Summary for ontology term: vagina

Number of annotations with term: 65

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCCGTGGGTTAAGCGTGCCGTGAAATTCCGTCGCTCAACGGCGGACGTGCGGCGCGAACTGGTCCACTTGAGTACGCGGGACGTTGGCGGAATTCGTGG0.015625
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAATGGCAAGTCTGATGTGAAAGGCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCAATCTAGAGTACCGGAGGGGTAAGTGGAATTCCTAG0.015625
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCTCGCCAAGCGGGATGTCAAAGCCCGGGGCTCAACCCCGGCCCGCATCCCGAACTGGCGGGCTTGAGTTCGGCAGGGGAAGGTGGAACACCCGGT0.015625
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__DoreaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCATTGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGTAGAGCTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.015625
d__BacteriaTACGGAGGATCCGAGCGTTATCCGGATTCATTGGGTTTAAAGGGTGCGCAGGCGGGCCTGCAAGCCCGCGGTGAAATGCGGGGGCTCAACCCCCGGACTGCCGCGGGAACTGCCGGCCTTGAGTCGCGGCGAGGGCTGCGGAACGCGGGG0.015625
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGATGTGAAAGCACGGGGCTCAACCCCGTGACTGCATTTGAAACTGTCAAACTAGAGTGCAGGAGAGGAAAGTGGAATTCCTAG0.015625
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTAAGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTTTGGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.015625
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGAAGCAAGTCAGATGTGAAATCCCGGGGCTCAACCCCGGAACTGCATTTGAAACTGTTTCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.015625
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTGCGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGTACTAGAGTGTCGGAGGGGTAAGCGGAATTCCTAG0.015625
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTGTGCAAGTCTGGTGTGAAAACCCGGGGCCCAACCCCGGGACTGCATTGGAAACTGTATAGCTTGAGTGCAGGAGGGGCAGGCGGAATTCCTAG0.015625

Top negative-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACGTAGGGGCCAAGCGTTGTCCGGAGTTACTGGGCGTAAAGCGCGCGCAGGTGGCTCACTGCGCCCGGCGTGAAAGCCCCCGGCCTAACCGGGGAGGGTCGTCGGGGACGGGTGAGCTTGAGGGTAGCAGGGGCTGGTGGAATTCCCGG0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__ArthrobacterTACGTAGGGCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCCGTGAAAGTCCGAGGCTCAACCTCGGATCTGCGGTGGGTACGGGCAGACTAGAGTGATGTAGGGGAGACTGGAATTCCTGG0.333333
d__Bacteria;p__"Deinococcus-Thermus";c__Deinococci;o__Deinococcales;f__Deinococcaceae;g__DeinococcusTACGGAGGGTGCAAGCGTTACCCGGAATCACTGGGCGTAAAGGGCGTGTAGGCGGACACTTAAGTCTGGTTTTAAAGACTGCGGCTCAACCGCAGGGATGGACTGGATACTGGGTGTCTTGACCTCTGGAGAGAGAACTGGAATTCCTGG0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAATCCCGGGGCTTAACTCCGGGCTTGCAGTGGGTACGGGCAGGCTAGAGTGTGGTAGGGGAGACTGGAATTCCTGG0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__KocuriaTACGTAGGGCGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTCGCGTCTGCTGTGAAAGCCCGGGGCTTAACCCCGGGTGTGCAGTGGGTACGGGCAGACTAGAGTGCAGTAGGGGAGACTGGAATTCCTGG0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Intrasporangiaceae;g__JanibacterTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTTGTCGCGTCTGCTGTGAAAATCCGGGGCTCAACCCCGGACTTGCAGTGGGTACGGGCAGACTAGAGTGTGGTAGGGGAGACTGGAATTCCTGG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiales_Incertae Sedis XI;g__FinegoldiaTACGTATGGAGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGTACGCAGGCGGTTTAATAAGTCGAATGTTAAAGATCGGGGCTCAACCCCGTAAAGCATTGGAAACTGATAAACTTGAGTAGTGGAGAGGAAAGTGGAATTCCTAGT0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Corynebacteriaceae;g__CorynebacteriumTACGTAGGGTGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGTGGTTTGTCGCGTCGTCTGTGAAATTCCGGGGCTTAACTTCGGGCGTGCAGGCGATACGGGCATAACTTGAGTGCTGTAGGGGAGACTGGAATTCCTG0.333333
