Summary for ontology term: wild

Number of annotations with term: 181

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTGATAAGTCTGAAGTTAAAGGCTGTGGCTCAACCATAGTTCGCTTTGGAAACTGTCAAACTTGAGTGCAGAAGGGGAGAGTGGAATTCCATGT0.024242
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.024242
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pseudomonadales;f__Pseudomonadaceae;g__PseudomonasTACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGTGGTTTGTTAAGTTGGATGTGAAATCCCCGGGCTCAACCTGGGAACTGCATTCAAAACTGACTGACTAGAGTATGGTAGAGGGTGGTGGAATTTCCTG0.018182
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__StaphylococcusTACGTAGGTGGCAAGCGTTATCCGGAATTATTGGGCGTAAAGCGCGCGTAGGCGGTTTTTTAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGGAAAACTTGAGTGCAGAAGAGGAAAGTGGAATTCCATG0.018182
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Xanthomonadales;f__Xanthomonadaceae;g__RhodanobacterTACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTTAGTTAAGTCTGTCGTGAAATCCCCGGGCTCAACCTGGGAATGGCGATGGATACTGGCTGGCTAGAGTGTGTCAGAGGATGGTGGAATTTCCGG0.018182
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Alteromonadales;f__Alteromonadaceae;g__HalieaTACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGCGGTTTGTTAAGTCAGCTGTGAAAGCCCCGGGCTCAACCTGGGAACTGCAGTTGATACTGGCCGACTAGAGTACGAGAGAGGGAGGTAGAATTCCATG0.018182
d__Bacteria;p__Cyanobacteria/Chloroplast;c__Chloroplast;f__Chloroplast;g__StreptophytaTACAGAGGATGCAAGCGTTATCCGGAATGATTGGGCGTAAAGCGTCTGTAGGTGGCTTTTTAAGTCCGCCGTCAAATCCCAGGGCTCAACCCTGGACAGGCGGTGGAAACTACCAAGCTGGAGTACGGTAGGGGCAGAGGGAATTTCCGG0.018182
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__Rhizobiales;f__Bradyrhizobiaceae;g__BradyrhizobiumTACGAAGGGGGCTAGCGTTGCTCGGAATCACTGGGCGTAAAGGGTGCGTAGGCGGGTCTTTAAGTCAGGGGTGAAATCCTGGAGCTCAACTCCAGAACTGCCTTTGATACTGAAGATCTTGAGTTCGGGAGAGGTGAGTGGAACTGCGAG0.018182
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__DoreaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCACGGCAAGCCAGATGTGAAAGCCCGGGGCTCAACCCCGGGACTGCATTTGGAACTGCTGAGCTAGAGTGTCGGAGAGGCAAGTGGAATTCCTAG0.018182
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Oxalobacteraceae;g__MassiliaTACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTTTGTAAGTCTGACGTGAAATCCCCGGGCTCAACCTGGGAATTGCGTTGGAGACTGCAAGGCTAGAATCTGGCAGAGGGGGGTAGAATTCCACG0.018182

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGATGGCAAGTCAGATGTGAAATCCATGGGCTCAACCCATGAACTGCATTTGAAACTGTCGTTCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__TerrisporobacterTACGTAGGGGGCTAGCGTTATCCGGATTTACTGGGCGTAAAGGGTGCGTAGGTGGTTTCTTAAGTCAGGAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTCTTGAAACTGGGAAACTTGAGTGCAGGAGAGGAAAGTGGAATTCCTAGT0.222222
d__BacteriaCACGTAAGTTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGTTATCTAAGCTTGGTGTGAAAGGCAGGGGCTCAACTCCTGGACTGCATTGAGAACTGGATAACTAGAGTTACTGAAGTGAAATCAGAATTCCAGG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATGCAAGTCGGGAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCGAAACTGTATCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.222222
d__BacteriaTACGTAGGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGAGTAGACGGCGATGCAAGTCAGATGTGAAATGCTAGGGCTTAACCTTAGAACTGCATCTGAAACTGTATTGCTAGAGTGCAGGAGAGGTAAACGGAATTCCTAG0.222222
d__BacteriaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGAGGTGCAAGCGTGCCGTGAAAGCGCGGGGCTCAACCCCGTACAGCGGCGCGAACTGCTCCCCTTGGTTGCGGGAAGGGAAGGCGGAACTCGTGGT0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATGCAAGTCAGGAGTGAAATCCCGGGGCTCAACCCCGGAACTGCTTTTGAAACTGTATCCCTTGAGTGTCGGAGAGGCAAGCGGAATTCCTAG0.222222
d__BacteriaTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATGCAAGTTGGGAGTGAAATCCCGGGGCTCAACCCCGGAACTGCTCTCAAAACTGTATCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.222222
d__BacteriaCACGTAAGTTGCGAGCGTTGTTCGGAATTATTGGGCGTAAAGGGCATGTAGGCGGTATTGCAAGCCTGGTGTGAAAGGCGGGGGCTCAACCCCTGGACTGCGCTGGGAACTGCATTACTAGAGTCGCTGAGGGGCAATCAGAATTCCAGG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGACGGCATGGCAAGCCAGATGTGAAAGGTGGGGGCTCAACCCCCAAGCTGCATTTGGAACTGTCAAGCTAGAGTATCGGAGAGGTAAGTGGAATTCCTAG0.222222

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGATATTAAGTCAGTCGTCAAAGCCTGTGGCTCAACCACAGCCCGCGATTGATACTGGTAACCTTGAGTGCGGATGAGGTGGATGGAATTCGTGGT0.182609
d__BacteriaTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATGCAAGTTGGGAGTGAAATCCCGGGGCTCAACCCCGGAACTGCTTTCAAAACTGTATCCCTTGAGTGTCGGAGAGGCAAGCGGAATTCCTAG0.178295
d__BacteriaTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGATGCAAGTTGGGAGTGAAATCCCGGGGCTCAACCCCGGAACTGCTTTCAAAACTGCATCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.169118
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAAGACAGGTCAGATGTGAAATGTCGGGGCTCAACCCCGGAACTGCATTTGAAACCGTTTTTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.167331
