Summary for ontology term: water

Number of annotations with term: 331

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAAGGTCCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTATTAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGATTCACTAGAGTACGATAGAGGGAGGTAGAATTCACAG0.009539
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAAGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAAGCCCTGGGCTCAACCTAGGAACTGCATCCAAAACTAACTCACTAGAGTACGATAGAGGGAGGTAGAATTCATAG0.009539
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__Rhodobacteraceae;g__LoktanellaTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATTGGAAAGTTGGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTCCAAAACTATCAGTCTAGAGTTCGAGAGAGGTGAGTGGAATTCCAAG0.009539
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;f__SAR11;g__Candidatus PelagibacterTACGAAGGGACCTAGCGTAGTTCGGAATTACTGGGCTTAAAGAGTTCGTAGGTGGTTGAAAAAGTTAGTGGTGAAATCCCAGAGCTTAACTCTGGAACTGCCATTAAAACTTTTCAGCTAGAGTATGATAGAGGAAAGCAGAATTTCTAG0.009539
d__BacteriaTACGAAGGGGGCGAGCGTTATTCGGAATTATTGGGCGTAAAGGGCTCGCAGGCTGCTTGAACAGTTAGACGTGAAATCCCCGGGCTCAACCTGGGAACTGCGTTTAATACTAGCAAGCTAGAGAAATAGAGAGGAAAGTGGAACTCCCAG0.009539
d__Bacteria;p__"Proteobacteria";c__AlphaproteobacteriaTACGGAGGGGGCTAACGTTGTTCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGATTAGACAGTTGAGGGTGAAATCCCGGAGCTTAACTCCGGAACTGCCTTCAATACTACTAATCTTGAGTTCGGAAGAGGTGAGTGGAATTCCTAG0.009539
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGTAGGCGGTTTATTAAGTCAGATGTGAAAGCCCCGGGCTTAACCTGGGAACTGCATTTGAAACTGGTAAACTAGAGTATGGTAGAGGAAAGTGGAATTTCTGG0.009539
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__CryptomonadaceaeTACAGAGGATGCAAGCGTTATCCGGAATCACTGGGCATAAAGCGTCTGTAGGTTGTTTAGTAAGTCTGCTGTTAAAGACTGGGGCTCAACCCCAGAAAAGCAGTGGAAACTGCTAGACTTGAGTGTGGTAGAGGTAGAGGGAATTCCTAG0.009539
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;f__SAR11;g__Candidatus PelagibacterTACGAAGGGACCTAGCGTAGTTCGGAATTACTGGGCTTAAAGAGTTCGTAGGTGGTTGAAAAAGTTGGTGGTGAAATCCCAGAGCTTAACTCTGGAACTGCCATCAAAACTTTTCAGCTAGAGTATGATAGAGGAAAGCAGAATTTCTAG0.007949
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__BurkholderialesTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTATATAAGACAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTTGTGACTGTATAGCTAGAGTACGGTAGAGGGGGATGGAATTCCGCG0.007949

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATCGGAAAGTTGGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTCCAAAACTATCGGTCTAGAGTTCGAGAGAGGTGAGTGGAATTCCGAG0.142857
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Burkholderiaceae;g__RalstoniaTACGTAGGGTCCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTGTGCAAGACCGATGTGAAATCCCCGAGCTTAACTTGGGAATTGCATTGGTGACTGCACGGCTAGAGTGTGTCAGAGGGGGGTAGAATTCCACG0.142857
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATTAGTCAGTTAGAGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTTAATACTGCTAGTCTTGAGTTCGAGAGAGGTGAGTGGAATTCCGAG0.114286
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGATTGGAAAGTTGGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTCCAAAACTATCAGTCTAGAGGTCGAGAGAGGTGAGTGGAATTCCGAG0.114286
d__BacteriaAACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGCGTAAAGCGCGTGCAGGCGGCTTAGTAGGTTGGACGTGAAAGCTCCTGGCTCAACTGGGAGAGGCCGTTCAATACCGCTAGGCTCGAGGGCGGAAGAGGGGAGTGGAATTCCCGG0.114286
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp17;g__Gp17GACAGAGGTGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGCAGGCGGTTCGTCAAGTCCCGTGTGAAATCCCCCGGCTCAACTGGGGAACTGCGCGGGAAACTAGCGGGCTTGAGTTCGGGAGAGGAAAGCGGAATTCCGGG0.114286
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGAAGGGGGCTAGCGTTGTTCGGAATCACTGGGCGTAAAGCGCACGTAGGCGGACTGATCAGTTGGGGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTCAATACTGTCAGTCTTGAGTCCGAGAGAGGTGAGTGGAATTCCTAG0.114286
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCTCGTAGGCGGTTTGTTAAGTCGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATTCGATACTGGCAGACTAGAGTATAGTAGAGGCAAGTGGAATTCCGGG0.114286
d__Bacteria;p__"Actinobacteria";c__ActinobacteriaTACGTAGGGACCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTCGGTAAGTCGGGTGTGAAAATCCAGGGCTCAACCCTGGGACGCCACCCGATACTGCTGTGACTAGAGTCCGGTAGAGGAGCGTGGAATTCCTG0.114286
d__BacteriaTACGTAGGGGCCAAGCGTTGTCCGGATTTATTGGGCGTAAAGGGCTCGTAGGCGGTTTAGTAAGTCAATCGTGAAATGTCGGGGCTCAACCCCGAGACTGCGGTCGAAACTGCTATGACTAGGGTCCGGTAGAGGTGAGTGGAATTCTCG0.114286

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGTACGTAGGCGGATTAATAAGTTAGAGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTTAAAACTGTTAGTCTTGAGATCGAGAGAGGTGAGTGGAATTCCAAG0.164159
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACGGAAGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAAGCCCTGGGCTCAACCTAGGAACTGCATCCAAAACTAACTCACTAGAGTACGATAGAGGGAGGTAGAATTCATAG0.154047
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;f__SAR11;g__Candidatus PelagibacterTACGAAGGGACCTAGCGTAGTTCGGAATTACTGGGCTTAAAGAGTTCGTAGGTGGTTGAAAAAGTTAGTGGTGAAATCCCAGAGCTTAACTCTGGAACTGCCATTAAAACTTTTCAGCTAGAGTATGATAGAGGAAAGCAGAATTTCTAG0.150649
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;f__SAR11;g__Candidatus PelagibacterTACGAAGGGACCTAGCGTAGTTCGGAATTACTGGGCTTAAAGAGTTCGTAGGTGGTTGAAAAAGTTGGTGGTGAAATCCCAGAGCTTAACTCTGGAACTGCCATCAAAACTTTTCAGCTAGAGTATGATAGAGGAAAGCAGAATTTCTAG0.141753
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__BurkholderialesTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTATATAAGACAGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTTGTGACTGTATAGCTAGAGTACGGTAGAGGGGGATGGAATTCCGCG0.141753
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__RhodobacteraceaeTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATTAGTAAGTTAGAGGTGAAATCCCAGGGCTCAACCCTGGAACTGCCTTTAATACTGCTAGTCTTGAGTTCGAGAGAGGTAAGTGGAATTCCGAG0.141113
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhodobacterales;f__Rhodobacteraceae;g__LoktanellaTACGGAGGGGGTTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGATTGGAAAGTTGGGGGTGAAATCCCGGGGCTCAACCCCGGAACTGCCTCCAAAACTATCAGTCTAGAGTTCGAGAGAGGTGAGTGGAATTCCAAG0.137063
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Methylophilales;f__Methylophilaceae;g__MethylophilusTACGTAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGTCAGATGTGAAATCCCCGAGCTCAACTTGGGAACTGCGTTTGAAACTACAAGACTAGAATATGTCAGAGGGGGGTAGAATTCCACG0.135638
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;f__SAR11;g__Candidatus PelagibacterTACGAAGGGACCTAGCGTAGTTCGGAATTACTGGGCTTAAAGAGCTCGTAGGTGGTTAAAAAAGTTGATGGTGAAATCCCAAGGCTCAACCTTGGAACTGCCATCAAAACTTTTTAGCTAGAGTGTGATAGAGGTAAGTGGAATTTCTAG0.135135
d__BacteriaTACATAGGGGTCAAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGTTCAACAAGTCGGTCGTAAAAGTTTAGGGCTCAACCCTAAAATGTCGATCGATACTGTTGTGACTAGGATACGGTAGAGGTGAATGGAATTCCGA0.133705

Annotations:

common ontology terms
term enrichment score
TermScore
water0.964944
fresh water0.417597
sea water0.390424
drinking water0.312655
pacific ocean0.260983
river0.236145
state of california0.197821
lake0.170291
surface water0.152345
monterey bay0.150134
united states of america0.130452
depth (water) 1m0.117333
saline water0.115301
lake water0.111836
biofilm0.110345
free floating0.105702
filtered 2.7um0.090823
freshwater lake0.084270
LOWER IN water0.083147
particle bound0.080076
depth (water) 10cm0.077994
filtered 0.2um0.077994
mississippi river0.072351
canada0.065173
depth (soil) 50cm0.062323
beach0.062323
state of florida0.061269
china0.057906
french republic0.057831
mediterranean sea0.056980
spring water0.056980
depth (water) 20-100cm0.054895
tap water0.052250
jiulong river0.051576
fujian province0.050279
scotland0.049875
kingdom of the netherlands0.048662
brazil0.046948
high temperature environment0.046829
koshi river0.046110
philippine sea0.046110
river amazon0.046110
lago grande do curuai0.046110
nepal0.045070
sand0.044568
atlantic ocean0.043860
LOWER IN summer0.043313
summer0.043313
marine sediment0.042516
pond water0.041207
