserve alaska debris )2017-07-27v4No1 / 310
816amnon high in late pregnancy compared to early pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism 2021-07-04v4No1 / 312
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, early pregnancy2021-07-04v4No1 / 313
13amnon high in feces rectum caecum colon compared to stomach esophagus duodenum ileum mouth in united states of america gastrointestinal system mus musculus 2016-11-08v4No1 / 316
208amnoncommon feces, united states of america, mus musculus, balb/c, state of texas, mouse2017-10-06v4No1 / 316
226amnoncommon united states of america, lake, freshwater lake, water, fresh water, lake erie2017-10-29v4No1 / 316
298amnonhigher in mature soil crust ( high in mature crust compared to non mature crust in united states of america desert soil state of utah depth 1cm soil crust )2018-02-20v4No1 / 316
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
699amnon high in united states of america atlantic ocean brazil compared to kingdom of spain mediterranean sea italy in harbor clavelina oblonga sea squirts inner tunic 2028-04-01v4No1 / 317
399amnoncommon feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 319
322amnon high in tadpole compared to adult in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2018-04-23v4No1 / 320
461amnoncommon united states of america, water, surface water, sea water, coastal water, atlantic ocean, commonwealth of massachusetts2019-01-12v4No1 / 322
311amnoncommon in floor of kimchi production facility (common united states of america, food processing factory, state of rhode island, floor)2018-04-09v4No1 / 324
123amnoncommon feces, united states of america, research facility, mus musculus, c57bl/6j, mouse2017-04-13v4No1 / 325
518amnonhigher in beginning of experiment ( high in days 1-2 compared to days 14-28 in feces united states of america bos taurus state of georgia cow post-weaning angus steer )2019-06-11v4No1 / 325
61amnoncommon united states of america, research facility, skin, inguinal region, canis lupus familiaris2017-02-05v4No1 / 327
447amnoncommon united states of america, research facility, caecum, mus musculus, fasting, c57bl/6, state of maryland, mouse, charles river laboratories, every other day fasting2019-01-08v4No1 / 328
471amnon high in adult compared to tadpole in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2019-01-14v4No1 / 328
759amnoncommon feces, united states of america, farm, sus scrofa, pig, state of vermont2021-04-04v4No1 / 328
710amnon high in feces compared to stomach small intestine in united states of america research facility mus musculus state of california mouse swiss webster 2028-05-20v4No1 / 329
443amnonlower in lower mississippi river (downstream) compared to upper mississippi river ( high in upstream upper mississippi river compared to downstream lower mississippi river in united states of america river water fresh water mississippi river free floating depth (water) 1m filtered 0.2um )2019-01-07v4No1 / 335
508amnoncommon united states of america, lake, water, fresh water, state of minnesota, mcquade lake, lake water2019-03-17v4No1 / 336
542amnon high in adult age 12-23 years compared to child age 1-7 years in research facility dentition macaca mulatta puerto rico subgingival plaque monkey 2019-08-01v4No1 / 337
351amnoncommon in artificial sea water where sea urchins were grown (common united states of america, research facility, sea water, state of florida, lytechinus variegatus, sea urchin, artificial seawater)2018-07-30v4No1 / 338
456amnon high in caecum compared to tongue in united states of america female research facility mus musculus c57bl/6 mouse 2019-01-10v4No1 / 338
124amnoncommon feces, united states of america, caecum, mus musculus, c57bl/6j, mouse2017-04-14v4No1 / 339
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, late pregnancy2021-07-04v4No1 / 340
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in feces homo sapiens )2018-11-18v4No1 / 343
447amnoncommon united states of america, research facility, caecum, mus musculus, c57bl/6, state of maryland, mouse, charles river laboratories2019-01-08v4No1 / 343
158amnonlower in skin sites compared to mouth in cats ( high in saliva mouth compared to skin in united states of america felis catus cat )2017-07-06v4No1 / 346
443amnoncommon united states of america, river, water, fresh water, mississippi river, free floating, downstream, depth (water) 1m, filtered 0.2um, lower mississippi river2019-01-07v4No1 / 349
902amnoncommon feces, control, united states of america, equus caballus, horse, adult organism2022-05-02v4No1 / 350
620amnon high in wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park compared to united states of america zoological garden pan troglodytes in feces chimpanzee 2020-05-06v4No1 / 351
718amnon high in hypolimnion compared to epilimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "north sparkling bog" lake 2028-05-23v4No1 / 351
671amnon high in state of california compared to state of oregon in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 355
671amnoncommon feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 356
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chicago, chimpanzee, lincoln park zoo2020-05-06v4No1 / 358
558amnon high in caecum compared to colon in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 359
337amnonlower in manhattan compared to queens in feces of house mice from new york city ( high in queens region compared to manhatten region in united states of america city mus musculus new york city mouse house mice )2018-05-18v4No1 / 362
759amnoncommon feces, united states of america, sus scrofa, state of alabama, wild, wild boar2021-04-04v4No1 / 362
876amnoncommon feces, united states of america, research facility, juvenile organism, macaca mulatta, state of washington, monkey, age 20 months2022-03-06v4No1 / 364
902amnon high in colitis antibiotic colitis antibiotics induced colitis compared to control in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 364
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in united states of america water drinking water tap water state of illinois )2018-05-28v4No1 / 365
665amnoncommon united states of america, state of california, late time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 366
308amnoncommon united states of america, research facility, foot, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 368
620amnon high in wild republic of congo nouabale-ndoki national park compared to united states of america zoological garden in feces gorilla gorilla gorilla 2020-05-06v4No1 / 368
174amnonhigher farther away from glacier terminus ( high in top of glacier compared to terminus of glacier in united states of america glacier surface denali national park and preserve alaska debris )2017-07-27v4No1 / 369