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGGGAGCGCAGGCGGTGACTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAAGGTCATTGGAAACTGGGTCACTTGAATGCAGAAGAGGAAAGTGGAATTCCATG0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTACTAGCGTTGTCCGGATTTATTGGGCGTAAAGGGCTTGTAGGTGGTTTGTCGCGTCTGTCGTGAAATCCTGTGGCTTAACCATGGGCTTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCTGG0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__BifidobacteriaceaeTACGTAGGGCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTCGTCGCGTCTGGTGTGAAAGCCCATCGCTTAACGGTGGGTCTGCGCCGGGTACGGGCGGGCTAGAGTGCAGTAGGGGAGACTGGAATTCCCGG0.254902
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__MegasphaeraTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCGCGCAGGCGGTTCGGTAAGTCTGTCTTAAAAGTGCGGGGCTTAACCCCGTGAGGGGACGGAAACTGTCGAACTTGAGTGTCGGAGAGGAAAGCGGAATTCCTAGT0.246914
TGGGGAATATTGCACAATGGAGGGAACTCTGATGCAGCGACGCCGCGTGAGCGATGAAGGAATTCGTTTCGTAAAGCTCTGTTCTATGGGAAGAAAAGGACTGTACCATAGGAGCAAGCCCCGGCTAAATACGTGCCAGCAGCCGCGGTA0.246154
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__AtopobiumTACGTAGGGGGCAAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGTCTGTTAGGTCAGGAGTTAAATCTGGGGGCTCAACCCCTATCCGCTCCTGATACCGGCAGGCTTGAGTCTGGTAGGGGAAGATGGAATTCCAAGT0.238095
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTGGGGAATATTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGAGGGATGACGGCCTTCGGGTTGTAAACCTCTTTCAGCAGGGACGAAGCGCAAGTGACGGTACCTGCAGAAGAAGCACCGGCTAACTACGTGCCAGCAGCCG0.220183
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGACGCAAGTCTGAACCAGCCAAGTAGCGTGCAGGATGACGGCCCTATGGGTTGTAAACTGCTTTTATATGGGGATAAAGTGGGGAACGTGTTCCCTTTTGCAGGTACCATATGAATAAGGACCGGCTAATT0.216216
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTGGGGAATCTTGCACAATGGGCGAAAGCCTGATGCAGCGACGCCGCGTGCGGGATGAAGGCCTTCGGGTTGTAAACCGCTTTCAGCAGGGACGAGGCCGCAAGGTGACGGTACCTGCAGAAGAAGCCCCGGCTAACTACGTGCCAGCAGC0.204545
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__PhyllobacteriaceaeTGGGGAATATTGGACAATGGGCGCAAGCCTGATCCAGCCATGCCGCGTGAGTGATGAAGGCCCTAGGGTTGTAAAGCTCTTTCAACGGTGAAGATAATGACGGTAACCGTAGAAGAAGCCCCGGCTAACTTCGTGCCAGCAGCCGCGGTA0.200000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGTGCAGGCGGCTCGATAAGTCTGATGTGAAAGCCTTCGGCTCAACCGGAGAATTGCATCAGAAACTGTCGAGCTTGAGTACAGAAGAGGAGAGTGGAACTCCATG0.198473
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__GardnerellaTACGTAGGGCGCAAGCGTTATCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTCGTCGCGTCTGGTGTGAAAGCCCATCGCTTAACGGTGGGTTTGCGCCGGGTACGGGCGGGCTAGAGTGCAGTAGGGGAGACTGGAATTCTCGG0.195652

Annotations:

common ontology terms
term enrichment score
TermScore
vagina1.065020
pregnancy0.263736
phoenix0.197531
female0.174523
state of arizona0.164948
ismailia0.155844
age 25-45 years0.144578
nigeria0.129032
egypt0.118812
madre de dios0.115942
tamarin0.115942
municipality of yogyakarta0.109589
indonesia0.109589
age > 1 year0.109589
indian rhesus macaque0.109589
cayo santiago0.109589
vervet monkey0.109589
south africa0.109091
monkey0.107463
female organism0.100000
puerto rico0.098765
peru0.089888
first trimester0.086331
macaca mulatta0.086022
in vitro fertilization clinic0.084507
anambra state0.084507
dysplasia of cervix0.084507
non-pregnant0.084507
pregnancy trimester 20.084507
captive0.068670
wild0.061538
macaca nemestrina0.059701
ngamba island0.059701
titi monkey0.059701
plecturocebus cupreus0.059701
kirindy mitea national park0.059701
propithecus verreauxi0.059701
sifaka0.059701
edo state0.059701
sooty mangabey0.059701
cercocebus atys0.059701
chlorocebus sabaeus0.059701
chlorocebus pygerythrus pygerythrus0.059701
saguinus fuscicollis weddelli0.059701
uganda0.057971
pan troglodytes schweinfurthii0.057971
saguinus imperator0.057971
invasive carcinoma0.057971
invasive cervical carcinoma0.057971
cervical carcinoma0.057971
age 90 weeks0.057971
macaque0.056338
madagascar0.056338
chimpanzee0.054795
state of washington0.053333
male organism0.053333