depth (water) 0-100cm0.040996
downstream0.040580
upstream0.040580
particles0.039773
state of minnesota0.038929
autumn0.038745
sediment0.036978
LOWER IN sea water0.035533
depth (water) 300m0.035294
geothermal field0.035294
site e0.035294
site d0.035294
site b0.035294
site c0.035294
site a0.035294
depth (water) 150m0.034985
lower mississippi river0.034985
commune of paris0.034985
coastal water0.034985
romania0.034985
ursu lake0.034985
estuary water0.034985
bilbao0.034985
guinea0.034985
depth (water) 3m0.034985
lake erie0.034985
hydrothermal vent0.034985
volcanic crater0.034985
volcanic rock0.034985
marine hydrothermal vent0.034985
greece0.034985
cairo0.034985
river nile0.034985
depth (water) 50cm0.034985
saanich inlet0.034985
algae production system0.034985
biofilter0.034384
bioreactor0.034384
state of wisconsin0.033803
estuary0.033803
san diego0.033803
fish farm0.033241
LOWER IN fresh water0.032698
egypt0.032698
winter0.032520
state of illinois0.031662
commonwealth of massachusetts0.031169
state of colorado0.031169
depth (water) 100m0.029542
stream0.029340
Fraction of dbbact annotations with this term covered by the query
TermScore
water0.981818
drinking water0.875000
pond water0.800000
filtered 2.7um0.750000
particle bound0.750000
LOWER IN depth (water) 0cm0.750000
high temperature environment0.750000
lake water0.750000
free floating0.666667
tap water0.666667
depth (water) 300m0.666667
LOWER IN depth (water) 300m0.666667
depth (water) 0-100cm0.666667
depth (water) 10m0.666667
depth (water) 40m0.666667
LOWER IN water pipe0.666667
water pipe0.666667
hot spring0.666667
geothermal field0.666667
monterey bay0.666667
depth (water) 100m0.666667
site e0.666667
site d0.666667
site b0.666667
site c0.666667
site a0.666667
fresh water0.600000
freshwater lake0.600000
river0.583333
surface water0.583333
lake0.583333
rana luteiventris0.500000
columbia spotted frog0.500000
sea water0.500000
haliotis sorenseni0.500000
white abalone0.500000
tributary0.500000
depth (water) 10cm0.500000
koshi river0.500000
filtered 0.2um0.500000
red abalone0.500000
haliotis rufescens0.500000
treated wastewater0.500000
LOWER IN treated wastewater0.500000
LOWER IN quasipaa spinosa0.500000
LOWER IN giant spiny frog0.500000
quasipaa spinosa0.500000
giant spiny frog0.500000
depth (water) 75m0.500000
depth (water) 150m0.500000
LOWER IN depth (water) 75m0.500000
LOWER IN depth (water) 150m0.500000
south florida0.500000
depth (water) 0cm0.500000
LOWER IN shark0.500000
shark0.500000
photic zone0.500000
high turbidity0.500000
turbidity0.500000
LOWER IN low turbidity0.500000
low turbidity0.500000
LOWER IN high turbidity0.500000
phosphorus0.500000
high phosporus0.500000
LOWER IN low phosphorus0.500000
low phosphorus0.500000
LOWER IN high phosphorus0.500000
depth (soil) 50cm0.500000
andrias japonicus0.500000
japanese giant salamander0.500000
LOWER IN stagnant water0.500000
stagnant water0.500000
LOWER IN deposits0.500000
deposits0.500000
philippine sea0.500000
LOWER IN filtered 2.7um0.500000
depth (water) 1m0.500000
LOWER IN free floating0.500000
downstream0.500000
lower mississippi river0.500000
LOWER IN upstream0.500000
LOWER IN higher mississippi river0.500000
upstream0.500000
LOWER IN downstream0.500000
LOWER IN lower mississippi river0.500000
uppper mississippi river0.500000
temp 60c0.500000
LOWER IN temp 40c0.500000
temp 40c0.500000
LOWER IN temp 60c0.500000
yellowstone national park0.500000
drinking water reservoir0.500000
water distribution network0.500000
LOWER IN water reservoir0.500000
commune of paris0.500000
water reservoir0.500000
LOWER IN water distribution network0.500000
LOWER IN middle0.500000
LOWER IN bottom0.500000
middle0.500000
Fraction of annotations for the query sequences containing the term
TermScore
water0.948640
united states of america0.419940
sea water0.320242
fresh water0.320242
pacific ocean0.226586
drinking water0.190332
state of california0.178248
river0.148036
saline water0.111782
lake0.099698
china0.087613
surface water0.087613
monterey bay0.084592
biofilm0.072508
depth (water) 1m0.066465
lake water0.060423
free floating0.057402
LOWER IN water0.051360
filtered 2.7um0.048338
canada0.048338
freshwater lake0.045317
depth (water) 10cm0.042296
particle bound0.042296
filtered 0.2um0.042296
state of florida0.042296
mississippi river0.042296
french republic0.036254
depth (soil) 50cm0.033233
beach0.033233
atlantic ocean0.030211
depth (water) 20-100cm0.030211
kingdom of the netherlands0.030211
mediterranean sea0.030211
brazil0.030211
spring water0.030211
scotland0.030211
tap water0.027190
fujian province0.027190
jiulong river0.027190
research facility0.024169
nepal0.024169
koshi river0.024169
LOWER IN summer0.024169
summer0.024169
philippine sea0.024169
high temperature environment0.024169
sand0.024169
marine sediment0.024169
river amazon0.024169
lago grande do curuai0.024169
state of minnesota0.024169
autumn0.021148
LOWER IN sea water0.021148
depth (water) 0-100cm0.021148
pond water0.021148
particles0.021148
downstream0.021148
upstream0.021148
sediment0.021148
israel0.018127
LOWER IN fresh water0.018127
depth (water) 300m0.018127
depth (water) 150m0.018127
stream0.018127
state of illinois0.018127
lower mississippi river0.018127
geothermal field0.018127
commune of paris0.018127
fish farm0.018127
biofilter0.018127
state of wisconsin0.018127
coastal water0.018127
commonwealth of massachusetts0.018127
romania0.018127
ursu lake0.018127
estuary0.018127
kingdom of spain0.018127
estuary water0.018127
bilbao0.018127
guinea0.018127
depth (water) 3m0.018127
lake erie0.018127
hydrothermal vent0.018127
volcanic crater0.018127
volcanic rock0.018127
marine hydrothermal vent0.018127
greece0.018127
egypt0.018127
cairo0.018127
river nile0.018127
winter0.018127
depth (water) 50cm0.018127
saanich inlet0.018127
site e0.018127
site d0.018127
site b0.018127
site c0.018127
site a0.018127
san diego0.018127
bioreactor0.018127
Exp. ID User ID Description Date Region Flag Sequences
198amnon high in water compared to sediment in united states of america geothermal field yellowstone national park high temperature environment 2017-09-14v4No1 / 2
265amnondominant water, canada, province of quebec, soilwater2017-12-11v4No1 / 2
110amnondominant water, drinking water, scotland, site c2017-04-08v4No1 / 2
110amnondominant water, drinking water, scotland, site b2017-04-08v4No1 / 2
338amnon high in water pond water compared to skin in andrias japonicus japanese giant salamander japan 2018-05-21v4No1 / 3
691amnon high in water pipe water distribution network compared to water reservoir in water drinking water french republic commune of paris 2028-03-11v3No1 / 3
204amnondominant drinking water reservoir, sediment, water, china2017-10-02v4No1 / 4
483amnondominant united states of america, water, sea water, hawaii, pearl harbor, depth 1-2m2019-02-13v4No1 / 4
733amnon high in lake compared to aquatic/terrestrial transition zone in water fresh water brazil depth (water) 1m filtered 2.7um particle bound lake water river amazon lago grande do curuai 2021-01-17v3No1 / 4
110amnondominant water, drinking water, scotland, site a2017-04-08v4No1 / 4
662amnondominant water, wastewater treatment plant, israel, treated wastewater2020-09-20v3No1 / 6
612amnondominant united states of america, water, fresh water, state of florida, spring water, location 12020-04-22v4No1 / 6
110amnondominant water, drinking water, scotland, site d2017-04-08v4No1 / 6
110amnondominant water, drinking water, scotland, site e2017-04-08v4No1 / 6
338amnon high in skin compared to water pond water in andrias japonicus japanese giant salamander japan 2018-05-21v4No1 / 7
691amnon high in water reservoir compared to water pipe water distribution network in water drinking water french republic commune of paris 2028-03-11v3No1 / 7
