Summary for ontology term: wastewater treatment plant

Number of annotations with term: 16

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.066667
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTATCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.066667
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__DialisterTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGCTTCCCAAGTCCCTCTTAAAAGTGCGGGGCTTAACCCCGTGATGGGAAGGAAACTGGGAAGCTGGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.066667
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTGGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCTGACTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.066667
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATTACTGGGCGTAAAGGGAGCGTAGGCGGTCGATTAAGTTAGATGTGAAACCCCCGGGCTTAACTTGGGGACTGCATCTAATACTGGTTGACTTAGAGTACAGGAGAGGGAAGCGGAATTCCTA0.066667
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__LactococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGTGGTTTATTAAGTCTGGTGTAAAAGGCAGTGGCTCAACCATTGTATGCATTGGAAACTGGTAGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCATGT0.066667
d__Bacteria;p__"Proteobacteria"TGGGGAATTTTGGACAATGGGGGCAACCCTGATCCAGCCATGCCGCGTGCGGGAAGAAGGCCTTCGGGTTGTAAACCGCTTTTAGCCGGAAAGAAAAGGCGCTCTCTAATACGGGGCGTTCTTGACGGTACCGGCGGAATAAGCACCGGC0.066667
d__Bacteria;p__"Planctomycetes";c__Planctomycetia;o__Planctomycetales;f__PlanctomycetaceaeTCGAGAATCTTCGGCAATGGGCGCAAGCCTGACCGAGCGATGCCGCGTGCGGGATGAAGGCCTTCGGGTTGTAAACCGCTGTCAGAGGGGATGAAATACGTCGGGGGTTCTCCCCCGGGTTTGACATATCCTCAGAGGAAGGACGGGCTA0.066667
d__Bacteria;p__"Proteobacteria";c__BetaproteobacteriaTGGGGAATTTTGGACAATGGGGGCAACCCTGATCCAGCCATGCCGCGTGCGGGAAGAAGGCCTTCGGGTTGTAAACCGCTTTTAGTCGGGAAGAAAAGGCGCCGGATAACACCCGGCGTTCTTGACGGTACCGGCGGAATAAGCACCGGC0.066667
d__BacteriaTCAAGAATCTTCCCCAATGGACGAAAGTCTGAGGGAGCGACGCCGCGTGCAGGAAGAAACCCCTCGGGGCGTAAACTGCTTTTCTCTGGGAATAACTCTGAAGGTACCAGAGGAATAAGAGGCTGCTAACTTCGTGCCAGCAGCAGCGGT0.066667

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTAATCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTCAAGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTTTGACTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAATCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVbTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGCATGGTAAGTAAGATGTGAAAGCCCGAGGCTTAACCTCGAGGATTGCATTTTAAACTATCAAGCTAGAGTACAGGAGAGGAAAGCGGAATTCCTA0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGCAGCCGGGTGCGCAAGTCAGATGTGAAATCTCAGGGCTCAACCCTGAAACTGCATTTGAAACTGTGCATCTTGAGTGCCGGAGAGGTAATCGGAATTCCTTG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGATGCAAGTCTGAAGTGAAATACCCGGGCTCAACCTGGGAACTGCTTTGGAAACTGTGTTGCTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.333333
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGATTGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCAGTCTTGAGTGCAGTAGAGGTGGGCGGAATTCGTGG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGCGTAGGTGGTATGGCAAGTCAGAAGTGAAAGGCTGGGGCTCAACCCCGGGACTGCTTTTGAAACTGTCAAACTAGAGTACAGGAGAGGAAAGCGGAATTCCTAG0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__CoriobacteriaceaeTACGTATGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCTGGCAGGCCGGGAGTCAAATCCGGGGGCTCAACCCCCGCCCGCTCCCGGAACCTCCAGGCTTGAGTCTGGCAGGGGAGGGTGGAATACCCGGT0.333333