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Helicobacteraceae;g__HelicobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGAGCGCGTAGGCGGGAAAGTAAGTCAGATGTGAAATCCTGTAGCTTAACTACAGAACTGCATTTGAAACTACTTTTCTAGAGTATGGGAGAGGTAGGTGGAATTCTTGG0.160428
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGAACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.158845
d__Bacteria;p__"Fusobacteria";c__Fusobacteriia;o__"Fusobacteriales";f__"Fusobacteriaceae"TACGTATGTCGCAAGCGTTATCCGGATTTATTGGGCGTAAAGCGCGTCTAGGCGGTTTGGTAAGTCTGATGTGGAAATGCGGGGCTCAACTCCGTATTGCGTTGGAAACTGCCAGACTAGAGTACTGGAGAGGTGGGCGGAACTACAAGT0.153005
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Peptostreptococcaceae;g__Clostridium XITACGTAGGGGGCTAGCGTTATCCGGAATTACTGGGCGTAAAGGGTGCGTAGGCGGTCTTTCAAGCCAGAAGTGAAAGGCTACGGCTCAACCGTAGTAAGCTTTTGGAACTGTAGGACTTGAGTGCAGGAGAGGAGAGTGGAATTCCTAGT0.151515
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGCTGCAAGTCAGATGTGAAATCCCGGGGCTCAACCCCGGAACTGCATTTGAAACTGTAGCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.146179
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__CollinsellaTACGTAGGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCGCGTAGGCGGGGGGTCAAATCCCGGGGCTCAACCCCGGTCCGCCCCCCGAACCCCGCGGCTCGGGTCCGGTAGGGGAGGGTGGAATTCCCGGT0.135135

Annotations:

common ontology terms
term enrichment score
TermScore
wild0.969153
masai mara national park0.223176
kenya0.182456
edmonton0.162437
canis latrans0.162437
LOWER IN wild0.158140
santa catalina island0.150235
urocyon littoralis0.150235
urocyon littoralis catalinae0.150235
santa catalina island fox0.150235
monkey0.140915
feces0.105383
adult organism0.103560
hokkaido0.094787
canada0.092807
japan0.086643
caecum0.085791
coelomic fluid0.084656
starfish0.081218
republic of congo0.081218
nouabale-ndoki national park0.081218
zambia0.081218
australia0.075235
pan troglodytes troglodytes0.073107
chimpanzee0.071795
gorilla gorilla0.069307
phascolarctos cinereus0.062176
koala0.062176
cape otway0.062176
lake hulun0.062176
nature reserve0.062176
cameroon0.060302
LOWER IN captive0.059230
LOWER IN zoological garden0.058968
zoological garden0.058968
costa rica0.058537
winter0.058212
mongolia0.056872
city0.052493
papio kindae0.052356
anatomical space0.048682
male0.045134
democratic republic of the congo0.042328
algonquin provincial park0.042328
peromyscus maniculatus0.042328
deer mice0.042328
asterias amurensis0.042328
patiria pectinifera0.042328
cambridgeshire0.042328
elaphurus davidianus0.042328
pere deer0.042328
deer0.042328
kinda baboon0.042328
age 3-5 weeks0.041451
ursus arctos0.041451
brown bear0.041451
newt0.041451
cebus capucinus0.041451
white-faced capuchin0.041451
external acoustic meatus0.040609
ear canal0.040609
captive0.040201
hawaii0.039801
province of ontario0.039801
LOWER IN research facility0.039716
research facility0.039716
united states of america0.036326
rattus norvegicus0.033755
sweden0.033195
chicken0.032653
sus scrofa0.032653
descending colon0.032609
gallus gallus0.032129
age 15-20 weeks0.032086
feral0.032086
ascending colon0.032086
cattle0.032086
damaliscus lunatus0.032086
tsessebe0.032086
eucalyptus obliqua diet0.032086
eucalyptus viminalis diet0.032086
central chimpanzee0.032086
vulpes vulpes0.032086
red fox0.032086
vulpes corsac0.032086
corsac fox0.032086
european brown hare0.032086
labial commissure0.032086
perianal skin0.032086
papio ursinus0.032086
pan troglodytes0.031830
rat0.031621
aepyceros melampus0.031579
impala0.031579
syncerus caffer caffer0.031579
cape buffalo0.031579
wild boar0.031579
european rabbit0.031579
lip0.031579
digestive system0.031128
Fraction of dbbact annotations with this term covered by the query
TermScore
wild1.041667
edmonton1.000000
canis latrans1.000000
descending colon1.000000
LOWER IN descending colon1.000000
mikura-jima1.000000
coelomic fluid1.000000
LOWER IN coelomic fluid1.000000
pan troglodytes troglodytes0.666667
age 15-20 weeks0.500000
feral0.500000
ascending colon0.500000
LOWER IN ascending colon0.500000
pan paniscus0.500000
democratic republic of the congo0.500000
bonobo0.500000
carcharhinus leucas0.500000
bull shark0.500000
acheta domesticus0.500000
cricket0.500000
chimpanzee0.500000
pan troglodytes schweinfurthii0.500000
masai mara national park0.500000
eudorcas thomsonii0.500000
thomson's gazelle0.500000
cattle0.500000
madoqua kirkii0.500000
kirk's dik-dik0.500000
equus burchellii quagga0.500000
giraffa tippelskirchi0.500000
damaliscus lunatus0.500000
tsessebe0.500000
phacochoerus africanus0.500000
warthog0.500000
elephant0.500000
LOWER IN cattle0.500000