305amnonhigh freq. in low volume algae production photobioreactor (dominant united states of america, water, bioreactor, state of colorado, algae production system)2018-03-12v4No1 / 7
305amnonhigh freq. in medium volume algae production photobioreactor (dominant united states of america, water, bioreactor, state of colorado, algae production system)2018-03-12v4No1 / 7
305amnonhigh freq. in large volume algae production photobioreactor (dominant united states of america, water, bioreactor, state of colorado, algae production system)2018-03-12v4No1 / 7
235amnoncommon in ocean water above eelgrass from various northern hemisphere sites (common water, sea water)2017-11-07v4No1 / 8
733amnon high in aquatic/terrestrial transition zone compared to lake in water fresh water brazil depth (water) 1m filtered 2.7um particle bound lake water river amazon lago grande do curuai 2021-01-17v3No1 / 8
341amnonhigh freq. in week old water (dominant united states of america, water, drinking water, tap water, state of illinois)2018-05-28v4No1 / 9
235amnonhigh freq. in ocean water above eelgrass from various northern hemisphere sites (dominant water, sea water)2017-11-07v4No1 / 9
647amnon high in skin frog rana luteiventris columbia spotted frog compared to lake water freshwater lake in united states of america state of montana 2020-09-06v4No1 / 10
534amnondominant river, water, fresh water, nepal, free floating, depth (water) 10cm, filtered 0.2um, koshi river2019-07-22v4No1 / 10
170amnonlower in low phosphorus river water ( high in phosphorus high phosporus compared to low phosphorus in united states of america river stream water fresh water depth (water) 10cm )2017-07-24v4No1 / 10
443amnondominant united states of america, river, water, fresh water, mississippi river, particles, upstream, depth (water) 1m, filtered 2.7um, uppper mississippi river2019-01-07v4No1 / 10
481amnondominant united states of america, fishpond, research facility, water, fresh water, pond water, state of alabama2019-02-12v4No1 / 10
642amnoncommon water, saline water, surface water, sea water, pacific ocean, san diego2020-08-28v4No1 / 10
169amnon high in autumn spring compared to summer in lake photic zone water fresh water canada depth (water) 0-100cm depth (water) 20-100cm 2017-07-24v4No1 / 11
478amnondominant farm, water, saline water, shrimp farm, china2019-02-19v4No1 / 11
496amnondominant water, sea water, pacific ocean, canada, saanich inlet, depth (water) 200m2019-03-03v4No1 / 11
323amnondominant united states of america, water, surface water, sea water, atlantic ocean, state of florida, south florida, depth (soil) 0-20cm, depth (water) 0cm2018-04-24v4No1 / 12
691amnondominant water, drinking water, french republic, commune of paris2028-03-11v3No1 / 12
510amnondominant estuary, water, saline water, kingdom of spain, estuary water, salinity >20 ppt, bilbao2019-03-20v4No1 / 12
362amnondominant hydrothermal vent, volcanic crater, water, volcanic rock, marine sediment, sea water, marine hydrothermal vent, mediterranean sea, greece, inactive vent2018-08-29v4No1 / 12
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 500m2019-01-16v4No1 / 12
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 80m2019-01-16v4No1 / 12
109amnondominant united states of america, water, drinking water, site c2017-04-08v4No1 / 12
647amnondominant united states of america, lake, water, state of montana, freshwater lake2020-09-06v4No1 / 12
534amnondominant river, tributary, water, fresh water, nepal, free floating, depth (water) 10cm, filtered 0.2um, koshi river2019-07-22v4No1 / 13
315amnonhigh freq. in frog pond water (dominant pond, water, fresh water, jiangxi province, hunan province, china)2018-04-10v4No1 / 13
160amnonhigh freq. in river water upstream of WTP effluent in spring in china (dominant river, water, china, spring)2017-07-12v4No1 / 13
557amnondominant lake, freshwater lake, water, fresh water, french republic, depth (water) 10m2019-09-14v3No1 / 13
198amnon high in sediment compared to water in united states of america geothermal field yellowstone national park high temperature environment 2017-09-14v4No1 / 13
459amnonhigh freq. in surface in aquaculture biofilter sand (dominant united states of america, surface, fish farm, water, fresh water, sand, biofilter, state of wisconsin)2019-01-12v4No1 / 13
461amnondominant united states of america, water, surface water, sea water, coastal water, atlantic ocean, commonwealth of massachusetts2019-01-12v4No1 / 13
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 100m2019-01-16v4No1 / 13
110amnoncommon water, drinking water, scotland, site c2017-04-08v4No1 / 13
642amnondominant water, saline water, surface water, sea water, pacific ocean, san diego2020-08-28v4No1 / 13
169amnon high in summer autumn compared to spring in lake photic zone water fresh water canada depth (water) 0-100cm depth (water) 20-100cm 2017-07-24v4No1 / 14
170amnondominant united states of america, river, stream, water, fresh water, depth (water) 10cm2017-07-24v4No1 / 14
178amnonhigh freq. in drinking water pipe loose deposits (dominant water, drinking water, kingdom of the netherlands, deposits)2017-08-10v4No1 / 14
342amnondominant water, surface water, sea water, pacific ocean, philippine sea2018-05-28v4No1 / 14
366amnondominant river, water, fresh water, egypt, cairo, river nile, winter, dry season, depth (water) 50cm2018-08-31v4No1 / 14
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 200m2019-01-16v4No1 / 14
382amnondominant hot spring, geothermal field, water, ganzi tibetan autonomous prefecture, high temperature environment, china2018-10-22v4No1 / 14
508amnondominant united states of america, lake, water, fresh water, state of minnesota, mcquade lake, lake water2019-03-17v4No1 / 14
308amnonhigh freq. in water of aquarium with red abalone (dominant united states of america, research facility, water, sea water, aquarium, state of california, red abalone, haliotis rufescens)2018-03-30v4No1 / 15
169amnon high in spring compared to summer in lake photic zone water fresh water canada depth (water) 0-100cm depth (water) 20-100cm 2017-07-24v4No1 / 15
341amnonlower in fresh drinking water compared to week old water ( high in stagnant water compared to fresh water in united states of america water drinking water tap water state of illinois )2018-05-28v4No1 / 15
341amnondominant united states of america, water, fresh water, drinking water, tap water, state of illinois2018-05-28v4No1 / 15
341amnoncommon in week old water (common united states of america, water, drinking water, tap water, state of illinois)2018-05-28v4No1 / 15
342amnondominant water, sea water, pacific ocean, philippine sea, depth (water) 150m2018-05-28v4No1 / 15
342amnondominant water, sea water, pacific ocean, philippine sea, depth (water) 300m2018-05-28v4No1 / 15
200amnonhighfreq. in river downstream of wastewater treatment plant (dominant united states of america, river, water, fresh water, wastewater treatment plant, effluent)2017-10-01v4No1 / 15
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 60m2019-01-16v4No1 / 15
612amnondominant united states of america, water, fresh water, state of florida, spring water, location 52020-04-22v4No1 / 15
496amnondominant water, sea water, pacific ocean, canada, saanich inlet, depth (water) 100m2019-03-03v4No1 / 15
508amnondominant united states of america, lake, water, fresh water, state of minnesota, lake water, manganika lake, hypereutrophic lake, sulfidic bottom water2019-03-17v4No1 / 15
304amnondominant united states of america, beach, water, sea water, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 15
534amnondominant river, tributary, water, fresh water, nepal, depth (water) 10cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 16