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
560amnoncommon united states of america, female, zoological garden, ceratotherium simum, white rhinoceros, captive, san diego zoo, ceratotherium simum simum2019-11-04v4No1 / 373
582amnon high in external acoustic meatus ear canal compared to rectum perianal skin in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 374
816amnonhigher in sows in first pregnancy compared to later pregnancies ( high in first pregnancy compared to multiple pregnancies in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 374
400amnonhigher in people from thailand compared to 2nd generation immigrants to usa ( high in thailand rural community compared to united states of america in feces homo sapiens )2018-11-18v4No1 / 378
458amnonlower in A/J strain compared to BALB/c and C57BL/6 strains ( high in balb/c c57bl/6 compared to a/j in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 379
108amnon high in caecum compared to colon in united states of america research facility state of texas quail coturnix coturnix 2017-04-07v4No1 / 380
458amnonhigher in C57BL/6 strain compared to A/J and BALB/c strains ( high in c57bl/6 compared to balb/c a/j in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 380
784amnon high in spartina alterniflora sporobolus alterniflorus smooth cordgrass compared to sporobolus pumilus saltmeadow cordgrass in united states of america estuary saline marsh rhizosphere topsoil state of connecticut long island sound depth (soil) 0-5cm 2021-05-16v4No1 / 380
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in diet cron diet caloric restriction diet compared to american diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 381
559amnoncommon feces, united states of america, zoological garden, diceros bicornis, black rhinoceros, captive2019-11-03v4No1 / 382
559amnon high in ceratotherium simum white rhinoceros compared to rhinoceros unicornis greater one-horned rhinoceros in feces united states of america zoological garden captive 2019-11-03v4No1 / 382
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "south sparkling bog" lake 2028-05-23v4No1 / 382
784amnoncommon united states of america, estuary, saline marsh, rhizosphere, topsoil, state of connecticut, long island sound, sporobolus pumilus, saltmeadow cordgrass, depth (soil) 0-5cm2021-05-16v4No1 / 382
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 52020-04-22v4No1 / 383
63amnon high in female compared to male in feces homo sapiens united states of america 2017-12-04v4No1 / 384
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, chicago, lincoln park zoo2020-05-06v4No1 / 384
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
813amnonhigher in epiphytic materiall attached to intact branch compared to severed suspended branch ( high in intact branch compared to severed branch in united states of america soil state of washington olympic national park canopy soil epiphytic material )2021-06-22v4No1 / 390
399amnonlower in clindamycin treated mice compared to controls ( high in control compared to antibiotic clindamycin in feces united states of america research facility mus musculus mouse )2018-11-18v4No1 / 394
170amnonhigher in low turbidity river water ( high in turbidity low turbidity compared to high turbidity in united states of america river stream water fresh water depth (water) 10cm )2017-07-24v4No1 / 395
399amnoncommon feces, united states of america, state of tennessee, zoological garden, gorilla gorilla2018-11-16v4No1 / 395
770amnoncommon feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 396
722amnon high in surface water sea water compared to sediment marine sediment sediment surface in united states of america estuary state of new york new york city 2021-01-02v4No1 / 399
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
718amnoncommon united states of america, state of wisconsin, meromictic lake, hypolimnion, bog lake, freshwater lake, "hells kitchen" lake2028-05-23v4No1 / 400
399amnoncommon feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 404
186amnoncommon united states of america, research facility, caecum, sprague dawley, rattus, rat2017-08-23v4No1 / 407
399amnoncommon feces, united states of america, state of tennessee, zoological garden, pan troglodytes, chimpanzee2018-11-16v4No1 / 407
748amnon high in holstein dairy cow compared to jersey cow in feces united states of america research facility bos taurus cow female organism state of mississippi 2021-03-10v4No1 / 407
558amnon high in gizzard compared to crop in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 408
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pongo abelii, sumatran orangutan, como zoo2020-05-16v4No1 / 414
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
560amnoncommon united states of america, female, zoological garden, captive, san diego zoo, rhinoceros unicornis, greater one-horned rhinoceros2019-11-04v4No1 / 419
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 32020-04-22v4No1 / 420
166amnonhigher in river sediment under mussles compared to control ( high in mussel unionidae compared to control in united states of america river sediment freshwater biome mississippi river depth 5cm upper mississippi river )2017-07-18v4No1 / 422
508amnon high in lake sediment sediment compared to lake water fresh water lake water in united states of america state of minnesota manganika lake hypereutrophic lake sulfidic bottom water 2019-03-17v4No1 / 422
592amnoncommon feces, united states of america, research facility, macaca mulatta, macaque2020-02-18v1No1 / 423
443amnonlower in lower mississippi river (downstream) compared to upper mississippi river ( high in upstream upper mississippi river compared to downstream lower mississippi river in united states of america river water fresh water mississippi river particles depth (water) 1m filtered 2.7um )2019-01-07v4No1 / 425
829sheryohigher soil depth of 12-44cm compared to 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 12-44cm compared to depth 44-108cm in united states of america soil state of illinois sandy loam soil dekalb county illinois alfisol hapludalf sandy loam )2021-08-26v3No1 / 428
466amnonhigher in shaded compared to unshaded samples in cow feces left in field for 30-60 days ( high in shaded compared to unshaded sunlight in feces united states of america farm bos taurus state of georgia cow late timepoints 30-60 days )2019-01-14v4No1 / 432
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chimpanzee, saint louis, saint louis zoo2020-05-06v4No1 / 433
99amnoncommon united states of america, mucus, skin, commonwealth of virginia, pseudacris crucifer, peeper2017-04-02v4No1 / 438