LOWER IN damaliscus lunatus0.500000
LOWER IN tsessebe0.500000
LOWER IN wild0.500000
algonquin provincial park0.500000
peromyscus maniculatus0.500000
deer mice0.500000
bottlenosed dolphin0.500000
quasipaa spinosa0.500000
giant spiny frog0.500000
eucalyptus obliqua diet0.500000
eucalyptus obliqua0.500000
LOWER IN eucalyptus viminalis0.500000
LOWER IN eucalyptus viminalis diet0.500000
phascolarctos cinereus0.500000
koala0.500000
cape otway0.500000
eucalyptus viminalis0.500000
eucalyptus viminalis diet0.500000
LOWER IN eucalyptus obliqua diet0.500000
LOWER IN eucalyptus obliqua0.500000
central chimpanzee0.500000
LOWER IN pan troglodytes verus0.500000
starfish0.500000
asterias amurensis0.500000
patiria pectinifera0.500000
LOWER IN starfish0.500000
LOWER IN patiria pectinifera0.500000
LOWER IN asterias amurensis0.500000
days 0-30.500000
LOWER IN days 57-600.500000
harvard forest0.500000
sarracenia purpurea0.500000
pitcher plant0.500000
pitcher fluid0.500000
days 57-600.500000
LOWER IN days 0-30.500000
republic of congo0.500000
nouabale-ndoki national park0.500000
gorilla gorilla gorilla0.500000
LOWER IN republic of congo0.500000
LOWER IN nouabale-ndoki national park0.500000
cambridgeshire0.500000
lissotriton vulgaris0.500000
triturus cristatus0.500000
guanacaste conservation area0.500000
LOWER IN state of vermont0.500000
state of vermont0.500000
pygathrix nemaeus0.500000
red-shanked douc0.500000
son tra nature reserve0.500000
elaphurus davidianus0.500000
pere deer0.500000
deer0.500000
LOWER IN city of boston0.500000
city of boston0.500000
vulpes vulpes0.500000
lake hulun0.500000
red fox0.500000
vulpes corsac0.500000
corsac fox0.500000
LOWER IN vulpes corsac0.500000
LOWER IN corsac fox0.500000
LOWER IN vulpes vulpes0.500000
LOWER IN red fox0.500000
Fraction of annotations for the query sequences containing the term
TermScore
wild0.906077
feces0.651934
united states of america0.176796
kenya0.143646
masai mara national park0.143646
canada0.110497
monkey0.104972
LOWER IN wild0.093923
male0.088398
adult organism0.088398
edmonton0.088398
canis latrans0.088398
coyote0.088398
caecum0.088398
santa catalina island0.088398
urocyon littoralis0.088398
urocyon littoralis catalinae0.088398
santa catalina island fox0.088398
anatomical space0.066298
japan0.066298
australia0.066298
mus musculus0.055249
mouse0.055249
city0.055249
hokkaido0.055249
adult0.055249
coelomic fluid0.044199
starfish0.044199
republic of congo0.044199
nouabale-ndoki national park0.044199
zambia0.044199
LOWER IN research facility0.038674
chimpanzee0.038674
research facility0.038674
winter0.038674
gorilla gorilla0.038674
pan troglodytes troglodytes0.038674
LOWER IN captive0.033149
china0.033149
phascolarctos cinereus0.033149
koala0.033149
cape otway0.033149
cameroon0.033149
LOWER IN zoological garden0.033149
zoological garden0.033149
costa rica0.033149
mongolia0.033149
lake hulun0.033149
nature reserve0.033149
papio kindae0.027624
gallus gallus0.022099
hawaii0.022099
chicken0.022099
democratic republic of the congo0.022099
digestive system0.022099
captive0.022099
province of ontario0.022099
algonquin provincial park0.022099
peromyscus maniculatus0.022099
deer mice0.022099
age 3-5 weeks0.022099
sweden0.022099
ursus arctos0.022099
brown bear0.022099
asterias amurensis0.022099
patiria pectinifera0.022099
skin0.022099
cambridgeshire0.022099
newt0.022099
united kingdom0.022099
sus scrofa0.022099
elaphurus davidianus0.022099
pere deer0.022099
deer0.022099
rattus norvegicus0.022099
rat0.022099
bovidae0.022099
cebus capucinus0.022099
white-faced capuchin0.022099
external acoustic meatus0.022099
ear canal0.022099
kinda baboon0.022099
jejunum0.016575
age 15-20 weeks0.016575
feral0.016575
ascending colon0.016575
descending colon0.016575
duodenum0.016575
pan troglodytes0.016575
bos taurus0.016575
cattle0.016575
aepyceros melampus0.016575
impala0.016575
damaliscus lunatus0.016575
tsessebe0.016575
syncerus caffer caffer0.016575
cape buffalo0.016575
eucalyptus obliqua diet0.016575
eucalyptus viminalis diet0.016575
bolivia0.016575
Exp. ID User ID Description Date Region Flag Sequences
592amnondominant feces, united states of america, ovis aries, commonwealth of pennsylvania, wild, sheep2020-02-18v1No1 / 2
781amnondominant feces, kenya, wild, masai mara national park, equus burchellii quagga, zebra2021-04-28v4No1 / 2
315amnonlower in captive grown compared to wild frogs ( high in wild compared to research facility in digestive system colon jiangxi province hunan province frog quasipaa spinosa giant spiny frog china )2018-04-10v4No1 / 3
550amnondominant city, coelomic fluid, hokkaido, wild, starfish, patiria pectinifera, japan2019-08-18v4No1 / 5