534amnondominant river, water, fresh water, nepal, depth (water) 10cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 16
317amnondominant united states of america, water, sea water, state of california, pacific ocean, depth (water) 300m, depth (water) 75m, depth (water) 150m2018-04-15v4No1 / 16
443amnondominant united states of america, river, water, fresh water, mississippi river, particles, downstream, depth (water) 1m, filtered 2.7um, lower mississippi river2019-01-07v4No1 / 16
198amnondominant united states of america, hot spring, geothermal field, water, yellowstone national park, high temperature environment2017-09-13v4No1 / 16
691amnoncommon water, drinking water, french republic, commune of paris2028-03-11v3No1 / 16
226amnondominant united states of america, lake, freshwater lake, water, fresh water, lake erie2017-10-29v4No1 / 16
590amnoncommon in turtle pond water (dominant farm, water, pond water, china, hainan autonomous prefecture, turtle farm)2020-02-10v4No1 / 16
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 40m2019-01-16v4No1 / 16
612amnondominant united states of america, water, fresh water, state of florida, spring water, location 32020-04-22v4No1 / 16
612amnondominant united states of america, water, fresh water, state of florida, spring water, location 22020-04-22v4No1 / 16
499amnondominant pond, water, fresh water, pond water, brazil2019-03-05v4No1 / 16
505amnondominant water, surface water, sea water, state of california, pacific ocean, particle bound, size 1-80um2019-03-14v4No1 / 16
304amnondominant united states of america, beach, water, sea water, state of california, pacific ocean, santa cruz county2018-03-12v4No1 / 16
662amnondominant water, drinking water, tap water, israel2020-09-20v3No1 / 17
317amnondominant united states of america, water, surface water, sea water, state of california, pacific ocean, depth (water) 5m2018-04-15v4No1 / 17
557amnondominant lake, freshwater lake, water, fresh water, french republic, depth (soil) 50cm2019-09-14v3No1 / 17
443amnondominant united states of america, river, water, fresh water, mississippi river, free floating, upstream, depth (water) 1m, filtered 0.2um, uppper mississippi river2019-01-07v4No1 / 17
196amnonhigh freq. in biofilm in tap water (dominant united states of america, water, biofilm, drinking water, biofilm)2017-09-12v4No1 / 17
366amnondominant river, water, fresh water, egypt, cairo, river nile, summer, wet season, depth (water) 50cm2018-08-31v4No1 / 17
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 30m2019-01-16v4No1 / 17
733amnondominant water, fresh water, brazil, depth (water) 1m, filtered 2.7um, particle bound, lake water, river amazon, lago grande do curuai2021-01-17v3No1 / 17
109amnondominant united states of america, water, drinking water, site a2017-04-08v4No1 / 17
308amnonhigh freq. in aquarium water with white abalone (dominant united states of america, research facility, water, sea water, aquarium, state of california, haliotis sorenseni, white abalone)2018-03-30v4No1 / 18
196amnondominant united states of america, water, drinking water2017-09-12v4No1 / 18
222amnondominant water, sea water, guinea, depth (water) 3m2017-10-26v4No1 / 18
362amnondominant hydrothermal vent, volcanic crater, water, volcanic rock, marine sediment, sea water, marine hydrothermal vent, mediterranean sea, greece, active vent2018-08-29v4No1 / 18
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 5m2019-01-16v4No1 / 18
504amnondominant water, sea water, nan'ao island, china2019-03-14v4No1 / 18
160amnonhigh freq. in river water upstream of WTP effluent in autumn in china (dominant river, water, autumn, china)2017-07-12v4No1 / 19
178amnonhigh freq. in drinking water pipes biofilm (dominant water, biofilm, drinking water, kingdom of the netherlands, water pipe, biofilm)2017-08-10v4No1 / 19
443amnondominant united states of america, river, water, fresh water, mississippi river, free floating, downstream, depth (water) 1m, filtered 0.2um, lower mississippi river2019-01-07v4No1 / 19
588amnonreagent contaminant (contamination)2020-02-10v3No1 / 19
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 20m2019-01-16v4No1 / 19
612amnondominant united states of america, water, fresh water, state of florida, spring water, location 42020-04-22v4No1 / 19
109amnondominant united states of america, water, drinking water, site d2017-04-08v4No1 / 19
577amnondominant lake, water, low salinity, lake water, romania, ursu lake, depth (water) 0-3m, mixolimnion, depth (water) 20-100cm, depth (water) 1-5m2020-01-09v3No1 / 20
510amnondominant estuary, water, fresh water, kingdom of spain, estuary water, salinity <5 ppt, bilbao2019-03-20v4No1 / 20
222amnonhigh freq. on inner biofilm on metal plate in ocean water (dominant water, biofilm, sea water, biofilm material, guinea, depth (water) 3m, metal, biofilm)2017-10-26v4No1 / 20
109amnon high in distribution system compared to water treatment plant in united states of america water drinking water site b 2017-04-08v4No1 / 20
577amnondominant lake, water, high salinity, lake water, hypersaline water, romania, ursu lake, depth (water) 4-9m, monimolimnion2020-01-09v3No1 / 21
236amnondominant ocean, water, sea water, state of california, pacific ocean, bodega bay2017-11-07v4No1 / 21
473amnondominant water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 10m2019-01-16v4No1 / 21
254amnondominant river, water, fresh water, fujian province, depth (soil) 50cm, jiulong river, china2017-11-23v4No1 / 21
733amnondominant water, fresh water, brazil, free floating, depth (water) 1m, filtered 0.2um, lake water, river amazon, lago grande do curuai2021-01-17v3No1 / 21
505amnondominant water, surface water, sea water, state of california, pacific ocean, free floating, size < 1um2019-03-14v4No1 / 21
109amnondominant united states of america, water, drinking water, site e2017-04-08v4No1 / 21
110amnoncommon water, drinking water, scotland, site b2017-04-08v4No1 / 21
304amnondominant united states of america, beach, water, sea water, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 21
557amnondominant lake, freshwater lake, water, fresh water, french republic, depth (water) 40m2019-09-14v3No1 / 22
110amnoncommon water, drinking water, scotland, site a2017-04-08v4No1 / 22
169amnondominant lake, photic zone, water, fresh water, canada, depth (water) 0-100cm, depth (water) 20-100cm2017-07-24v4No1 / 23
485amnondominant coast, water, saline water, surface water, sea water, mediterranean sea, italy, gulf of naples, depth (water) 0-100cm, depth (water) 20-100cm2019-02-19v4No1 / 23
109amnondominant united states of america, water, drinking water, site b2017-04-08v4No1 / 23
459amnonhigh freq. in middle, bottom in aquaculture biofilter sand (dominant united states of america, fish farm, water, fresh water, sand, biofilter, state of wisconsin, middle, bottom)2019-01-12v4No1 / 24
222amnonhig hfreq. on outer biofilm on metal plate in ocean water (dominant water, biofilm, sea water, biofilm material, guinea, depth (water) 3m, metal, outer biofilm, biofilm)2017-10-26v4No1 / 24
178amnondominant water, drinking water, kingdom of the netherlands2017-08-10v4No1 / 25
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site b 2017-04-08v4No1 / 30
109amnoncommon united states of america, water, drinking water, site b2017-04-08v4No1 / 31
305amnoncommon in low volume algae production photobioreactor (common united states of america, water, bioreactor, state of colorado, algae production system)2018-03-12v4No1 / 31
196amnonhigher in heated tap water 60C compared to 40C ( high in temp 60c high temperature environment compared to control temp 40c in united states of america water drinking water )2017-09-12v4No1 / 36
110amnoncommon water, drinking water, scotland, site d2017-04-08v4No1 / 36
