Summary for ontology term: vellozia epidendroides

Number of annotations with term: 12

Top positive-associated sequence

Taxonomy Sequence Recall

Top negative-associated sequence

Taxonomy Sequence Recall

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaCACAAGTAAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGGGTACCTAGACAGTATTTCCAGCCTCTAAAGGGTACGGATTTACTAGAGTTTTATGGGAGAGGTAAATATTAGGGCTATTGGTGTAGAGATGAAATGTTTTGATACTA0.600000
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__RhizobialesTACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGAAATTTAAGTCAGGGGTGAAATCCCGAGGCTCAACCTCGGAACTGCCTTTGATACTGGATTTCTCGAGTCCGGGAGAGGTGAGTGGAACTGCGAG0.600000
d__BacteriaTACGTTAAGAGACTAGTGTTATTCATCTTTAATAGGTTTAAAGGGTACTCAAACGGAAAAATTAGCCTCAAAGGATACAGTTTTTCTAGAGTTTTATATAAGGAGGTCGTACTTGTGAGTGGAGAGATAAAATTCTTTGATACCTAGAGG0.600000
d__BacteriaTACGTAAGAGCCTAGTGTTATTCATCTTAAATAGGTTTAAAGGGTACTTAGACGGTAGTAAATGACTTAAAATAAGAGTACATCACTACTAGAGTTTGATATGGGGAGGTCGTACCCAGGGTGAAGAGTTAAAATTTGGTAATACCCCGG0.571429
d__BacteriaTACGTAGAAGACAAGTGTTATTCATCTTTAAAAGGTTTAAAGGGTACCTAGACTGGATATCAAGCCTTAAAAGGGGACTAATATTCTAGAGTTTTATATGTGAAAATTGAACCACATGTGTAGTGTCAATATACTTTAATACGTGGGGGA0.545455
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp1;g__GranulicellaTACGAGGGGGGCAAGCGTTGTTCGGAATTATTGGGCGTAAAGGGTGCGTAGGCGGTTTGATAAGTCATCTGTGAAATCCCTGGGCTCAACCCAGGGTCTGCAGGCGAAACTGTCGGGCTTGAGAGTGGGAGAGGTGAGTGGAATTTCCGG0.526316
d__BacteriaTACAAGGAAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGTTTTTTTCGCTCCAAAAGAGTACATGAAAACTAGAGTTTGATAGGAGAGGTAAATATTAGGGCCATTGGTGTAGAGATGGAATGTTTTGATACTA0.526316
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp3;g__Gp3TACGTAGGCAGCGAGCGTTGTTCGGAATTACTGGGCGTAAAGAGTGTGTAGGCGGTGCTCTAAGTTCGGTGTGAAATCTCCTGGCTTAACTGGGAGGGTGCGCCGGAAACTGGAATGCTCGAGCGTGGGAGAGGTAAGCGGAATTCCTGG0.526316
d__BacteriaTACAAGTAAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGGGTACCTAGACGGTTATGCTTGCCTTCAACGGGAACGGCATTTCTAGGGTTTTATGGGAGAGGTAAATGGAGTACTATTGATGTAGAGATAAAATATTTTGATATTAA0.500000
d__BacteriaTACGAGTAAGACTAGTGTTATTCATCTTTATTAGGTTTAAAGGGTACCTAGACGACAAATAAAGCCCCATGGGAACGTATTTGATAGAGTTTTATGTAAGAGGAAAATTTAGTACTATTGGTGTAGAGATGAAATGTTTTGATACCGATG0.480000

Annotations:

common ontology terms
term enrichment score
TermScore
minas gerais state0.666667
campos rupestres0.666667
vellozia epidendroides0.666667
leaf endosphere0.200000
stem0.153846
root0.105263
brazil0.100000
leaf0.083333
LOWER IN root0.074074
plant0.041667
rhizosphere0.039216
LOWER IN rhizosphere0.033898
Fraction of dbbact annotations with this term covered by the query
TermScore
minas gerais state0.500000
campos rupestres0.500000
vellozia epidendroides0.500000
leaf endosphere0.250000
stem0.142857
root0.066667
LOWER IN root0.066667
brazil0.052632
leaf0.047619
plant0.022727
rhizosphere0.021277
LOWER IN rhizosphere0.021277
Fraction of annotations for the query sequences containing the term
TermScore
minas gerais state1.000000
campos rupestres1.000000
brazil1.000000
vellozia epidendroides1.000000
leaf0.333333
rhizosphere0.250000
plant0.250000
root0.250000
leaf endosphere0.166667
stem0.166667
LOWER IN rhizosphere0.083333
LOWER IN root0.083333
Exp. ID User ID Description Date Region Flag Sequences
548amnondominant minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 6
548amnonhigh freq. in endopytic roots of Vellozia epidendroides (dominant minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 11
548amnondominant minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf, leaf endosphere2019-08-17v4No1 / 17
548amnonhigh freq. on leaf surface (dominant minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v4No1 / 18
548amnondominant minas gerais state, campos rupestres, brazil, vellozia epidendroides, stem2019-08-17v4No1 / 21
548amnon high in plant root compared to rhizosphere in minas gerais state campos rupestres brazil vellozia epidendroides 2019-08-15v4No1 / 100
548amnon high in rhizosphere compared to root in minas gerais state campos rupestres brazil vellozia epidendroides 2019-08-15v4No1 / 197
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf, leaf endosphere2019-08-17v4No1 / 243
548amnoncommon minas gerais state, campos rupestres, brazil, vellozia epidendroides, stem2019-08-17v4No1 / 431
548amnoncommon on leaf surface (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, leaf)2019-08-17v4No1 / 548
548amnoncommon in endopytic roots of Vellozia epidendroides (common minas gerais state, campos rupestres, brazil, vellozia epidendroides, plant, root)2019-08-15v4No1 / 800
548amnoncommon minas gerais state, campos rupestres, brazil, rhizosphere, vellozia epidendroides2019-08-15v4No1 / 1040

Problems / suggestions? Please email info AT dbbact DOT org