Summary for ontology term: wild boar

Number of annotations with term: 6

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAAGAGCAAGTCTGATGTGAAAGGTGTGGGCTCAACCCGCAAACTGCATTGGAAACTGTTTTTCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAAGGCAAGTCAGAAGTGAAAGCTCGGGGCTCAACCCCGGAACTGCTTTTGAAACTGTCCTACTGGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTACGGCAAGTCAGAAGTGAAATGCCGGGGCTCAACCCCGGAACTGCTTTTGAAACTGTCGAACTAGATTGCAGGAGAGGTAAGTGGAATTCCTAG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTTGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGAGCTGCAAGTCAGATGTGAAATCCCGGGGCTCAACCCCGGAACTGCATTTGAAACTGTAGCCCTTGAGTATCGGAGAGGCAAGCGGAATTCCTAG0.166667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae"TACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGGCTATTAAGTCAGCTGTGAAATCCGGCGGCTCAACCGTCGGCCTGCAGTTGATACTGGTGGCCTTGAGTGCGCGCAGGGGTGTTGGAATTCATGG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAGAGCAAGTCAGCTGTGAAATCCATGGGCTTAACCCATGAACTGCAGTTGAAACTGTTTTTCTTGAGTGAAGTAGAGGTTGGCGGAATTCCGAG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__RoseburiaTACGTATGGTGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGTACGGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCCGGTACTGCATTGGAAACTGTCGGACTAGAGTGTCGGAGGGGTAAGTGGAATTCCTAG0.166667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGCAGGTTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGCCTGCTTGAGTGCGGCAGAGGCAGGCGGAATTTGTGG0.166667
d__ArchaeaTACCTGCAGCCCAAGTGGTGGTCGATTTTATTGAGTCTAAAGCGTTCGTAGCCGGTTTGATAAATCCTTGGGTAAATCGGGAAGCTTAACTTTCCGACTTCCGAGGAGACTGTCAAACTTGGGACCGGGAGAGGCTAGAGGTACTTCTGG0.166667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGCTTTTAAGCGTGTTGTGAAATGCCGCGGCTCAACCGTGGCACTGCAGCGCGAACTGGAGGCCTTGAGTGCGCGGGAGGTAGGCGGAATTCGTGG0.166667