guangzhou city prefecture0.053333
homo sapiens0.052796
LOWER IN vagina0.052632
state of north carolina0.051948
LOWER IN female organism0.050633
adult0.049967
state of georgia0.049383
state of michigan0.047059
adult organism0.043011
pig0.041237
sus scrofa0.041237
human early adulthood stage0.040404
chicken0.039604
gallus gallus0.038835
united states of america0.036954
state of california0.033613
african0.029851
LOWER IN african0.029851
LOWER IN bacterial vaginosis0.029851
bacterial vaginosis0.029851
semen0.029851
sperm0.029851
LOWER IN dysplasia of cervix0.029851
LOWER IN last trimester0.029851
last trimerster0.029851
premature birth0.029851
LOWER IN premature birth0.029851
LOWER IN birth in over 6 months0.029851
birth during last 6 months0.029851
LOWER IN birth during last 6 months0.029851
birth in over 6 months0.029851
LOWER IN pregnancy trimester 20.029851
LOWER IN non-pregnant0.029851
LOWER IN first trimester0.029412
penis0.029412
LOWER IN penis0.029412
LOWER IN caucasian0.028986
african american0.028986
caucasian0.028986
LOWER IN african american0.028986
farm0.028777
LOWER IN male organism0.026667
control0.026201
LOWER IN pregnancy0.025641
Fraction of dbbact annotations with this term covered by the query
TermScore
vagina1.181818
macaca nemestrina1.000000
ngamba island1.000000
titi monkey1.000000
plecturocebus cupreus1.000000
kirindy mitea national park1.000000
propithecus verreauxi1.000000
sifaka1.000000
madre de dios1.000000
tamarin1.000000
edo state1.000000
sooty mangabey1.000000
cercocebus atys1.000000
chlorocebus sabaeus1.000000
chlorocebus pygerythrus pygerythrus1.000000
saguinus fuscicollis weddelli1.000000
first trimester0.666667
african0.500000
LOWER IN african0.500000
uganda0.500000
pan troglodytes schweinfurthii0.500000
LOWER IN bacterial vaginosis0.500000
bacterial vaginosis0.500000
in vitro fertilization clinic0.500000
anambra state0.500000
saguinus imperator0.500000
semen0.500000
sperm0.500000
phoenix0.500000
invasive carcinoma0.500000
invasive cervical carcinoma0.500000
cervical carcinoma0.500000
dysplasia of cervix0.500000
LOWER IN dysplasia of cervix0.500000
LOWER IN last trimester0.500000
last trimerster0.500000
premature birth0.500000
LOWER IN premature birth0.500000
LOWER IN birth in over 6 months0.500000
birth during last 6 months0.500000
municipality of yogyakarta0.500000
indonesia0.500000
LOWER IN birth during last 6 months0.500000
birth in over 6 months0.500000
LOWER IN pregnancy trimester 20.500000
non-pregnant0.500000
ismailia0.500000
LOWER IN non-pregnant0.500000
pregnancy trimester 20.500000
age 90 weeks0.500000
age > 1 year0.500000
indian rhesus macaque0.500000
cayo santiago0.500000
vervet monkey0.500000
nigeria0.400000
macaque0.333333
madagascar0.333333
LOWER IN first trimester0.333333
age 25-45 years0.333333
penis0.333333
LOWER IN penis0.333333
pregnancy0.307692
LOWER IN caucasian0.250000
african american0.250000
caucasian0.250000
LOWER IN african american0.250000
chimpanzee0.250000
state of arizona0.250000
puerto rico0.250000
state of washington0.200000
male organism0.200000
guangzhou city prefecture0.200000
LOWER IN vagina0.181818
peru0.166667
egypt0.166667
state of north carolina0.166667
female organism0.142857
LOWER IN female organism0.142857
macaca mulatta0.142857
south africa0.133333
state of georgia0.125000
female0.106061
state of michigan0.100000
LOWER IN male organism0.100000
LOWER IN pregnancy0.076923
adult organism0.071429
monkey0.066667
pig0.062500
sus scrofa0.062500
human early adulthood stage0.058824
chicken0.055556
gallus gallus0.052632
captive0.047619
wild0.038462
state of california0.037037
homo sapiens0.027682
farm0.027027
adult0.026882
united states of america0.019305
control0.015789
Fraction of annotations for the query sequences containing the term