829sheryohigher soil depth of 44-108cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 44-108cm compared to depth 12-44cm in united states of america soil state of illinois sandy loam soil dekalb county illinois alfisol hapludalf sandy loam )2021-08-26v3No1 / 442
371amnonhigher in amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in feces homo sapiens )2018-09-06v4No1 / 443
508amnon high in lake sediment sediment compared to lake water fresh water lake water in united states of america state of minnesota mcquade lake 2019-03-17v4No1 / 446
459amnonhigher in surface compared to middle and bottom in aquaculture biofilter sand ( high in surface compared to middle bottom in united states of america fish farm water fresh water sand biofilter state of wisconsin )2019-01-12v4No1 / 448
702amnoncommon feces, united states of america, ovis aries, state of north carolina, sheep2028-04-02v4No1 / 450
399amnoncommon feces, united states of america, state of tennessee, zoological garden, ovis aries, sheep2018-11-16v4No1 / 451
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
665amnoncommon united states of america, state of california, late time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland, outlet2020-09-23v4No1 / 461
276amnon high in peru small village tunapuco rural community compared to united states of america city state of oklahoma in feces homo sapiens adult 2018-01-22v4No1 / 469
722amnon high in soundview oyster reef compared to hunts point in united states of america estuary sediment marine sediment state of new york new york city sediment surface 2021-01-02v4No1 / 469
650amnon high in caucasian european compared to asian in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 475
813amnoncommon united states of america, soil, state of washington, olympic national park, canopy soil, intact branch, epiphytic material2021-06-22v4No1 / 475
462amnon high in stem compared to leaf in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 477
298amnonhigher in non-mature soil crust ( high in non mature crust compared to mature crust in united states of america desert soil state of utah depth 1cm soil crust )2018-02-20v4No1 / 480
786sheryoCommon in flood plain soil near cosumnes river, california, at 400-700cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 400-700cm)2021-05-18v3No1 / 481
558amnon high in caecum compared to duodenum in united states of america state of wyoming bird centrocercus urophasianus greater sage-grouse 2019-09-20v4No1 / 488
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "north sparkling bog" lake 2028-05-23v4No1 / 488
829sheryoCommon in soil depth of 56-116cm in Mollisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 56-116cm)2021-08-26v3No1 / 491
376amnondisappear when transferred from high salinity to low salinity (other united states of america, saline marsh, sediment, rhizosphere, spartina alterniflora, atlantic ocean)2018-09-11v4No1 / 494
415amnoncommon united states of america, orchard, soil, rhizosphere, citrus, cultivated environment2018-11-27v4No1 / 494
214amnon high in diet mouse chow nih 31m chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2017-10-23v4No1 / 495
518amnoncommon feces, united states of america, bos taurus, state of georgia, cow, post-weaning, angus steer2019-06-11v4No1 / 498
205amnonlower in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth 2.5cm compared to depth depth (soil) 15cm in united states of america quarry rock state of minnesota ph 7 greenschist )2017-10-03v4No1 / 499
323amnoncommon united states of america, water, surface water, sea water, atlantic ocean, state of florida, south florida, depth (soil) 0-20cm, depth (water) 0cm2018-04-24v4No1 / 504
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "trout bog" lake 2028-05-23v4No1 / 509
416amnoncommon united states of america, research facility, colon, termite, reticulitermes flaviceps2018-11-30v4No1 / 511
784amnoncommon united states of america, estuary, saline marsh, rhizosphere, spartina alterniflora, topsoil, state of connecticut, long island sound, sporobolus alterniflorus, smooth cordgrass, depth (soil) 0-5cm2021-05-16v4No1 / 511
748amnoncommon feces, united states of america, research facility, bos taurus, cow, female organism, state of mississippi, jersey cow2021-03-10v4No1 / 516
829sheryoCommon in soil depth of 116-140cm in Mollisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 116-140cm)2021-08-26v3No1 / 516
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 518
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 12020-04-22v4No1 / 518
665amnoncommon united states of america, state of california, influent, late time points, biomat, microbial biomat, water treatment pond, benthic biomat, engineered wetland2020-09-23v4No1 / 526
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, saint louis, saint louis zoo2020-05-06v4No1 / 530
376amnonlower in salt marsh with low salinity (11) compared to higher salinity (25-30) ( high in high salinity compared to low salinity in united states of america saline marsh sediment rhizosphere spartina alterniflora atlantic ocean )2018-09-11v4No1 / 533
671amnon high in state of oregon compared to state of california in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 534
821sheryoHigher at 50-100cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth 50-100m compared to depth (soil) 25-50cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 543
317amnonlower in depth>75m compared to depth >5m in ocean water ( high in surface water depth (water) 5m compared to depth (water) 300m depth (water) 75m depth (water) 150m in united states of america water sea water state of california pacific ocean )2018-04-15v4No1 / 544
304amnonhigher in seawater compared to beach sand ( high in water sea water compared to sand in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 547
304amnoncommon united states of america, beach, air, aerosol, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 558
462amnon high in populus deltoides compared to populus trichocarpa x deltoides in united states of america state of tennessee leaf populus tree cultivated environment 2019-01-13v4No1 / 559
718amnoncommon united states of america, state of wisconsin, meromictic lake, hypolimnion, bog lake, freshwater lake, ph 5.5-6, "mary lake"2028-05-23v4No1 / 559
205amnonhigher in depth 15cm compared to 2.5cm in Ely Greenstone rock piles ( high in depth depth (soil) 15cm compared to depth 2.5cm in united states of america quarry rock state of minnesota ph 7 greenschist )2017-10-03v4No1 / 562
600sheryohigher in stover ammendment soil ( high in stover amended soil compared to unamended soil in united states of america soil state of new york ph 6 coarse-loamy soil day 82 depth (soil) 0-5cm )2020-03-27v4No1 / 567