362amnon high in active vent compared to inactive vent in hydrothermal vent volcanic crater water volcanic rock marine sediment sea water marine hydrothermal vent mediterranean sea greece 2018-08-29v4No1 / 37
691amnon high in summer compared to spring in water drinking water french republic commune of paris 2028-03-11v3No1 / 39
647amnoncommon united states of america, lake, water, state of montana, freshwater lake2020-09-06v4No1 / 41
109amnon high in distribution system compared to water treatment plant in united states of america water drinking water site a 2017-04-08v4No1 / 41
305amnoncommon in medium volume algae production photobioreactor (common united states of america, water, bioreactor, state of colorado, algae production system)2018-03-12v4No1 / 41
110amnoncommon water, drinking water, scotland, site e2017-04-08v4No1 / 44
733amnon high in free floating filtered 0.2um compared to filtered 2.7um particle bound in water fresh water brazil depth (water) 1m lake water river amazon lago grande do curuai 2021-01-17v3No1 / 46
109amnon high in distribution system compared to water treatment plant in united states of america water drinking water site d 2017-04-08v4No1 / 46
254amnon high in winter autumn dry season compared to summer wet season in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 47
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site a 2017-04-08v4No1 / 48
196amnonlower in biofilms in water at 60C compared to 40C ( high in control temp 40c compared to temp 60c high temperature environment in united states of america water biofilm drinking water biofilm )2017-09-12v4No1 / 51
196amnonlower in heated tap water 60C compared to 40C ( high in control temp 40c compared to temp 60c high temperature environment in united states of america water drinking water )2017-09-12v4No1 / 54
109amnoncommon united states of america, water, drinking water, site a2017-04-08v4No1 / 54
642amnon high in water saline water sea water compared to sediment marine sediment in pacific ocean san diego 2020-08-28v4No1 / 56
366amnon high in winter dry season compared to summer wet season in river water fresh water egypt cairo river nile depth (water) 50cm 2018-08-31v4No1 / 58
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site e 2017-04-08v4No1 / 58
178amnonhigher in drinking water compared to loose deposits in water pipes ( high in drinking water compared to deposits in water kingdom of the netherlands )2017-08-10v4No1 / 61
317amnoncommon united states of america, water, surface water, sea water, state of california, pacific ocean, depth (water) 5m2018-04-15v4No1 / 62
196amnonhigher in biofilms in water at 60C compared to 40C ( high in temp 60c high temperature environment compared to control temp 40c in united states of america water biofilm drinking water biofilm )2017-09-12v4No1 / 62
341amnoncommon united states of america, water, fresh water, drinking water, tap water, state of illinois2018-05-28v4No1 / 66
109amnoncommon united states of america, water, drinking water, site d2017-04-08v4No1 / 67
642amnon high in skin scomber japonicus chub mackerel compared to water saline water sea water in pacific ocean san diego 2020-08-28v4No1 / 67
170amnonhigher in high turbidity river water ( high in high turbidity turbidity compared to low turbidity in united states of america river stream water fresh water depth (water) 10cm )2017-07-24v4No1 / 69
483amnoncommon united states of america, water, sea water, hawaii, pearl harbor, depth 1-2m2019-02-13v4No1 / 72
170amnonhigher in low phosphorus river water ( high in phosphorus low phosphorus compared to high phosphorus in united states of america river stream water fresh water depth (water) 10cm )2017-07-24v4No1 / 76
304amnonlower in seawater compared sea spray aerosol ( high in air aerosol compared to water sea water in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 77
534amnoncommon river, tributary, water, fresh water, nepal, free floating, depth (water) 10cm, filtered 0.2um, koshi river2019-07-22v4No1 / 80
109amnoncommon united states of america, water, drinking water, site e2017-04-08v4No1 / 80
178amnonlower in drinking water compared to water pipe biofilm ( high in biofilm water pipe biofilm compared to drinking water in water kingdom of the netherlands )2017-08-10v4No1 / 81
109amnon high in distribution system compared to water treatment plant in united states of america water drinking water site c 2017-04-08v4No1 / 81
733amnon high in filtered 2.7um particle bound compared to free floating filtered 0.2um in water fresh water brazil depth (water) 1m lake water river amazon lago grande do curuai 2021-01-17v3No1 / 82
305amnoncommon in large volume algae production photobioreactor (common united states of america, water, bioreactor, state of colorado, algae production system)2018-03-12v4No1 / 83
496amnon high in depth (water) 200m compared to depth (water) 100m in water sea water pacific ocean canada saanich inlet 2019-03-03v4No1 / 84
109amnoncommon united states of america, water, drinking water, site c2017-04-08v4No1 / 86
662amnoncommon water, drinking water, tap water, israel2020-09-20v3No1 / 89
662amnon high in drinking water tap water compared to wastewater treatment plant treated wastewater in water israel 2020-09-20v3No1 / 89
459amnonlower in surface compared to middle and bottom in aquaculture biofilter sand ( high in middle bottom compared to surface in united states of america fish farm water fresh water sand biofilter state of wisconsin )2019-01-12v4No1 / 89
382amnoncommon hot spring, geothermal field, water, ganzi tibetan autonomous prefecture, high temperature environment, china2018-10-22v4No1 / 89
178amnoncommon in drinking water pipes biofilm (common water, biofilm, drinking water, kingdom of the netherlands, water pipe, biofilm)2017-08-10v4No1 / 91
508amnon high in lake water fresh water lake water compared to lake sediment sediment in united states of america state of minnesota manganika lake hypereutrophic lake sulfidic bottom water 2019-03-17v4No1 / 91
557amnoncommon lake, freshwater lake, water, fresh water, french republic, depth (soil) 50cm2019-09-14v3No1 / 94
505amnon high in early time points compared to late time points in water surface water sea water state of california pacific ocean free floating size < 1um 2019-03-16v4No1 / 96
196amnonlower in water compared to biofilm ( high in biofilm biofilm compared to water in united states of america drinking water )2017-09-12v4No1 / 100
317amnoncommon united states of america, water, sea water, state of california, pacific ocean, depth (water) 300m, depth (water) 75m, depth (water) 150m2018-04-15v4No1 / 101
198amnoncommon united states of america, hot spring, geothermal field, water, yellowstone national park, high temperature environment2017-09-13v4No1 / 103
642amnon high in water saline water sea water compared to skin scomber japonicus chub mackerel in pacific ocean san diego 2020-08-28v4No1 / 103
226amnonlower in offshore station compared to near shore station ( high in near shore compared to offshore in united states of america lake freshwater lake water fresh water lake erie )2017-10-29v4No1 / 106
323amnonhigher in sharks compared to sea water ( high in shark compared to water surface water sea water depth (water) 0cm in united states of america atlantic ocean state of florida south florida )2018-04-24v4No1 / 107
461amnonearly colonizers in chitin beads incubated in ocean water (other united states of america, water, surface water, sea water, coastal water, atlantic ocean, commonwealth of massachusetts, chitin beads, middle timepoints)2019-01-12v4No1 / 108
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site d 2017-04-08v4No1 / 111