550amnon high in coelomic fluid wild starfish asterias amurensis compared to sea water in city hokkaido japan 2019-08-18v4No1 / 5
550amnondominant city, coelomic fluid, hokkaido, wild, starfish, asterias amurensis, japan2019-08-18v4No1 / 6
582amnondominant united states of america, external acoustic meatus, ear canal, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 6
781amnondominant feces, bos taurus, kenya, wild, masai mara national park, cattle2021-04-28v4No1 / 7
550amnon high in asterias amurensis compared to patiria pectinifera in city coelomic fluid hokkaido wild starfish japan 2019-08-18v4No1 / 7
454amnondominant feces, wild, elaphurus davidianus, pere deer, deer, china2019-01-10v4No1 / 8
781amnondominant feces, kenya, wild, masai mara national park, tragelaphus oryx, eland2021-04-28v4No1 / 9
781amnondominant feces, kenya, wild, aepyceros melampus, impala, masai mara national park2021-04-28v4No1 / 9
781amnondominant feces, kenya, wild, masai mara national park, damaliscus lunatus, tsessebe2021-04-28v4No1 / 10
537amnonhigh freq. in feces of wild caught deer mice feces (dominant feces, canada, province of ontario, algonquin provincial park, wild, peromyscus maniculatus, deer mice, age 3-5 weeks)2019-07-28v3No1 / 10
890amnoncommon feces, tursiops truncatus, pacific ocean, bottlenosed dolphin, wild, japan, mikura-jima2022-04-03v3No1 / 10
411amnondominant feces, zambia, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 10
898amnondominant jejunum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 11
898amnon high in duodenum jejunum compared to feces ascending colon descending colon in male canada wild adult organism edmonton canis latrans coyote 2022-04-19v4No1 / 11
592amnondominant feces, wild, democratic republic of the congo, pan troglodytes schweinfurthii, eastern chimpanzee2020-02-18v1No1 / 11
781amnondominant feces, kenya, syncerus caffer caffer, cape buffalo, wild, masai mara national park2021-04-28v4No1 / 11
386amnondominant caecum, mus musculus, bolivia, mouse, wild2018-10-28v4No1 / 11
592amnondominant feces, pan troglodytes, africa, wild, chimpanzee2020-02-18v1No1 / 12
898amnoncommon duodenum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 12
898amnondominant duodenum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 12
815amnon high in vulpes vulpes red fox compared to vulpes corsac corsac fox in feces mongolia winter wild lake hulun 2021-07-04v3No1 / 12
582amnondominant united states of america, wild, external ear, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 12
781amnondominant feces, kenya, wild, masai mara national park, eudorcas thomsonii, thomson's gazelle2021-04-28v4No1 / 13
890amnondominant feces, tursiops truncatus, pacific ocean, bottlenosed dolphin, wild, japan, mikura-jima2022-04-03v3No1 / 13
781amnondominant feces, kenya, wild, giraffe, masai mara national park, giraffa tippelskirchi2021-04-28v4No1 / 14
386amnondominant caecum, mus musculus, ecuador, mouse, wild2018-10-28v4No1 / 14
759amnondominant feces, united states of america, sus scrofa, state of alabama, wild, wild boar2021-04-04v4No1 / 14
625amnondominant feces, wild, viet nam, pygathrix nemaeus, red-shanked douc, son tra nature reserve2020-05-16v4No1 / 14
592amnoncommon feces, state of florida, wild, carcharhinus leucas, bull shark2020-02-18v1No1 / 15
592amnondominant feces, state of florida, wild, carcharhinus leucas, bull shark2020-02-18v1No1 / 15
781amnondominant feces, kenya, wild, masai mara national park, madoqua kirkii, kirk's dik-dik2021-04-28v4No1 / 15
729amnondominant feces, gorilla gorilla, monkey, wild, cameroon2021-01-05v3No1 / 15
550amnoncommon city, coelomic fluid, hokkaido, wild, starfish, asterias amurensis, japan2019-08-18v4No1 / 15
550amnon high in coelomic fluid wild starfish patiria pectinifera compared to sea water in city hokkaido japan 2019-08-18v4No1 / 15
815amnon high in vulpes corsac corsac fox compared to vulpes vulpes red fox in feces mongolia winter wild lake hulun 2021-07-04v3No1 / 15
898amnoncommon jejunum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 15
592amnondominant feces, wild, pan paniscus, democratic republic of the congo, bonobo2020-02-18v1No1 / 16
781amnondominant feces, kenya, wild, loxodonta africana, masai mara national park, elephant2021-04-28v4No1 / 16
541amnondominant feces, australia, wild, phascolarctos cinereus, koala, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 16
625amnondominant feces, costa rica, alouatta palliata, mantled howler monkey, wild, guanacaste conservation area2020-05-16v4No1 / 16