TermScore
vagina0.969231
homo sapiens0.569231
female0.492308
united states of america0.430769
adult0.353846
monkey0.276923
pregnancy0.230769
wild0.153846
captive0.123077
phoenix0.123077
state of arizona0.123077
south africa0.092308
age 25-45 years0.092308
ismailia0.092308
egypt0.092308
control0.076923
nigeria0.076923
female organism0.076923
madre de dios0.061538
peru0.061538
tamarin0.061538
municipality of yogyakarta0.061538
indonesia0.061538
china0.061538
age > 1 year0.061538
indian rhesus macaque0.061538
macaca mulatta0.061538
cayo santiago0.061538
puerto rico0.061538
vervet monkey0.061538
LOWER IN control0.046154
in vitro fertilization clinic0.046154
anambra state0.046154
dysplasia of cervix0.046154
first trimester0.046154
non-pregnant0.046154
pregnancy trimester 20.046154
state of washington0.030769
macaque0.030769
macaca nemestrina0.030769
ngamba island0.030769
uganda0.030769
chimpanzee0.030769
pan troglodytes schweinfurthii0.030769
state of california0.030769
titi monkey0.030769
plecturocebus cupreus0.030769
kirindy mitea national park0.030769
propithecus verreauxi0.030769
madagascar0.030769
sifaka0.030769
saguinus imperator0.030769
LOWER IN vagina0.030769
LOWER IN female organism0.030769
male organism0.030769
edo state0.030769
invasive carcinoma0.030769
invasive cervical carcinoma0.030769
cervical carcinoma0.030769
human early adulthood stage0.030769
guangzhou city prefecture0.030769
pig0.030769
sus scrofa0.030769
state of michigan0.030769
farm0.030769
age 90 weeks0.030769
adult organism0.030769
research facility0.030769
gallus gallus0.030769
chicken0.030769
state of georgia0.030769
sooty mangabey0.030769
cercocebus atys0.030769
state of north carolina0.030769
chlorocebus sabaeus0.030769
chlorocebus pygerythrus pygerythrus0.030769
saguinus fuscicollis weddelli0.030769
LOWER IN caucasian0.015385
african american0.015385
african0.015385
caucasian0.015385
LOWER IN african0.015385
LOWER IN african american0.015385
LOWER IN bacterial vaginosis0.015385
bacterial vaginosis0.015385
semen0.015385
sperm0.015385
LOWER IN dysplasia of cervix0.015385
LOWER IN last trimester0.015385
last trimerster0.015385
LOWER IN first trimester0.015385
premature birth0.015385
LOWER IN premature birth0.015385
LOWER IN birth in over 6 months0.015385
birth during last 6 months0.015385
LOWER IN birth during last 6 months0.015385
birth in over 6 months0.015385
LOWER IN pregnancy trimester 20.015385
LOWER IN pregnancy0.015385
LOWER IN non-pregnant0.015385
Exp. ID User ID Description Date Region Flag Sequences
723amnonlower in females that gave birth during last 6 months ( high in birth in over 6 months compared to birth during last 6 months in municipality of yogyakarta vagina adult female indonesia homo sapiens )2021-01-02v3No1 / 1
850amnoncommon in vitro fertilization clinic, adult, anambra state, nigeria, female organism, vagina, homo sapiens2021-12-16v4No1 / 2
191amnondecreases during pregnancy ( high in first trimester compared to last trimester in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 3
976amnoncommon human early adulthood stage, vagina, first trimester, pregnancy, female, guangzhou city prefecture, china2022-12-24v3No1 / 4
528amnoncommon homo sapiens, female, vagina, pregnancy, united states of america2019-07-14v1No1 / 5
976amnondominant china, guangzhou city prefecture, female, pregnancy, first trimester, vagina, human early adulthood stage2022-12-24v3No1 / 6
850amnon high in semen sperm male organism compared to vagina female organism in in vitro fertilization clinic anambra state nigeria adult homo sapiens 2021-12-16v4No1 / 7
960amnoncommon edo state, adult, female, nigeria, vagina, homo sapiens2022-12-20v4No1 / 7