500amnonincreases when incubating water sample from depth 2100m at depth 0m for one year ( high in late time points depth (water) 0cm compared to early time points in water sea water mediterranean sea depth (water) 2000-3000m depth (water) 2000-5000m )2019-03-05v4No1 / 114
691amnon high in spring compared to summer in water drinking water french republic commune of paris 2028-03-11v3No1 / 115
222amnoncommon water, sea water, guinea, depth (water) 3m2017-10-26v4No1 / 115
481amnonhigher in channel catfish intestine compared to the growing pond water ( high in intestine ictalurus punctatus fish channel catfish compared to pond water fresh water in united states of america research facility state of alabama )2019-02-12v4No1 / 118
315amnonlower in frog pond water compared to frog gut ( high in frog quasipaa spinosa giant spiny frog compared to water fresh water in jiangxi province hunan province china )2018-04-10v4No1 / 119
461amnonlate colonizers in chitin beads incubated in ocean water (other united states of america, water, surface water, sea water, coastal water, atlantic ocean, commonwealth of massachusetts, late timepoints, chitin beads)2019-01-12v4No1 / 120
196amnoncommon in biofilm in tap water (common united states of america, water, biofilm, drinking water, biofilm)2017-09-12v4No1 / 121
557amnoncommon lake, freshwater lake, water, fresh water, french republic, depth (water) 10m2019-09-14v3No1 / 123
178amnonhigher in drinking water compared to water pipe biofilm ( high in drinking water compared to biofilm water pipe biofilm in water kingdom of the netherlands )2017-08-10v4No1 / 123
590amnoncommon in turtle pond water (common farm, water, pond water, china, hainan autonomous prefecture, turtle farm)2020-02-10v4No1 / 127
557amnoncommon lake, freshwater lake, water, fresh water, french republic, depth (water) 40m2019-09-14v3No1 / 129
362amnon high in inactive vent compared to active vent in hydrothermal vent volcanic crater water volcanic rock marine sediment sea water marine hydrothermal vent mediterranean sea greece 2018-08-29v4No1 / 129
577amnoncommon lake, water, low salinity, lake water, romania, ursu lake, depth (water) 0-3m, mixolimnion, depth (water) 20-100cm, depth (water) 1-5m2020-01-09v3No1 / 130
500amnondecreases when incubating water sample from depth 2100m at depth 0m for one year ( high in early time points compared to late time points depth (water) 0cm in water sea water mediterranean sea depth (water) 2000-3000m depth (water) 2000-5000m )2019-03-05v4No1 / 132
461amnonlower in early compared to late timepoints in chitin beads incubated in ocean water ( high in late timepoints compared to early timepoints in united states of america water surface water sea water coastal water atlantic ocean commonwealth of massachusetts chitin beads )2019-01-12v4No1 / 141
109amnon high in distribution system compared to water treatment plant in united states of america water drinking water site e 2017-04-08v4No1 / 143
222amnoncommon on outer biofilm on metal plate in ocean water (common water, biofilm, sea water, biofilm material, guinea, depth (water) 3m, metal, outer biofilm, biofilm)2017-10-26v4No1 / 147
178amnoncommon water, drinking water, kingdom of the netherlands2017-08-10v4No1 / 148
366amnon high in summer wet season compared to winter dry season in river water fresh water egypt cairo river nile depth (water) 50cm 2018-08-31v4No1 / 148
362amnoncommon hydrothermal vent, volcanic crater, water, volcanic rock, marine sediment, sea water, marine hydrothermal vent, mediterranean sea, greece, active vent2018-08-29v4No1 / 150
254amnon high in winter dry season compared to summer autumn wet season in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 153
510amnoncommon estuary, water, saline water, kingdom of spain, estuary water, salinity >20 ppt, bilbao2019-03-20v4No1 / 158
461amnonhigher in early compared to late timepoints in chitin beads incubated in ocean water ( high in early timepoints compared to late timepoints in united states of america water surface water sea water coastal water atlantic ocean commonwealth of massachusetts chitin beads )2019-01-12v4No1 / 160
342amnon high in surface water compared to depth (water) 300m depth (water) 150m in water sea water pacific ocean philippine sea 2018-05-28v4No1 / 161
226amnonhigher in offshore station compared to near shore station ( high in offshore compared to near shore in united states of america lake freshwater lake water fresh water lake erie )2017-10-29v4No1 / 171
534amnoncommon river, water, fresh water, nepal, free floating, depth (water) 10cm, filtered 0.2um, koshi river2019-07-22v4No1 / 172
222amnoncommon on inner biofilm on metal plate in ocean water (common water, biofilm, sea water, biofilm material, guinea, depth (water) 3m, metal, biofilm)2017-10-26v4No1 / 177
196amnoncommon united states of america, water, drinking water2017-09-12v4No1 / 178
577amnon high in low salinity depth (water) 0-3m mixolimnion depth (water) 20-100cm depth (water) 1-5m compared to high salinity hypersaline water depth (water) 4-9m monimolimnion in lake water lake water romania ursu lake 2020-01-09v3No1 / 190
534amnoncommon river, tributary, water, fresh water, nepal, depth (water) 10cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 193
109amnon high in water treatment plant compared to distribution system in united states of america water drinking water site c 2017-04-08v4No1 / 193
170amnoncommon united states of america, river, stream, water, fresh water, depth (water) 10cm2017-07-24v4No1 / 194
508amnoncommon united states of america, lake, water, fresh water, state of minnesota, lake water, manganika lake, hypereutrophic lake, sulfidic bottom water2019-03-17v4No1 / 196
226amnonlower in algal bloom period in lake erie ( high in control compared to algal bloom in united states of america lake freshwater lake water fresh water lake erie )2017-10-29v4No1 / 198
443amnoncommon united states of america, river, water, fresh water, mississippi river, particles, upstream, depth (water) 1m, filtered 2.7um, uppper mississippi river2019-01-07v4No1 / 201
254amnon high in autumn compared to summer winter in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 206
481amnoncommon united states of america, fishpond, research facility, water, fresh water, pond water, state of alabama2019-02-12v4No1 / 210
733amnoncommon water, fresh water, brazil, free floating, depth (water) 1m, filtered 0.2um, lake water, river amazon, lago grande do curuai2021-01-17v3No1 / 210
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 10m2019-01-16v4No1 / 213
508amnon high in lake water fresh water lake water compared to lake sediment sediment in united states of america state of minnesota mcquade lake 2019-03-17v4No1 / 214
443amnoncommon united states of america, river, water, fresh water, mississippi river, free floating, upstream, depth (water) 1m, filtered 0.2um, uppper mississippi river2019-01-07v4No1 / 219
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 5m2019-01-16v4No1 / 220
196amnonhigher in water compared to biofilm ( high in water compared to biofilm biofilm in united states of america drinking water )2017-09-12v4No1 / 223
510amnon high in saline water salinity >20 ppt compared to fresh water salinity <5 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 223
505amnon high in early time points compared to late time points in water surface water sea water state of california pacific ocean particle bound size 1-80um 2019-03-16v4No1 / 223
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 20m2019-01-16v4No1 / 225
505amnoncommon water, surface water, sea water, state of california, pacific ocean, free floating, size < 1um2019-03-14v4No1 / 225
499amnoncommon pond, water, fresh water, pond water, brazil2019-03-05v4No1 / 228
169amnoncommon lake, photic zone, water, fresh water, canada, depth (water) 0-100cm, depth (water) 20-100cm2017-07-24v4No1 / 234