443amnoncommon united states of america, river, water, fresh water, mississippi river, particles, downstream, depth (water) 1m, filtered 2.7um, lower mississippi river2019-01-07v4No1 / 568
399amnoncommon feces, united states of america, research facility, oryctolagus cuniculus, rabbit2018-11-16v4No1 / 577
748amnoncommon feces, united states of america, research facility, bos taurus, cow, female organism, state of mississippi, holstein dairy cow2021-03-10v4No1 / 577
308amnoncommon united states of america, research facility, shell, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 579
372amnon high in mouse chow compared to high fat diet in feces united states of america research facility mus musculus mouse 2018-09-07v4No1 / 579
406amnoncommon feces, united states of america, zoological garden, giraffa camelopardalis, giraffe2018-11-21v4No1 / 581
784amnon high in sporobolus pumilus saltmeadow cordgrass compared to phragmites australis common reed in united states of america estuary saline marsh rhizosphere topsoil state of connecticut long island sound depth (soil) 0-5cm 2021-05-16v4No1 / 581
559amnoncommon feces, united states of america, zoological garden, captive, rhinoceros unicornis, greater one-horned rhinoceros2019-11-03v4No1 / 582
893amnon high in sandy loam compared to silty clay loam in united states of america research facility fertilized soil rhizosphere commonwealth of virginia radish greenhouse raphanus sativus 2022-04-11v4No1 / 582
788amnon high in feces cherokia georgiana georgiana millipede compared to soil in united states of america state of georgia mesocosm 2021-05-31v4No1 / 589
146amnon high in rhizosphere compared to soil in united states of america solanum lycopersicum tomato ph 6 slit loam 2017-04-20v4No1 / 590
536amnon high in terrestrial snake compared to aquatic snake in united states of america skin snake southern united states 2019-07-28v4No1 / 590
308amnoncommon united states of america, research facility, foot, state of california, red abalone, haliotis rufescens2018-03-30v4No1 / 592
647amnon high in lake water freshwater lake compared to skin frog rana luteiventris columbia spotted frog in united states of america state of montana 2020-09-06v4No1 / 593
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin meromictic lake bog lake freshwater lake "hells kitchen" lake 2028-05-23v4No1 / 594
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 22020-04-22v4No1 / 596
406amnoncommon feces, united states of america, zoological garden, switzerland, diceros bicornis, black rhinoceros2018-11-21v4No1 / 600
748amnon high in jersey cow compared to holstein dairy cow in united states of america research facility rumen bos taurus cow female organism ruminal fluid state of mississippi 2021-03-10v4No1 / 603
893amnon high in silty clay loam compared to sandy loam in united states of america research facility fertilized soil rhizosphere commonwealth of virginia radish greenhouse raphanus sativus 2022-04-11v4No1 / 605
788amnoncommon feces, united states of america, state of georgia, mesocosm, cherokia georgiana georgiana, millipede2021-05-31v4No1 / 607
308amnoncommon feces, united states of america, research facility, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 609
518amnonhigher in end of experiment (older steers) ( high in days 14-28 compared to days 1-2 in feces united states of america bos taurus state of georgia cow post-weaning angus steer )2019-06-11v4No1 / 609
748amnoncommon united states of america, research facility, rumen, bos taurus, cow, female organism, ruminal fluid, state of mississippi, holstein dairy cow2021-03-10v4No1 / 614
459amnoncommon in surface in aquaculture biofilter sand (common united states of america, surface, fish farm, water, fresh water, sand, biofilter, state of wisconsin)2019-01-12v4No1 / 622
786sheryoHigher at 0-30cm depth compared to 30-60cm depth in flood plain soil near cosumnes river, california ( high in depth (soil) 0-20cm depth (soil) 0-30 cm compared to depth 30-60cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-13v3No1 / 627
829sheryoHigher in soil depth of 0-56cm compared to soil depth of 56-140cm in Mollisol soil, Dekalb, Illinois, united states of america ( high in depth 0-56 compared to depth 56-140 in united states of america soil state of illinois mollisol silt loam dekalb county illinois )2021-08-26v3No1 / 631
308amnoncommon united states of america, research facility, shell, state of california, haliotis sorenseni, white abalone2018-03-30v4No1 / 632
748amnoncommon united states of america, research facility, rumen, bos taurus, cow, female organism, ruminal fluid, state of mississippi, jersey cow2021-03-10v4No1 / 632
592amnoncommon feces, united states of america, farm, bos taurus, commonwealth of pennsylvania, cow2020-02-18v1No1 / 633
813amnoncommon united states of america, soil, state of washington, olympic national park, canopy soil, severed branch, epiphytic material2021-06-22v4No1 / 633
748amnon high in holstein dairy cow compared to jersey cow in united states of america research facility rumen bos taurus cow female organism ruminal fluid state of mississippi 2021-03-10v4No1 / 638
458amnonhigher in mice from hsd compared to jackson laboratories ( high in harlan sprague dawley compared to jackson laboratories in feces united states of america female research facility mus musculus mouse )2019-01-11v4No1 / 644
471amnon high in tadpole compared to adult in digestive system united states of america research facility state of florida frog osteopilus septentrionalis 2019-01-14v4No1 / 648
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream higher mississippi river in united states of america river water fresh water mississippi river free floating depth (water) 1m filtered 0.2um )2019-01-07v4No1 / 652
559amnoncommon feces, united states of america, zoological garden, ceratotherium simum, white rhinoceros, captive2019-11-03v4No1 / 652
103amnonlower in particle bound fraction compared to free floating bacteria in mississippi river ( high in free floating compared to particles in united states of america river aquatic biome fresh water mississippi river )2017-04-05v4No1 / 653
200amnoncommon in river downstream of wastewater treatment plant (common united states of america, river, water, fresh water, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 42020-04-22v4No1 / 655
560amnon high in rhinoceros unicornis greater one-horned rhinoceros compared to ceratotherium simum white rhinoceros ceratotherium simum simum in united states of america female zoological garden captive san diego zoo 2019-11-04v4No1 / 656
466amnonhigher in cow feces left in field for 30-60 days compared to initial feces ( high in late timepoints 30-60 days compared to early timepoints 0-2 days in feces united states of america farm bos taurus state of georgia cow )2019-01-14v4No1 / 662