535amnoncommon in healthy adult vaginal samples (common homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, control)2019-07-25v4No1 / 7
191amnonincreases during pregnancy ( high in last trimerster compared to first trimester in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 7
981amnondominant monkey, plecturocebus cupreus, titi monkey, captive, united states of america, state of california, vagina2022-12-25v3No1 / 8
981amnoncommon vagina, state of california, united states of america, captive, titi monkey, plecturocebus cupreus, monkey2022-12-25v3No1 / 9
535amnon high in dysplasia of cervix compared to control in homo sapiens vagina female adult united states of america phoenix state of arizona 2019-07-25v4No1 / 9
724amnon high in pregnancy pregnancy trimester 2 compared to non-pregnant in age 25-45 years ismailia egypt adult female vagina homo sapiens 2021-01-03v3No1 / 10
724amnondominant non-pregnant, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 10
535amnonhigh freq. in healthy adult vaginal samples (dominant homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, control)2019-07-25v4No1 / 11
535amnoncommon in adult vaginal samples with ICC (common homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, invasive carcinoma, invasive cervical carcinoma, cervical carcinoma)2019-07-25v4No1 / 11
535amnonhcommon in adult vaginal samples with cervical dysplasia (common homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, dysplasia of cervix)2019-07-25v4No1 / 11
191amnondominant homo sapiens, vagina, female, united states of america, pregnancy2017-09-05v4No1 / 11
724amnondominant pregnancy trimester 2, pregnancy, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 12
389amnondominant pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 13
795amnoncommon vagina, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 13
850amnondominant in vitro fertilization clinic, anambra state, female organism, nigeria, adult, vagina, homo sapiens2021-12-16v4No1 / 14
770amnondominant vagina, female organism, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 14
960amnondominant homo sapiens, vagina, nigeria, female, adult, edo state2022-12-20v4No1 / 15
723amnoncommon municipality of yogyakarta, vagina, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 15
528amnondominant homo sapiens, female, vagina, pregnancy, united states of america2019-07-14v1No1 / 16
981amnondominant monkey, wild, pan troglodytes schweinfurthii, chimpanzee, uganda, ngamba island, vagina2022-12-25v3No1 / 16
535amnonhigh freq. in adult vaginal samples with cervical dysplasia (dominant homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, dysplasia of cervix)2019-07-25v4No1 / 16
535amnon high in control compared to dysplasia of cervix in homo sapiens vagina female adult united states of america phoenix state of arizona 2019-07-25v4No1 / 16
213amnondominant homo sapiens, south africa, vagina2017-10-22v4No1 / 16
724amnoncommon non-pregnant, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 17
981amnondominant monkey, cercocebus atys, captive, united states of america, sooty mangabey, state of georgia, vagina2022-12-25v3No1 / 17
981amnondominant monkey, captive, united states of america, chlorocebus sabaeus, vervet monkey, state of north carolina, vagina2022-12-25v3No1 / 17
724amnoncommon pregnancy trimester 2, pregnancy, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 18
535amnonhigh freq. in adult vaginal samples with ICC (dominant homo sapiens, vagina, female, adult, united states of america, phoenix, state of arizona, invasive carcinoma, invasive cervical carcinoma, cervical carcinoma)2019-07-25v4No1 / 20
191amnonhigher in preterm birth vaginal samples ( high in premature birth compared to control in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 22