407amnondominant feces, costa rica, monkey, wild, cebus capucinus, white-faced capuchin2018-11-21v4No1 / 16
582amnondominant united states of america, axilla, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 16
411amnondominant feces, zambia, monkey, wild, papio kindae, kinda baboon2018-11-23v4No1 / 16
898amnondominant male, canada, wild, anatomical space, ascending colon, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 17
386amnondominant caecum, mus musculus, brazil, mouse, wild2018-10-28v4No1 / 17
387amnon high in winter compared to summer in feces sweden wild ursus arctos brown bear 2018-11-03v4No1 / 17
729amnondominant feces, monkey, wild, pan troglodytes troglodytes, cameroon, central chimpanzee2021-01-05v3No1 / 17
759amnondominant feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 17
639amnondominant feces, nature reserve, adult, oryctolagus cuniculus, australia, wild, european rabbit2020-08-21v3No1 / 17
781amnondominant feces, kenya, wild, masai mara national park, phacochoerus africanus, warthog2021-04-28v4No1 / 18
898amnondominant feces, male, canada, wild, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 18
898amnondominant male, canada, wild, anatomical space, descending colon, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 18
387amnonhigh freq. in feces of wild brown bear (dominant feces, sweden, wild, ursus arctos, brown bear)2018-11-03v4No1 / 18
582amnondominant united states of america, wild, lip, labial commissure, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 18
898amnondominant ileum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 18
592amnondominant digestive system, united states of america, wild, acheta domesticus, cricket2020-02-18v1No1 / 19
898amnondominant caecum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 19
582amnondominant united states of america, pair of nares, wild, external naris, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 19
582amnondominant united states of america, rectum, wild, perianal skin, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 19
614amnonincreases in picher plant fluid grown in lab ( high in research facility late time points days 57-60 compared to early time points wild days 0-3 in united states of america commonwealth of massachusetts plant fluid harvard forest sarracenia purpurea pitcher plant pitcher fluid )2020-04-26v4No1 / 20
639amnondominant feces, nature reserve, adult, australia, wild, lepus europaeus, european brown hare2020-08-21v3No1 / 20
666amnondominant feces, italy, wild, canis lupus, wolf2020-09-25v3No1 / 22
541amnondominant feces, australia, wild, phascolarctos cinereus, koala, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 23
541amnonlower in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus viminalis eucalyptus viminalis diet compared to eucalyptus obliqua diet eucalyptus obliqua in feces australia wild phascolarctos cinereus koala cape otway )2019-08-01v4No1 / 24
620amnondominant feces, gorilla gorilla, wild, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 24
815amnondominant feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 24
898amnoncommon ileum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 24
776amnondominant caecum, gallus gallus, hawaii, chicken, wild, age 15-20 weeks, feral2021-04-25v3No1 / 26
387amnoncommon in feces of wild brown bear (common feces, sweden, wild, ursus arctos, brown bear)2018-11-03v4No1 / 27
815amnondominant feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 27
620amnondominant feces, wild, chimpanzee, pan troglodytes troglodytes, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 28
582amnoncommon united states of america, external acoustic meatus, ear canal, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 30
315amnonhigher in captive grown compared to wild frogs ( high in research facility compared to wild in digestive system colon jiangxi province hunan province frog quasipaa spinosa giant spiny frog china )2018-04-10v4No1 / 31
666amnoncommon feces, italy, wild, canis lupus, wolf2020-09-25v3No1 / 32
411amnonhigher in wild baboons feeding on discarded human foods ( high in human contact compared to low human contact in feces zambia monkey wild papio kindae kinda baboon )2018-11-23v4No1 / 33
411amnonlower in wild baboons feeding on discarded human foods ( high in low human contact compared to human contact in feces zambia monkey wild papio kindae kinda baboon )2018-11-23v4No1 / 33
407amnoncommon feces, costa rica, monkey, wild, cebus capucinus, white-faced capuchin2018-11-21v4No1 / 34
407amnon high in dry season compared to wet season in feces costa rica monkey wild cebus capucinus white-faced capuchin 2018-11-21v4No1 / 36