462amnon high in silt clay loam depth 30-75cm depth (soil) 20-60cm compared to silt loam depth (soil) 0-20cm depth (soil) 0-30 cm in united states of america state of tennessee soil cultivated environment 2019-01-12v4No1 / 665
304amnoncommon united states of america, beach, water, sea water, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 667
166amnonlower in river sediment under mussles compared to control ( high in control compared to mussel unionidae in united states of america river sediment freshwater biome mississippi river depth 5cm upper mississippi river )2017-07-18v4No1 / 671
786sheryoHigher at 30-60cm depth compared to 0-30cm depth in flood plain soil near cosumnes river, california ( high in depth 30-60cm compared to depth (soil) 0-20cm depth (soil) 0-30 cm in united states of america soil state of california flood plain sacramento cosumnes river preserve )2021-09-13v3No1 / 675
560amnon high in ceratotherium simum white rhinoceros ceratotherium simum simum compared to rhinoceros unicornis greater one-horned rhinoceros in united states of america female zoological garden captive san diego zoo 2019-11-04v4No1 / 677
902amnon high in control compared to salmonella gastroenteritis salmonellosis in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 679
416amnon high in mulch diet compared to wood diet in united states of america research facility colon termite reticulitermes flaviceps 2018-11-30v4No1 / 681
483amnoncommon united states of america, research facility, tubeworm tube, hawaii, pearl harbor, hydroides elegans, tubeworm2019-02-13v4No1 / 683
829sheryohigher soil depth of 0-12cm compared to 12-44cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 0-12cm compared to depth 12-44cm in united states of america soil state of illinois sandy loam soil dekalb county illinois alfisol hapludalf sandy loam )2021-08-26v3No1 / 685
829sheryohigher soil depth of 12-44cm compared to 0-12cm in Alfisol soil, Dekalb, Illinois, united states of america ( high in depth 12-44cm compared to depth 0-12cm in united states of america soil state of illinois sandy loam soil dekalb county illinois alfisol hapludalf sandy loam )2021-08-26v3No1 / 692
508amnoncommon united states of america, lake sediment, sediment, state of minnesota, manganika lake, hypereutrophic lake, sulfidic bottom water2019-03-17v4No1 / 693
722amnon high in hunts point compared to soundview oyster reef in united states of america estuary sediment marine sediment state of new york new york city sediment surface 2021-01-02v4No1 / 696
632amnonlower following metronidazole treatment in horse feces ( high in control compared to metronidazole in feces united states of america research facility adult equus caballus state of texas horse )2020-06-10v4No1 / 698
103amnon high in downstream compared to upstream in united states of america river aquatic biome fresh water mississippi river free floating 2017-04-05v4No1 / 703
921amnon high in puerto rico compared to costa rica in skin skin epidermis bufo marinus cane toad 2022-07-24v4No1 / 704
671amnon high in 3-month-old human stage compared to age 1 month in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 714
829sheryoCommon in soil depth of 12-44m in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 12-44cm)2021-08-26v3No1 / 721
821sheryoComoon in soil of miscanthus field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-08-02v4No1 / 726
308amnoncommon in aquarium water with white abalone (common united states of america, research facility, water, sea water, aquarium, state of california, haliotis sorenseni, white abalone)2018-03-30v4No1 / 727
462amnoncommon united states of america, state of tennessee, soil, silt clay loam, depth 30-75cm, cultivated environment, depth (soil) 20-60cm2019-01-13v4No1 / 728
665amnon high in outlet compared to inlet in united states of america state of california late time points biomat microbial biomat water treatment pond benthic biomat engineered wetland 2020-09-23v4No1 / 730
829sheryoCommon in soil depth of 0-12m in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, depth 0-12cm, alfisol, hapludalf, sandy loam)2021-08-26v3No1 / 737
813amnoncommon united states of america, soil, state of washington, forested area, olympic national park, temperate rainforest2021-06-22v4No1 / 740
481amnonlower in channel catfish intestine compared to the growing pond water ( high in pond fishpond water fresh water compared to intestine ictalurus punctatus fish channel catfish in united states of america research facility state of alabama )2019-02-12v4No1 / 741
821sheryoCommon in soil of restored prairie at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 744
600sheryoDecreases after 12 days of stover ammendment in soil ( high in day 1 compared to day 12 in united states of america soil state of new york ph 6 coarse-loamy soil stover ammendment soil depth (soil) 0-5cm )2020-03-27v4No1 / 747
829sheryoCommon in soil depth of 44-108cm in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 44-108cm)2021-08-26v3No1 / 751
443amnon high in free floating filtered 0.2um compared to particles filtered 2.7um in united states of america river water fresh water mississippi river depth (water) 1m 2019-01-07v4No1 / 755
157amnoncommon in naers of weened calves (common united states of america, nasal cavity, pair of nares, juvenile organism, bos taurus, calve)2017-07-04v4No1 / 766
813amnonlower in epiphytic materiall attached to intact branch compared to severed suspended branch ( high in severed branch compared to intact branch in united states of america soil state of washington olympic national park canopy soil epiphytic material )2021-06-22v4No1 / 768
821sheryoCommon in soil of continuous corn field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, depth 50-100m, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 769
171amnon high in drought environment compared to control in united states of america soil rhizosphere oryza sativa state of california rice 2017-07-25v4No1 / 770
171amnoncommon united states of america, soil, rhizosphere, oryza sativa, state of california, rice2017-07-25v4No1 / 772
816amnonlower in sows in first pregnancy compared to later pregnancies ( high in multiple pregnancies compared to first pregnancy in feces united states of america pregnancy research facility sus scrofa commonwealth of pennsylvania pig female organism adult organism )2021-07-04v4No1 / 780
466amnoncommon feces, united states of america, farm, bos taurus, state of georgia, cow2019-01-14v4No1 / 783
821sheryoHigher at 25-50cm depth compared to 50-100cm depth in soil in Michigan USA ( high in depth (soil) 25-50cm compared to depth 50-100m in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 784