795amnondominant vagina, age 90 weeks, adult organism, research facility, china, gallus gallus, chicken2021-06-08v4No1 / 23
981amnondominant monkey, vagina, chlorocebus pygerythrus pygerythrus, wild, vervet monkey, south africa2022-12-25v3No1 / 23
981amnoncommon vagina, captive, state of washington, united states of america, macaque, macaca nemestrina, monkey2022-12-25v3No1 / 24
981amnondominant monkey, macaca nemestrina, macaque, united states of america, state of washington, captive, vagina2022-12-25v3No1 / 24
981amnondominant monkey, wild, saguinus imperator, tamarin, peru, madre de dios, vagina2022-12-25v3No1 / 24
723amnondominant municipality of yogyakarta, vagina, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 24
981amnoncommon south africa, vervet monkey, wild, chlorocebus pygerythrus pygerythrus, vagina, monkey2022-12-25v3No1 / 28
981amnondominant monkey, wild, saguinus fuscicollis weddelli, tamarin, peru, madre de dios, vagina2022-12-25v3No1 / 28
724amnon high in non-pregnant compared to pregnancy trimester 2 pregnancy in age 25-45 years ismailia egypt adult female vagina homo sapiens 2021-01-03v3No1 / 29
191amnoncommon homo sapiens, vagina, female, united states of america, pregnancy2017-09-05v4No1 / 31
981amnondominant monkey, sifaka, madagascar, wild, propithecus verreauxi, kirindy mitea national park, vagina2022-12-25v3No1 / 32
528amnon high in african american african compared to caucasian in united states of america pregnancy vagina female homo sapiens 2019-07-14v1No1 / 34
191amnonlower in preterm birth vaginal samples ( high in control compared to premature birth in homo sapiens vagina female united states of america pregnancy )2017-09-05v4No1 / 37
528amnon high in caucasian compared to african african american in homo sapiens female vagina pregnancy united states of america 2019-07-14v1No1 / 38
213amnonhigher in patients with bacterial vaginosis compared to healthy controls ( high in bacterial vaginosis compared to control in homo sapiens vagina south africa )2017-10-31v4No1 / 38
723amnonhigher in females that gave birth during last 6 months ( high in birth during last 6 months compared to birth in over 6 months in municipality of yogyakarta vagina adult female indonesia homo sapiens )2021-01-02v3No1 / 38
981amnoncommon vagina, state of north carolina, vervet monkey, chlorocebus sabaeus, united states of america, captive, monkey2022-12-25v3No1 / 42
389amnoncommon pig, sus scrofa, vagina, united states of america, state of michigan, farm2018-11-04v4No1 / 43
981amnoncommon vagina, ngamba island, uganda, chimpanzee, pan troglodytes schweinfurthii, wild, monkey2022-12-25v3No1 / 46
981amnoncommon vagina, madre de dios, peru, tamarin, saguinus fuscicollis weddelli, wild, monkey2022-12-25v3No1 / 52
981amnoncommon vagina, madre de dios, peru, tamarin, saguinus imperator, wild, monkey2022-12-25v3No1 / 68
770amnon high in penis male organism compared to vagina female organism in age > 1 year indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 95
981amnoncommon vagina, state of georgia, sooty mangabey, united states of america, captive, cercocebus atys, monkey2022-12-25v3No1 / 102
213amnoncommon homo sapiens, south africa, vagina2017-10-22v4No1 / 103
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
981amnoncommon vagina, kirindy mitea national park, propithecus verreauxi, wild, madagascar, sifaka, monkey2022-12-25v3No1 / 109
770amnon high in vagina female organism compared to male organism penis in age > 1 year indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 138
770amnoncommon vagina, female organism, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 169

Problems / suggestions? Please email info AT dbbact DOT org