541amnonhigher in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus obliqua diet eucalyptus obliqua compared to eucalyptus viminalis eucalyptus viminalis diet in feces australia wild phascolarctos cinereus koala cape otway )2019-08-01v4No1 / 38
614amnondecreases in picher plant fluid grown in lab ( high in early time points wild days 0-3 compared to research facility late time points days 57-60 in united states of america commonwealth of massachusetts plant fluid harvard forest sarracenia purpurea pitcher plant pitcher fluid )2020-04-26v4No1 / 42
898amnoncommon male, canada, wild, anatomical space, descending colon, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 44
898amnoncommon male, canada, wild, anatomical space, ascending colon, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 47
898amnoncommon feces, male, canada, wild, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 50
898amnoncommon caecum, male, canada, wild, anatomical space, adult organism, edmonton, canis latrans, coyote2022-04-19v4No1 / 55
582amnoncommon united states of america, wild, lip, labial commissure, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 68
386amnon high in ecuador compared to bolivia in caecum mus musculus mouse wild 2018-10-28v4No1 / 70
541amnoncommon feces, australia, wild, phascolarctos cinereus, koala, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 72
541amnoncommon feces, australia, wild, phascolarctos cinereus, koala, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 77
898amnon high in feces ascending colon descending colon compared to duodenum jejunum in male canada wild adult organism edmonton canis latrans coyote 2022-04-19v4No1 / 78
407amnon high in wet season compared to dry season in feces costa rica monkey wild cebus capucinus white-faced capuchin 2018-11-21v4No1 / 79
406amnonlower in captive white rhinoceros compared to wild ( high in south africa wild compared to french republic captive in feces ceratotherium simum white rhinoceros bovidae )2018-11-21v4No1 / 80
406amnonhigher in captive bovidae compared to wild ( high in zoological garden compared to wild in feces bovidae )2018-11-21v4No1 / 84
550amnoncommon city, coelomic fluid, hokkaido, wild, starfish, patiria pectinifera, japan2019-08-18v4No1 / 85
582amnoncommon united states of america, rectum, wild, perianal skin, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 88
386amnoncommon caecum, mus musculus, ecuador, mouse, wild2018-10-28v4No1 / 90
582amnoncommon united states of america, pair of nares, wild, external naris, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 92
592amnoncommon digestive system, united states of america, wild, acheta domesticus, cricket2020-02-18v1No1 / 93
759amnoncommon feces, united states of america, rattus norvegicus, state of new york, new york city, rat, wild2021-04-06v4No1 / 94
537amnonhigher in feces of deer mice grown in captivity compared to wild caught ( high in research facility captive compared to wild in feces canada province of ontario algonquin provincial park peromyscus maniculatus deer mice age 3-5 weeks )2019-07-28v3No1 / 96
759amnon high in state of new york new york city wild compared to research facility commonwealth of massachusetts city of boston in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 96
582amnon high in external acoustic meatus ear canal compared to lip labial commissure in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 105
776amnon high in wild age 15-20 weeks feral compared to research facility captive broiler chicken age 5 weeks in caecum gallus gallus hawaii chicken 2021-04-25v3No1 / 107
387amnon high in summer compared to winter in feces sweden wild ursus arctos brown bear 2018-11-03v4No1 / 110
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 110
592amnoncommon feces, wild, democratic republic of the congo, pan troglodytes schweinfurthii, eastern chimpanzee2020-02-18v1No1 / 116
386amnonnegatively correlated with altitude (0-4km) in house mouse caecum ( high in low altitude compared to high altitude in caecum mus musculus south america mouse wild )2018-10-28v4No1 / 122
582amnoncommon united states of america, wild, external ear, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 124
386amnoncommon caecum, mus musculus, bolivia, mouse, wild2018-10-28v4No1 / 129
592amnoncommon feces, pan troglodytes, africa, wild, chimpanzee2020-02-18v1No1 / 130
353amnonhigher in captive compared to wild caught Lissotriton vulgaris newts skin ( high in research facility compared to wild in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 135