829sheryoCommon in soil depth of 0-27cm in Mollisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 0-27cm)2021-08-26v3No1 / 798
718amnon high in hypolimnion compared to epilimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "south sparkling bog" lake 2028-05-23v4No1 / 812
821sheryoHigher at 25-50cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 25-50cm compared to depth (soil) 10-25cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 812
592amnoncommon feces, united states of america, ovis aries, commonwealth of pennsylvania, wild, sheep2020-02-18v1No1 / 828
266amnoncommon in roots in JAM garden (common united states of america, state of idaho, plant, brassicaceae, boechera stricta, root)2017-12-19v4No1 / 843
718amnon high in hypolimnion compared to epilimnion in united states of america state of wisconsin dimictic lake bog lake freshwater lake ph 4.5-5 "trout bog" lake 2028-05-23v4No1 / 843
632amnoncommon feces, united states of america, research facility, adult, equus caballus, state of texas, horse2020-06-10v4No1 / 848
371amnonhigher in skin of amerindians compared to western visitors ( high in venezuela amerindian hunter gatherer compared to united states of america city in homo sapiens skin )2018-09-06v4No1 / 854
829sheryoCommon in soil depth of 108-140cm in Alfisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, sandy loam soil, dekalb county, illinois, alfisol, hapludalf, sandy loam, depth 108-140cm)2021-08-26v3No1 / 871
821sheryoCommon in soil of switchgrass field at 50-100cm depth, Michigan USA (common united states of america, soil, state of michigan, depth 50-100m, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-03v4No1 / 872
786sheryoCommon in flood plain soil near cosumnes river, california, at 60-100cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 60-100cm)2021-05-18v3No1 / 878
665amnon high in late time points compared to early time points in united states of america state of california biomat microbial biomat water treatment pond benthic biomat engineered wetland 2020-09-23v4No1 / 884
317amnonhigher in depth>75m compared to depth >5m in ocean water ( high in depth (water) 300m depth (water) 75m depth (water) 150m compared to surface water depth (water) 5m depth (water) 0cm in united states of america water sea water state of california pacific ocean )2018-04-15v4No1 / 889
171amnoncommon in soil with rice growth irrigation protocol (common united states of america, soil, state of california, depth 5cm)2017-07-25v4No1 / 890
462amnon high in leaf compared to stem in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 890
146amnoncommon united states of america, rhizosphere, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 894
632amnon high in feces compared to caecum cecal content in united states of america research facility adult equus caballus state of texas horse 2020-06-10v4No1 / 897
788amnoncommon united states of america, soil, state of georgia, mesocosm2021-05-31v4No1 / 897
786sheryoCommon in flood plain soil near cosumnes river, california, at 133-166cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 133-166cm)2021-05-18v3No1 / 898
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, ceanothus jepsonii2019-02-05v4No1 / 900
821sheryoCommon in soil of miscanthus field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm, restored prairie)2021-08-02v4No1 / 901
829sheryoCommon in soil depth of 27-56cm in Mollisol soil, Dekalb, Illinois, united states of america (common united states of america, soil, state of illinois, mollisol, silt loam, dekalb county, illinois, depth 27-56cm)2021-08-26v3No1 / 906
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, silt clay loam, depth 30-75cm, cultivated environment, depth (soil) 20-60cm2019-01-13v4No1 / 908
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, particles2017-04-05v4No1 / 909
103amnoncommon united states of america, river, aquatic biome, fresh water, mississippi river, free floating2017-04-05v4No1 / 909
632amnoncommon united states of america, research facility, caecum, adult, equus caballus, state of texas, cecal content, horse2020-06-10v4No1 / 914
784amnon high in phragmites australis common reed compared to spartina alterniflora sporobolus alterniflorus smooth cordgrass in united states of america estuary saline marsh rhizosphere topsoil state of connecticut long island sound depth (soil) 0-5cm 2021-05-16v4No1 / 918
722amnoncommon united states of america, estuary, sediment, marine sediment, state of new york, new york city, sediment surface, soundview, oyster reef2021-01-02v4No1 / 922
821sheryoHigher at 10-25cm depth compared to 0-10cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 0-10cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 930
786sheryoCommon in flood plain soil near cosumnes river, california, at 166-200cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 166-200cm)2021-05-18v3No1 / 936
462amnoncommon united states of america, state of tennessee, soil, silt loam, cultivated environment, depth (soil) 0-20cm, depth (soil) 0-30 cm2019-01-13v4No1 / 938
632amnon high in caecum cecal content compared to feces in united states of america research facility adult equus caballus state of texas horse 2020-06-10v4No1 / 943
671amnon high in female adult compared to age 8 months in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 947
671amnon high in age 8 months compared to age 6 months 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955
821sheryoCommon in soil of continuous corn field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-07-28v4No1 / 963
620amnon high in united states of america zoological garden pan troglodytes compared to wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park in feces chimpanzee 2020-05-06v4No1 / 964
821sheryoCommon in soil of restored prairie at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm, restored prairie)2021-07-28v4No1 / 968
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-03v4No1 / 974
821sheryoCommon in soil of switchgrass field at 25-50cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 25-50cm)2021-08-03v4No1 / 974
323amnonlower in sharks compared to sea water ( high in water surface water sea water depth (water) 0cm compared to shark in united states of america atlantic ocean state of florida south florida )2018-04-24v4No1 / 979
266amnoncommon in soil from MIL garden (common united states of america, soil, state of idaho, ph 6.5)2017-12-18v4No1 / 980
193amnonhigher in nares of people working in dairy farms ( high in farm bos taurus compared to control in homo sapiens united states of america pair of nares )2017-09-05v4No1 / 992
462amnoncommon united states of america, state of tennessee, rhizosphere, populus, tree, silt loam, cultivated environment, depth (soil) 0-20cm, depth (soil) 0-30 cm2019-01-13v4No1 / 997