733amnoncommon water, fresh water, brazil, depth (water) 1m, filtered 2.7um, particle bound, lake water, river amazon, lago grande do curuai2021-01-17v3No1 / 235
342amnoncommon water, surface water, sea water, pacific ocean, philippine sea2018-05-28v4No1 / 236
342amnon high in depth (water) 300m depth (water) 150m compared to surface water in water sea water pacific ocean philippine sea 2018-05-28v4No1 / 239
308amnoncommon in water of aquarium with red abalone (common united states of america, research facility, water, sea water, aquarium, state of california, red abalone, haliotis rufescens)2018-03-30v4No1 / 240
485amnoncommon coast, water, saline water, surface water, sea water, mediterranean sea, italy, gulf of naples, depth (water) 0-100cm, depth (water) 20-100cm2019-02-19v4No1 / 244
505amnon high in late time points compared to early time points in water surface water sea water state of california pacific ocean free floating size < 1um 2019-03-16v4No1 / 249
304amnonhigher in seawater compared sea spray aerosol ( high in water sea water compared to air aerosol in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 260
459amnoncommon in middle, bottom in aquaculture biofilter sand (common united states of america, fish farm, water, fresh water, sand, biofilter, state of wisconsin, middle, bottom)2019-01-12v4No1 / 262
315amnoncommon in frog pond water (common pond, water, fresh water, jiangxi province, hunan province, china)2018-04-10v4No1 / 274
160amnoncommon in river water upstream of WTP effluent in spring in china (common river, water, china, spring)2017-07-12v4No1 / 278
505amnon high in free floating size < 1um compared to particle bound size 1-80um in water surface water sea water state of california pacific ocean 2019-03-14v4No1 / 283
496amnoncommon water, sea water, pacific ocean, canada, saanich inlet, depth (water) 200m2019-03-03v4No1 / 287
473amnon high in summer compared to winter in water saline water sea water state of california pacific ocean monterey bay deth 5-100m 2019-01-16v4No1 / 293
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 30m2019-01-16v4No1 / 293
226amnonhigher in algal bloom period in lake erie ( high in algal bloom compared to control in united states of america lake freshwater lake water fresh water lake erie )2017-10-29v4No1 / 301
577amnoncommon lake, water, high salinity, lake water, hypersaline water, romania, ursu lake, depth (water) 4-9m, monimolimnion2020-01-09v3No1 / 303
496amnon high in depth (water) 100m compared to depth (water) 200m in water sea water pacific ocean canada saanich inlet 2019-03-03v4No1 / 310
534amnoncommon river, water, fresh water, nepal, depth (water) 10cm, filtered 2.7um, particle bound, koshi river2019-07-22v4No1 / 315
226amnoncommon united states of america, lake, freshwater lake, water, fresh water, lake erie2017-10-29v4No1 / 316
510amnoncommon estuary, water, fresh water, kingdom of spain, estuary water, salinity <5 ppt, bilbao2019-03-20v4No1 / 317
461amnoncommon united states of america, water, surface water, sea water, coastal water, atlantic ocean, commonwealth of massachusetts2019-01-12v4No1 / 322
342amnoncommon water, sea water, pacific ocean, philippine sea, depth (water) 300m2018-05-28v4No1 / 323
443amnonlower in lower mississippi river (downstream) compared to upper mississippi river ( high in upstream upper mississippi river compared to downstream lower mississippi river in united states of america river water fresh water mississippi river free floating depth (water) 1m filtered 0.2um )2019-01-07v4No1 / 335
508amnoncommon united states of america, lake, water, fresh water, state of minnesota, mcquade lake, lake water2019-03-17v4No1 / 336
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 40m2019-01-16v4No1 / 340
254amnoncommon river, water, fresh water, fujian province, depth (soil) 50cm, jiulong river, china2017-11-23v4No1 / 347
443amnoncommon united states of america, river, water, fresh water, mississippi river, free floating, downstream, depth (water) 1m, filtered 0.2um, lower mississippi river2019-01-07v4No1 / 349
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth (soil) 50cm jiulong river china )2017-11-23v4No1 / 356
341amnonhigher in fresh drinking water compared to week old water ( high in fresh water compared to stagnant water in united states of america water drinking water tap water state of illinois )2018-05-28v4No1 / 365
160amnoncommon in river water upstream of WTP effluent in autumn in china (common river, water, autumn, china)2017-07-12v4No1 / 376
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 52020-04-22v4No1 / 383
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 60m2019-01-16v4No1 / 390
170amnonhigher in low turbidity river water ( high in turbidity low turbidity compared to high turbidity in united states of america river stream water fresh water depth (water) 10cm )2017-07-24v4No1 / 395
504amnon high in sediment marine sediment compared to water sea water in nan'ao island china 2019-03-14v4No1 / 395
342amnoncommon water, sea water, pacific ocean, philippine sea, depth (water) 150m2018-05-28v4No1 / 397
505amnoncommon water, surface water, sea water, state of california, pacific ocean, particle bound, size 1-80um2019-03-14v4No1 / 397
366amnoncommon river, water, fresh water, egypt, cairo, river nile, winter, dry season, depth (water) 50cm2018-08-31v4No1 / 403
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 32020-04-22v4No1 / 420
508amnon high in lake sediment sediment compared to lake water fresh water lake water in united states of america state of minnesota manganika lake hypereutrophic lake sulfidic bottom water 2019-03-17v4No1 / 422
443amnonlower in lower mississippi river (downstream) compared to upper mississippi river ( high in upstream upper mississippi river compared to downstream lower mississippi river in united states of america river water fresh water mississippi river particles depth (water) 1m filtered 2.7um )2019-01-07v4No1 / 425
577amnon high in high salinity hypersaline water depth (water) 4-9m monimolimnion compared to low salinity depth (water) 0-3m mixolimnion depth (water) 20-100cm depth (water) 1-5m in lake water lake water romania ursu lake 2020-01-09v3No1 / 439
508amnon high in lake sediment sediment compared to lake water fresh water lake water in united states of america state of minnesota mcquade lake 2019-03-17v4No1 / 446
459amnonhigher in surface compared to middle and bottom in aquaculture biofilter sand ( high in surface compared to middle bottom in united states of america fish farm water fresh water sand biofilter state of wisconsin )2019-01-12v4No1 / 448
504amnoncommon water, sea water, nan'ao island, china2019-03-14v4No1 / 452
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 80m2019-01-16v4No1 / 454
504amnon high in water sea water compared to sediment marine sediment in nan'ao island china 2019-03-14v4No1 / 462
254amnonlower in river when close to populated region compared to downstream ( high in downstream compared to populated place city upstream in river water fresh water fujian province depth (soil) 50cm jiulong river china )2017-11-23v4No1 / 468
496amnoncommon water, sea water, pacific ocean, canada, saanich inlet, depth (water) 100m2019-03-03v4No1 / 469
662amnoncommon water, wastewater treatment plant, israel, treated wastewater2020-09-20v3No1 / 473
366amnoncommon river, water, fresh water, egypt, cairo, river nile, summer, wet season, depth (water) 50cm2018-08-31v4No1 / 474
362amnoncommon hydrothermal vent, volcanic crater, water, volcanic rock, marine sediment, sea water, marine hydrothermal vent, mediterranean sea, greece, inactive vent2018-08-29v4No1 / 480
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 100m2019-01-16v4No1 / 486