582amnoncommon united states of america, axilla, wild, santa catalina island, urocyon littoralis, urocyon littoralis catalinae, santa catalina island fox2020-01-22v4No1 / 140
582amnon high in lip labial commissure compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 142
815amnoncommon feces, mongolia, winter, wild, lake hulun, vulpes corsac, corsac fox2021-07-04v3No1 / 146
411amnon high in wild papio kindae papio ursinus compared to zoological garden papio anubis in feces papio zambia monkey baboon 2018-11-23v4No1 / 151
815amnoncommon feces, mongolia, winter, wild, vulpes vulpes, lake hulun, red fox2021-07-04v3No1 / 160
537amnoncommon in feces of wild caught deer mice feces (common feces, canada, province of ontario, algonquin provincial park, wild, peromyscus maniculatus, deer mice, age 3-5 weeks)2019-07-28v3No1 / 163
639amnoncommon feces, nature reserve, adult, australia, wild, lepus europaeus, european brown hare2020-08-21v3No1 / 182
550amnon high in sea water compared to coelomic fluid wild starfish patiria pectinifera in city hokkaido japan 2019-08-18v4No1 / 185
386amnoncommon caecum, mus musculus, brazil, mouse, wild2018-10-28v4No1 / 189
776amnoncommon caecum, gallus gallus, hawaii, chicken, wild, age 15-20 weeks, feral2021-04-25v3No1 / 191
620amnoncommon feces, gorilla gorilla, wild, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 196
592amnoncommon feces, wild, pan paniscus, democratic republic of the congo, bonobo2020-02-18v1No1 / 199
411amnoncommon feces, zambia, monkey, wild, papio kindae, kinda baboon2018-11-23v4No1 / 200
759amnon high in research facility commonwealth of massachusetts city of boston compared to state of new york new york city wild in feces united states of america rattus norvegicus rat 2021-04-06v4No1 / 217
411amnoncommon feces, zambia, monkey, wild, papio ursinus, grayfoot chacma baboon2018-11-23v4No1 / 224
639amnon high in lepus europaeus european brown hare compared to oryctolagus cuniculus european rabbit in feces nature reserve adult australia wild 2020-08-21v3No1 / 235
620amnoncommon feces, wild, chimpanzee, pan troglodytes troglodytes, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 238
386amnon high in bolivia compared to ecuador in caecum mus musculus mouse wild 2018-10-28v4No1 / 246
781amnoncommon feces, kenya, wild, masai mara national park, madoqua kirkii, kirk's dik-dik2021-04-28v4No1 / 248
776amnon high in research facility captive broiler chicken age 5 weeks compared to wild age 15-20 weeks feral in caecum gallus gallus hawaii chicken 2021-04-25v3No1 / 252
386amnonpositively correlated with altitude (0-4km) in house mouse caecum ( high in high altitude compared to low altitude in caecum mus musculus south america mouse wild )2018-10-28v4No1 / 255
759amnon high in farm pig state of vermont compared to state of alabama wild wild boar in feces united states of america sus scrofa 2021-04-04v4No1 / 258
759amnon high in state of alabama wild wild boar compared to farm pig state of vermont in feces united states of america sus scrofa 2021-04-04v4No1 / 268
406amnonhigher in captive white rhinoceros compared to wild ( high in zoological garden french republic compared to south africa wild in feces ceratotherium simum white rhinoceros bovidae )2018-11-21v4No1 / 277
550amnon high in patiria pectinifera compared to asterias amurensis in city coelomic fluid hokkaido wild starfish japan 2019-08-18v4No1 / 278
639amnoncommon feces, nature reserve, adult, oryctolagus cuniculus, australia, wild, european rabbit2020-08-21v3No1 / 280
729amnon high in wild pan troglodytes troglodytes cameroon central chimpanzee compared to zoological garden captive europe pan troglodytes verus eastern chimpanzee in feces monkey 2021-01-05v3No1 / 288
625amnoncommon feces, costa rica, alouatta palliata, mantled howler monkey, wild, guanacaste conservation area2020-05-16v4No1 / 309
406amnonlower in captive bovidae compared to wild ( high in wild compared to zoological garden in feces bovidae )2018-11-21v4No1 / 319
729amnoncommon feces, gorilla gorilla, monkey, wild, cameroon2021-01-05v3No1 / 321
729amnoncommon feces, monkey, wild, pan troglodytes troglodytes, cameroon, central chimpanzee2021-01-05v3No1 / 336
781amnon high in syncerus caffer caffer cape buffalo compared to bos taurus cattle in feces kenya wild masai mara national park 2021-04-28v4No1 / 349
620amnon high in gorilla gorilla compared to chimpanzee pan troglodytes troglodytes in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 351
620amnon high in wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park compared to united states of america zoological garden pan troglodytes in feces chimpanzee 2020-05-06v4No1 / 351