722amnoncommon united states of america, estuary, sediment, marine sediment, state of new york, new york city, sediment surface, hunts point2021-01-02v4No1 / 1001
479amnoncommon united states of america, rhizosphere, state of california, ph 6-7, heteromeles arbutifolia2019-02-05v4No1 / 1006
786sheryoCommon in flood plain soil near cosumnes river, california, at 100-133cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 100-133cm)2021-05-18v3No1 / 1015
620amnon high in united states of america zoological garden compared to wild republic of congo nouabale-ndoki national park in feces gorilla gorilla gorilla 2020-05-06v4No1 / 1019
103amnon high in downstream compared to upstream in united states of america river aquatic biome fresh water mississippi river particles 2017-04-05v4No1 / 1032
266amnoncommon in soil from PAR garden (common united states of america, soil, state of idaho, ph 5.5)2017-12-18v4No1 / 1032
304amnoncommon united states of america, beach, sand, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 1038
376amnonhigher in salt marsh with low salinity (11) compared to higher salinity (25-30) ( high in low salinity compared to high salinity in united states of america saline marsh sediment rhizosphere spartina alterniflora atlantic ocean )2018-09-11v4No1 / 1038
786sheryocommon in flood plain soil near cosumnes river, california, at 0-30cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 0-20cm, depth (soil) 0-30 cm)2021-05-18v3No1 / 1048
665amnon high in early time points compared to late time points in united states of america state of california biomat microbial biomat water treatment pond benthic biomat engineered wetland 2020-09-23v4No1 / 1052
876amnon high in juvenile organism age 20 months compared to age 1 week neonate in feces united states of america research facility macaca mulatta state of washington monkey 2022-03-06v4No1 / 1065
18amnoncommon feces, united states of america, equus caballus2016-11-09v4No1 / 1071
101amnoncommon united states of america, vitis vinifera, state of new york, merlot, grapevine, root2017-04-03v4No1 / 1106
266amnoncommon in roots in MAH garden (common united states of america, state of idaho, plant, brassicaceae, boechera stricta, root)2017-12-19v4No1 / 1110
146amnon high in soil compared to rhizosphere in united states of america solanum lycopersicum tomato ph 6 slit loam 2017-04-20v4No1 / 1135
5amnoncommon periplaneta americana, digestive system, united states of america, wild type2016-10-13v4No1 / 1142
146amnoncommon united states of america, soil, solanum lycopersicum, tomato, slit loam soil, ph 62017-04-20v4No1 / 1144
171amnon high in control compared to drought environment in united states of america soil rhizosphere oryza sativa state of california rice 2017-07-25v4No1 / 1164
718amnon high in hypolimnion compared to epilimnion in united states of america state of wisconsin meromictic lake bog lake freshwater lake "hells kitchen" lake 2028-05-23v4No1 / 1165
304amnoncommon united states of america, beach, water, sea water, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 1166
266amnon high in leaf compared to root in united states of america state of idaho plant brassicaceae boechera stricta 2017-12-19v4No1 / 1175
786sheryoCommon in flood plain soil near cosumnes river, california, at 30-60cm depth (common united states of america, soil, state of california, flood plain, sacramento, cosumnes river preserve, depth (soil) 30-60cm)2021-05-18v3No1 / 1180
718amnon high in epilimnion compared to hypolimnion in united states of america state of wisconsin meromictic lake bog lake freshwater lake ph 5.5-6 "mary lake" 2028-05-23v4No1 / 1195
821sheryoCommon in soil of restored prairie at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm, restored prairie)2021-07-28v4No1 / 1241
298amnoncommon united states of america, desert, soil, state of utah, depth 1cm, soil crust2018-02-20v4No1 / 1265
788amnon high in soil compared to plant litter in united states of america state of georgia mesocosm 2021-05-31v4No1 / 1280
821sheryoCommon in soil of restored prairie at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth (soil) 0-10cm, ph 6.5, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1291
266amnonCommon in soil from MAH garden (common united states of america, soil, state of idaho, ph 6)2017-12-18v4No1 / 1299
101amnon high in rhizosphere compared to root in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 1315
600sheryoCommon in biochar ammended soil after 82 days (common united states of america, soil, state of new york, ph 6, biochar, coarse-loamy soil, day 82, depth (soil) 0-5cm)2020-03-27v4No1 / 1326
600sheryoCommon in stover ammended soil after 82 days (common united states of america, soil, state of new york, ph 6, coarse-loamy soil, day 82, stover ammendment , depth (soil) 0-5cm)2020-03-27v4No1 / 1327
466amnonlower in cow feces left in field for 30-60 days compared to initial feces ( high in early timepoints 0-2 days compared to late timepoints 30-60 days in feces united states of america farm bos taurus state of georgia cow )2019-01-14v4No1 / 1329
821sheryoCommon in soil of miscanthus field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm, restored prairie)2021-08-02v4No1 / 1377
821sheryoCommon in soil of continuous corn field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth (soil) 0-10cm, corn, ph 5.9, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-07-28v4No1 / 1380
821sheryoHigher at 0-10cm depth compared to 10-25cm depth in soil in Michigan USA ( high in depth (soil) 0-10cm compared to depth (soil) 10-25cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 1383
821sheryoCommon in soil of switchgrass field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm)2021-08-02v4No1 / 1387
266amnoncommon in soil from SIL garden (common united states of america, soil, state of idaho, ph 6)2017-12-18v4No1 / 1389
600sheryoCommon in unammended soil after 82 days (common united states of america, soil, state of new york, ph 6, coarse-loamy soil, day 82, depth (soil) 0-5cm)2020-03-27v4No1 / 1395
788amnon high in soil compared to feces cherokia georgiana georgiana millipede in united states of america state of georgia mesocosm 2021-05-31v4No1 / 1395
266amnoncoomon in roots in SIL garden (common united states of america, state of idaho, plant, brassicaceae, boechera stricta, root)2017-12-19v4No1 / 1399
76amnoncommon in non-seleniferous soil (common united states of america, soil, rhizosphere, state of florida, non-seleniferous)2017-02-28v4No1 / 1414
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream upper mississippi river in united states of america river water fresh water mississippi river particles depth (water) 1m filtered 2.7um )2019-01-07v4No1 / 1418