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 200m2019-01-16v4No1 / 492
323amnoncommon united states of america, water, surface water, sea water, atlantic ocean, state of florida, south florida, depth (soil) 0-20cm, depth (water) 0cm2018-04-24v4No1 / 504
315amnonhigher in frog pond water compared to frog gut ( high in water fresh water compared to digestive system colon frog quasipaa spinosa giant spiny frog in jiangxi province hunan province china )2018-04-10v4No1 / 505
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 12020-04-22v4No1 / 518
178amnonlower in drinking water compared to loose deposits in water pipes ( high in deposits compared to drinking water in water kingdom of the netherlands )2017-08-10v4No1 / 538
317amnonlower in depth>75m compared to depth >5m in ocean water ( high in surface water depth (water) 5m compared to depth (water) 300m depth (water) 75m depth (water) 150m in united states of america water sea water state of california pacific ocean )2018-04-15v4No1 / 544
304amnonhigher in seawater compared to beach sand ( high in water sea water compared to sand in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 547
662amnon high in wastewater treatment plant treated wastewater compared to drinking water tap water in water israel 2020-09-20v3No1 / 565
443amnoncommon united states of america, river, water, fresh water, mississippi river, particles, downstream, depth (water) 1m, filtered 2.7um, lower mississippi river2019-01-07v4No1 / 568
254amnon high in summer autumn wet season compared to winter dry season in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 571
254amnon high in summer wet season compared to winter autumn dry season in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 581
473amnoncommon water, saline water, sea water, state of california, pacific ocean, monterey bay, depth (water) 500m2019-01-16v4No1 / 587
510amnon high in fresh water salinity <5 ppt compared to saline water salinity >20 ppt in estuary water kingdom of spain estuary water bilbao 2019-03-20v4No1 / 592
647amnon high in lake water freshwater lake compared to skin frog rana luteiventris columbia spotted frog in united states of america state of montana 2020-09-06v4No1 / 593
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 22020-04-22v4No1 / 596
265amnonhigher in tree leaves compared to soil and soilwater ( high in leaf tree compared to soil water soilwater in canada province of quebec )2017-12-11v4No1 / 610
505amnon high in late time points compared to early time points in water surface water sea water state of california pacific ocean particle bound size 1-80um 2019-03-16v4No1 / 612
459amnoncommon in surface in aquaculture biofilter sand (common united states of america, surface, fish farm, water, fresh water, sand, biofilter, state of wisconsin)2019-01-12v4No1 / 622
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream higher mississippi river in united states of america river water fresh water mississippi river free floating depth (water) 1m filtered 0.2um )2019-01-07v4No1 / 652
200amnoncommon in river downstream of wastewater treatment plant (common united states of america, river, water, fresh water, wastewater treatment plant, effluent)2017-10-01v4No1 / 655
612amnoncommon united states of america, water, fresh water, state of florida, spring water, location 42020-04-22v4No1 / 655
178amnoncommon in drinking water pipe loose deposits (common water, drinking water, kingdom of the netherlands, deposits)2017-08-10v4No1 / 656
304amnoncommon united states of america, beach, water, sea water, state of california, pacific ocean, monterey bay2018-03-12v4No1 / 667
308amnoncommon in aquarium water with white abalone (common united states of america, research facility, water, sea water, aquarium, state of california, haliotis sorenseni, white abalone)2018-03-30v4No1 / 727
481amnonlower in channel catfish intestine compared to the growing pond water ( high in pond fishpond water fresh water compared to intestine ictalurus punctatus fish channel catfish in united states of america research facility state of alabama )2019-02-12v4No1 / 741
443amnon high in free floating filtered 0.2um compared to particles filtered 2.7um in united states of america river water fresh water mississippi river depth (water) 1m 2019-01-07v4No1 / 755
478amnoncommon farm, water, saline water, shrimp farm, china2019-02-19v4No1 / 799
265amnoncommon water, canada, province of quebec, soilwater2017-12-11v4No1 / 841
473amnon high in depth (water) 150-500m compared to depth (water) 50-100m in water saline water sea water state of california pacific ocean monterey bay 2019-01-16v4No1 / 870
317amnonhigher in depth>75m compared to depth >5m in ocean water ( high in depth (water) 300m depth (water) 75m depth (water) 150m compared to surface water depth (water) 5m depth (water) 0cm in united states of america water sea water state of california pacific ocean )2018-04-15v4No1 / 889
473amnon high in depth (water) 5-50m compared to depth (water) 50-100m in water saline water sea water state of california pacific ocean monterey bay 2019-01-16v4No1 / 919
323amnonlower in sharks compared to sea water ( high in water surface water sea water depth (water) 0cm compared to shark in united states of america atlantic ocean state of florida south florida )2018-04-24v4No1 / 979
473amnon high in winter compared to summer in water saline water sea water state of california pacific ocean monterey bay deth 5-100m 2019-01-16v4No1 / 1006
473amnon high in depth (water) 50-100m compared to depth (water) 150-500m in water saline water sea water state of california pacific ocean monterey bay 2019-01-16v4No1 / 1072
236amnoncommon ocean, water, sea water, state of california, pacific ocean, bodega bay2017-11-07v4No1 / 1156
304amnoncommon united states of america, beach, water, sea water, state of california, pacific ocean, san francisco bay2018-03-12v4No1 / 1166
505amnon high in particle bound size 1-80um compared to free floating size < 1um in water surface water sea water state of california pacific ocean 2019-03-14v4No1 / 1218
204amnoncommon drinking water reservoir, sediment, water, china2017-10-02v4No1 / 1220
443amnonhigher in lower mississippi river (downstream) compared to upper mississippi river ( high in downstream lower mississippi river compared to upstream upper mississippi river in united states of america river water fresh water mississippi river particles depth (water) 1m filtered 2.7um )2019-01-07v4No1 / 1418
304amnoncommon united states of america, beach, water, sea water, state of california, pacific ocean, santa cruz county2018-03-12v4No1 / 1425
304amnonlower in seawater compared to beach sand ( high in sand compared to water sea water in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 1599
473amnon high in depth (water) 50-100m compared to depth (water) 5-50m in water saline water sea water state of california pacific ocean monterey bay 2019-01-16v4No1 / 1656
304amnonhigher in beach sand compared to sea water and sea spray ( high in sand compared to water air sea water in united states of america beach state of california pacific ocean )2018-03-12v4No1 / 2070
443amnon high in particles filtered 2.7um compared to free floating filtered 0.2um in united states of america river water fresh water mississippi river depth (water) 1m 2019-01-07v4No1 / 2266
265amnon high in soil compared to water soilwater in canada province of quebec 2017-12-11v4No1 / 2715
642amnon high in sediment marine sediment compared to water saline water sea water in pacific ocean san diego 2020-08-28v4No1 / 3217
265amnon high in water soilwater compared to soil in canada province of quebec 2017-12-11v4No1 / 3277

Problems / suggestions? Please email info AT dbbact DOT org