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to research facility captive in feces canada province of ontario algonquin provincial park peromyscus maniculatus deer mice age 3-5 weeks )2019-07-28v3No1 / 358
759amnoncommon feces, united states of america, sus scrofa, state of alabama, wild, wild boar2021-04-04v4No1 / 362
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in feces papio zambia monkey baboon 2018-11-23v4No1 / 364
620amnon high in wild republic of congo nouabale-ndoki national park compared to united states of america zoological garden in feces gorilla gorilla gorilla 2020-05-06v4No1 / 368
625amnoncommon feces, wild, viet nam, pygathrix nemaeus, red-shanked douc, son tra nature reserve2020-05-16v4No1 / 369
582amnon high in external acoustic meatus ear canal compared to rectum perianal skin in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 374
729amnon high in wild cameroon compared to zoological garden captive europe in feces gorilla gorilla monkey 2021-01-05v3No1 / 383
550amnon high in sea water compared to coelomic fluid wild starfish asterias amurensis in city hokkaido japan 2019-08-18v4No1 / 389
781amnoncommon feces, kenya, wild, giraffe, masai mara national park, giraffa tippelskirchi2021-04-28v4No1 / 400
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in united states of america wild santa catalina island urocyon littoralis urocyon littoralis catalinae santa catalina island fox 2020-01-22v4No1 / 400
781amnoncommon feces, kenya, wild, loxodonta africana, masai mara national park, elephant2021-04-28v4No1 / 419
781amnoncommon feces, kenya, wild, masai mara national park, eudorcas thomsonii, thomson's gazelle2021-04-28v4No1 / 425
781amnon high in aepyceros melampus impala compared to damaliscus lunatus tsessebe in feces kenya wild masai mara national park 2021-04-28v4No1 / 460
620amnon high in chimpanzee pan troglodytes troglodytes compared to gorilla gorilla in feces wild republic of congo nouabale-ndoki national park 2020-05-06v4No1 / 478
454amnoncommon feces, wild, elaphurus davidianus, pere deer, deer, china2019-01-10v4No1 / 480
639amnon high in oryctolagus cuniculus european rabbit compared to lepus europaeus european brown hare in feces nature reserve adult australia wild 2020-08-21v3No1 / 480
781amnoncommon feces, kenya, wild, aepyceros melampus, impala, masai mara national park2021-04-28v4No1 / 510
781amnoncommon feces, kenya, syncerus caffer caffer, cape buffalo, wild, masai mara national park2021-04-28v4No1 / 557
781amnoncommon feces, kenya, wild, masai mara national park, phacochoerus africanus, warthog2021-04-28v4No1 / 564
781amnon high in damaliscus lunatus tsessebe compared to aepyceros melampus impala in feces kenya wild masai mara national park 2021-04-28v4No1 / 599
781amnoncommon feces, kenya, wild, masai mara national park, damaliscus lunatus, tsessebe2021-04-28v4No1 / 622
781amnon high in bos taurus cattle compared to syncerus caffer caffer cape buffalo in feces kenya wild masai mara national park 2021-04-28v4No1 / 642
781amnoncommon feces, kenya, wild, masai mara national park, equus burchellii quagga, zebra2021-04-28v4No1 / 653
729amnon high in zoological garden captive europe compared to wild cameroon in feces gorilla gorilla monkey 2021-01-05v3No1 / 656
781amnoncommon feces, bos taurus, kenya, wild, masai mara national park, cattle2021-04-28v4No1 / 662
781amnoncommon feces, kenya, wild, masai mara national park, tragelaphus oryx, eland2021-04-28v4No1 / 666
592amnoncommon feces, united states of america, ovis aries, commonwealth of pennsylvania, wild, sheep2020-02-18v1No1 / 828
620amnon high in united states of america zoological garden pan troglodytes compared to wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park in feces chimpanzee 2020-05-06v4No1 / 964
620amnon high in united states of america zoological garden compared to wild republic of congo nouabale-ndoki national park in feces gorilla gorilla gorilla 2020-05-06v4No1 / 1019
454amnon high in wild compared to captive in feces elaphurus davidianus pere deer deer china 2019-01-10v4No1 / 1094
454amnon high in captive compared to wild in feces elaphurus davidianus pere deer deer china 2019-01-10v4No1 / 1374
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt triturus cristatus united kingdom )2018-07-30v4No1 / 1834
353amnonlower in captive compared to wild caught Lissotriton vulgaris newts skin ( high in wild compared to research facility in skin adult cambridgeshire newt lissotriton vulgaris united kingdom )2018-07-30v4No1 / 2162

Problems / suggestions? Please email info AT dbbact DOT org