784amnon high in spartina alterniflora sporobolus alterniflorus smooth cordgrass compared to phragmites australis common reed in united states of america estuary saline marsh rhizosphere topsoil state of connecticut long island sound depth (soil) 0-5cm 2021-05-16v4No1 / 1421
304amnoncommon united states of america, beach, water, sea water, state of california, pacific ocean, santa cruz county2018-03-12v4No1 / 1425
462amnon high in rhizosphere compared to soil in united states of america state of tennessee populus tree cultivated environment 2019-01-12v4No1 / 1428
76amnoncommon in seleniferous soil (common united states of america, soil, rhizosphere, selenium, seleniferous, woodland area)2017-02-28v4No1 / 1438
821sheryoCommon in soil of miscanthus field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth (soil) 0-10cm, miscanthus, kalamazoo loam, mesic type hapludalf, kellogg biological station, restored prairie)2021-07-28v4No1 / 1447
266amnoncommon in soil from JAM garden (common united states of america, soil, state of idaho, ph 5.5)2017-12-18v4No1 / 1456
145amnoncommon united states of america, soil, rhizosphere, oryza sativa, rice, ph 5.62017-04-19v4No1 / 1515
101amnon high in rhizosphere compared to root in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 1588
304amnonlower in seawater compared to beach sand ( high in sand compared to water sea water in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 1599
600sheryolower in stover ammendment soil ( high in unamended soil compared to stover amended in united states of america soil state of new york ph 6 coarse-loamy soil day 82 depth (soil) 0-5cm )2020-03-27v4No1 / 1612
76amnonhigher in non-seleniferous soil compared to seleniferous soil ( high in non-seleniferous compared to selenium seleniferous in united states of america soil rhizosphere woodland area )2017-02-28v4No1 / 1621
137amnoncommon feces, united states of america, state of florida, gopherus polyphemus, gopher tortoise2017-04-17v4No1 / 1622
665amnon high in inlet compared to outlet in united states of america state of california late time points biomat microbial biomat water treatment pond benthic biomat engineered wetland 2020-09-23v4No1 / 1629
4amnoncommon periplaneta americana, digestive system, united states of america2016-10-13v4No1 / 1637
462amnon high in silt loam depth (soil) 0-20cm depth (soil) 0-30 cm compared to silt clay loam detph 30-75cm in united states of america state of tennessee soil cultivated environment 2019-01-12v4No1 / 1648
821sheryoCommon in soil of continuous corn field at 10-25cm depth, Michigan USA (common united states of america, soil, state of michigan, corn, continuous corn, kalamazoo loam, mesic type hapludalf, kellogg biological station, depth (soil) 10-25cm)2021-07-28v4No1 / 1649
821sheryoHigher at 10-25cm depth compared to 25-50cm depth in soil in Michigan USA ( high in depth (soil) 10-25cm compared to depth (soil) 25-50cm in united states of america soil state of michigan corn panicum virgatum miscanthus kalamazoo loam mesic type hapludalf kellogg biological station restored prairie )2021-08-05v4No1 / 1704
722amnon high in sediment marine sediment sediment surface compared to surface water sea water in united states of america estuary state of new york new york city 2021-01-02v4No1 / 1736
902amnon high in control compared to colitis antibiotic colitis antibiotics induced colitis in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 1755
536amnon high in aquatic snake compared to terrestrial snake in united states of america skin snake southern united states 2019-07-28v4No1 / 1772
304amnoncommon united states of america, beach, sand, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 1799
304amnoncommon united states of america, beach, sand, state of california, pacific ocean, santa cruz province2018-03-12v4No1 / 1838
101amnoncommon united states of america, rhizosphere, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 1980
821sheryoCommon in soil of switchgrass field at 0-10cm depth, Michigan USA (common united states of america, soil, state of michigan, depth (soil) 0-10cm, panicum virgatum, kalamazoo loam, mesic type hapludalf, kellogg biological station)2021-08-02v4No1 / 2067
304amnonhigher in beach sand compared to sea water and sea spray ( high in sand compared to water air sea water in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 2070
101amnon high in root compared to rhizosphere in united states of america vitis vinifera state of new york merlot grapevine 2017-04-03v4No1 / 2075
166amnoncommon in river sediment (5cm) with mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river, mussel, unionidae)2017-07-18v4No1 / 2254
76amnonhigher in seleniferous soil compared to non-seleniferous soil ( high in selenium seleniferous compared to non-seleniferous in united states of america soil rhizosphere woodland area )2017-02-28v4No1 / 2259
443amnon high in particles filtered 2.7um compared to free floating filtered 0.2um in united states of america river water fresh water mississippi river depth (water) 1m 2019-01-07v4No1 / 2266
718amnon high in hypolimnion compared to epilimnion in united states of america state of wisconsin meromictic lake bog lake freshwater lake ph 5.5-6 "mary lake" 2028-05-23v4No1 / 2370
748amnon high in feces compared to rumen ruminal fluid in united states of america research facility bos taurus cow female organism state of mississippi 2021-03-10v4No1 / 2467
101amnoncommon united states of america, soil, vitis vinifera, state of new york, merlot, grapevine2017-04-03v4No1 / 2537
748amnon high in rumen ruminal fluid compared to feces in united states of america research facility bos taurus cow female organism state of mississippi 2021-03-10v4No1 / 2716
166amnoncommon in river sediment (5cm) without mussels (common united states of america, river, sediment, freshwater biome, mississippi river, depth 5cm, upper mississippi river)2017-07-18v4No1 / 2877
103amnonhigher in particle bound fraction compared to free floating bacteria in mississippi river ( high in particles compared to free floating in united states of america river aquatic biome fresh water mississippi river )2017-04-05v4No1 / 3559
462amnon high in rhizosphere compared to root in united states of america state of tennessee populus tree cultivated environment 2019-01-13v4No1 / 4630
266amnon high in root compared to leaf in united states of america state of idaho plant brassicaceae boechera stricta 2017-12-19v4No1 / 5886
171amnonlower in roots compared to rhizosphere soil in rice ( high in soil rhizosphere compared to root in united states of america oryza sativa state of california rice )2017-07-25v4No1 / 7628

Problems / suggestions? Please email info AT dbbact DOT org