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Xanthomonadales;f__Xanthomonadaceae;g__DokdonellaTACGAAGGGTGCAAGCGTTACTCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGTTTGTTAAGTCTGCTGTGAAAGCCCTGGGCTCAACCTGGGAACTGCAGTGGATACTGGCGAGCTAGAGTGTGTCAGAGGATGGTGGAATTCCCGG0.434783
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Rhodocyclales;f__Rhodocyclaceae;g__ZoogloeaTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTATGTAAGACAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTTGTGACTGCATAACTAGAGTACGGCAGAGGGAGGTGGAATTCCGCG0.387097
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfobacterales;f__Desulfobulbaceae;g__DesulfobulbusTACGGAGGGTGCAAGCGTTGTTCGGAATCACTGGGCGTAAAGGGCGCGCAGGCGGCCTGATCAGTCAGATGTGAAAGCCCACGGCTTAACTGTGGAAGTGCATTTGAAACTGTCAGGCTTGAGTACCAGAGGGGAAAGTGGAATTCCCGG0.380952
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Xanthomonadales;f__XanthomonadaceaeTACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGTAGGTGGTTTGTTAAGTCAGATGTGAAAGCCCTGGGCTCAACCTGGGAACTGCATTTGATACTGGCAGGCTAGAGTGCGGTAGAGGGTGGTGGAATTCCCGG0.380952
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGCTTGTCGCGTCTGCTGTGAAATCCTGGGGCTTAACTCTGGGCGTGCAGTGGGTACGGGCAGGCTAGAGTGCGGTAGGGGTGATTGGAATTCCTGG0.363636
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGATTAATAAGTCAGTTGTAAAATGCACGGGCTCAACTCGTGTTTGTCGACTGATACTGTTAGTCTAGAGTATGTGAGAGGGAAGTGGAATTCCCGG0.363636
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATTACTGGGCGTAAAGCGCACGCAGGCGGATTAAAAAGTCAGCCGTAAAATGCACGGGCTCAACCTGTGTTAGTCAGCTGATACTATTAGTCTAGAGTATGTGAGAGGGAAGTGGAATTCCCGG0.363636
d__BacteriaTACGTAGGATCCAAGCGTTGTCCGGATTTACTGGGTATAAAGGGTGCGTAGGCGGCTTTTTGCGTCAGAGGTGAAATCCACGGGCTTAACCCGTGGGGTGCCTTTGAAACGGGAAGGCTTGAGTATGACAGAGGCGGATGGAATTCCTGG0.363636
d__Bacteria;p__"Proteobacteria";c__BetaproteobacteriaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGATATGTAAGTTAGGAGTGAAATCCCCGGGCTCAACCTGGGAATGGCTTTTAAGACTGCGTATCTAGAGTTTGTCAGAGGGGGGTGGAATTCCAAG0.347826
d__BacteriaGACGTAGGAAGCAAGCGTTGTCCGGAATTACTGGGCGTAAAGAGCTCGTAGGCGGGATCGTAAGTCTTAGAGTAAATCTCACGGCTCAACCGTGGGGCCTTCTGAGATACTGCGATTCTTGAGGATGTCAGAGGAAAGTGGAATTCCCGG0.347826

Annotations:

common ontology terms
term enrichment score
TermScore
wastewater treatment plant0.933333
effluent0.552632
treated wastewater0.272727
spring0.222222
low income0.200000
bioreactor0.200000
LOWER IN wastewater treatment plant0.190476
state of minnesota0.125000
LOWER IN sewage0.111111
sewage0.111111
LOWER IN treated wastewater0.111111
LOWER IN influent0.105263
influent0.105263
tap water0.105263
LOWER IN tap water0.105263
LOWER IN effluent0.100000
river0.100000
autumn0.095238
sewer0.095238
LOWER IN sewer0.095238
israel0.095238
city0.083333
drinking water0.083333
LOWER IN drinking water0.083333
water0.066298
fresh water0.054054
south america0.043478
united states of america0.015686
china0.011364
homo sapiens0.006969
LOWER IN feces0.006061
feces0.006061
Fraction of dbbact annotations with this term covered by the query
TermScore
wastewater treatment plant1.000000
spring1.000000
effluent0.750000
low income0.500000
LOWER IN sewage0.500000
sewage0.500000
treated wastewater0.500000
bioreactor0.500000
LOWER IN treated wastewater0.500000
LOWER IN wastewater treatment plant0.400000
LOWER IN influent0.333333
influent0.333333
tap water0.333333
LOWER IN tap water0.333333
LOWER IN effluent0.250000
sewer0.200000
LOWER IN sewer0.200000
state of minnesota0.125000
drinking water0.125000
LOWER IN drinking water0.125000
river0.083333
autumn0.076923
israel0.058824
city0.050000
water0.036364
fresh water0.034483
south america0.023810
united states of america0.008097
china0.005814
homo sapiens0.003690
LOWER IN feces0.003185
feces0.003185
Fraction of annotations for the query sequences containing the term
TermScore
wastewater treatment plant0.875000
effluent0.437500
water0.375000
city0.250000
south america0.250000
china0.250000
israel0.250000
united states of america0.250000
treated wastewater0.187500
low income0.125000
LOWER IN wastewater treatment plant0.125000
spring0.125000
autumn0.125000
bioreactor0.125000
state of minnesota0.125000
river0.125000
fresh water0.125000
sewer0.062500
LOWER IN feces0.062500
feces0.062500
homo sapiens0.062500
LOWER IN sewer0.062500
LOWER IN sewage0.062500
LOWER IN influent0.062500
sewage0.062500
influent0.062500
LOWER IN effluent0.062500
drinking water0.062500
tap water0.062500
LOWER IN treated wastewater0.062500
LOWER IN drinking water0.062500
LOWER IN tap water0.062500
Exp. ID User ID Description Date Region Flag Sequences
907amnondominant united states of america, wastewater treatment plant, bioreactor, state of minnesota2022-05-19v4No1 / 1
662amnondominant water, wastewater treatment plant, israel, treated wastewater2020-09-20v3No1 / 6
160amnonhigh freq. in wastewater treatment plant effluent in spring in china (dominant wastewater treatment plant, effluent, china, spring)2017-07-12v4No1 / 15
200amnonhighfreq. in river downstream of wastewater treatment plant (dominant united states of america, river, water, fresh water, wastewater treatment plant, effluent)2017-10-01v4No1 / 15
160amnonhigh freq. in wastewater treatment plant effluent in autumn in china (dominant wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 20
662amnon high in drinking water tap water compared to wastewater treatment plant treated wastewater in water israel 2020-09-20v3No1 / 89
53amnonhigher in sewer and wastewater influent comapred to feces in low income south america ( high in wastewater treatment plant sewer compared to feces in city south america low income )2017-01-21v4No1 / 148
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to wastewater treatment plant sewer in city south america low income )2017-01-21v4No1 / 187
907amnoncommon united states of america, wastewater treatment plant, bioreactor, state of minnesota2022-05-19v4No1 / 279
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
160amnoncommon in wastewater treatment plant effluent in autumn in china (common wastewater treatment plant, effluent, autumn, china)2017-07-12v4No1 / 469
662amnoncommon water, wastewater treatment plant, israel, treated wastewater2020-09-20v3No1 / 473
662amnon high in wastewater treatment plant treated wastewater compared to drinking water tap water in water israel 2020-09-20v3No1 / 565
160amnoncommon in wastewater treatment plant effluent in spring in china (common wastewater treatment plant, effluent, china, spring)2017-07-12v4No1 / 573
200amnoncommon in river downstream of wastewater treatment plant (common united states of america, river, water, fresh water, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
53amnonhigher in wastewater plant effluent compared to influent and sewer in south america ( high in effluent compared to sewage influent in city wastewater treatment plant south america )2017-01-21v4No1 / 657

Problems / suggestions? Please email info AT dbbact DOT org