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGACCTTTAAGTGAGATGTGAAATACCCGAGCTCAACTTGGGTGCTGCATTTCAAACTGGAGGTCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCGAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGTCGGGTACGGGCGGGCTGGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGTAGGCGGGACGGCAAGTCAGAAGTGAAAATTATGGGCTCAACTCATAACCTGCTTTTGAAACTGTTGTTCTTGAGTGAAGTAGAGGCAAGCGGAATTCCTAG0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGCGTGCCAAGTCAGCGGTCAAAGTTCCGGGCTCAACCCGGTGATGCCGTTGAAACTGGTGTGCTTGAGTGCGTGCGAGGGAGGCGGAATGCGTTGT0.500000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTCATTGGGTTTAAAGGGTGCGTAGGTTGCCGATTAAGTCAGCGGTGAAAGTCAGTGGCTCAACCATTGAATTGCCGTTGAAACTGGTTGGCTTGAGTACGTACGGGGCAGGCGGAATGCGTGG0.500000
d__BacteriaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGAGGATCAAGCCAGCCGTCAAATAGCGGTGCTCAACACCGTCCAGCGGTTGGAACTGGTTCCCTTGATTGCGGGAGAAGAAGGCGGAACTCGTGGT0.500000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCGGACTGTTAAGTCAGCGGTAAAATCTCGGGGCCCAACCCCGTTGTGCCGTTGAAACTGGCAGCCTTGAGTACACACAAGGATGGTGGAATTCGTCGT0.500000
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__Erysipelotrichaceae;g__TuricibacterTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGCGCGCAGGTGGTTGATTAAGTCTGATGTGAAAGCCCACGGCTTAACCGTGGAGGGTCATTGGAAACTGGTCGACTTGAGTGCAGAAGAGGGAAGTGGAATTCCATG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGGTGCAAGTCTGATGTGAAAGCCCGGGGCTCAACCCTGGAACTGCATTGGAAACTGTACTGCTAGAGTGCAGGAGAGGTAAGCGGAATTCCTAG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Clostridiaceae 1;g__Clostridium sensu strictoTACGTAGGTGGCGAGCGTTGTCCGGATTTACTGGGCGTAAAGGGAGCGTAGGCGGATTTTTAAGTGAGATGTGAAATACTCGGGCTTAACCTGAGTGCTGCATTTCAAACTGGAAGTCTAGAGTGCAGGAGAGGAGAAGGGAATTCCTAG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACTATGGGCTTAACCCATAGCCTGCATTTGAAACTGTAGTTCTTGAGTGCTGGAGAGGCAATCGGAATTCCGTG0.600000
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCCGGACATCAAGTCGGCGGTAAAATCTAAGGGCTCAACCCTTACGAGCCGTCGAAACTGGTGACCTAGAGTGGGCGAGAAGTATGCGGAATGCGAGGT0.545455
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGCAGGCGGCGAAGCAAGCCAGAGGTGAAAACCCGGGGCTCAACCCCGAGGATTGCCTTTGGAACTGTTTTGCTTGAGTGCTGGAGGGGCAGGCGGAATTCCTG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGAGTAGGCGGGTCGGCAAGTTGGGAGTGAAATGTCGGGGCTTAACCCCGGAACTGCTTCCAAAACTGTTGATCTTGAGTGATGGAGAGGCAGGCGGAATTCCTAG0.461538
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAAGAGCAAGTCTGATGTGAAAGGTGTGGGCTCAACCCGCAAACTGCATTGGAAACTGTTTTTCTGGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.444444
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGGCGGTACGGCAAGTCAGAAGTGAAATGCCGGGGCTCAACCCCGGAACTGCTTTTGAAACTGTCGAACTAGATTGCAGGAGAGGTAAGTGGAATTCCTAG0.444444
d__BacteriaTACGTAGGGAGCGAGCGTTATCCGGATTTATTGGGTGTAAAGGGTGCGTAGGCGGCCTTACAGGTCTGTGGTTTAATCCCGAAGCTTAACTTCGGTTCGCCACAGAAACCGTTTGGCTTGAGTATGGTAGAGGCAAGTGGAATTTCTAGT0.444444
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTGAGGAATATTGGTCAATGGGCGTGAGCCTGAACCAGCCAAGTAGCGTGCAGGACGACGGCCCTATGGGTTGTAAACTGCTTTTATGCGGGGATAAAGTTTGCCACGTGTGGCAATTTGCAGGTACCGCATGAATAAGGACCGGCTAATT0.444444
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGGGAATATTGCGCAATGGGGGCAACCCTGACGCAGCAACGCCGCGTGATCGAAGAAGGTCTTCGGATTGTAAAGATCTTTTATCAGGGACGAAGAAGTGACGGTACCTGATGAATAAGCTCCGGCTAACTACGTGCCAGCAGCCGCGG0.444444
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGTGTGTAGGCGGGACAACAAGTCAGATGTGAAACTTATGGGCTTAACCCATAACCTGCATTTGAAACTGCTGTTCTTGAGAGTCGGAGAGGTAGATGGAATTCCCGG0.444444

Annotations:

common ontology terms
term enrichment score
TermScore
wild boar0.740741
state of alabama0.333333
state of vermont0.250000
LOWER IN state of vermont0.250000
sus scrofa0.222222
LOWER IN wild boar0.222222
LOWER IN state of alabama0.200000
pig0.090909
LOWER IN pig0.090909
italy0.086957
wild0.076923
LOWER IN wild0.066667
farm0.047619
LOWER IN farm0.047619
feces0.012658
united states of america0.008048
Fraction of dbbact annotations with this term covered by the query
TermScore
wild boar0.666667
state of vermont0.500000
LOWER IN state of vermont0.500000
LOWER IN wild boar0.333333
state of alabama0.250000
LOWER IN state of alabama0.250000
sus scrofa0.125000
pig0.062500
LOWER IN pig0.062500
italy0.050000
wild0.041667
LOWER IN wild0.041667
farm0.027778
LOWER IN farm0.027778
feces0.006369
united states of america0.004049
Fraction of annotations for the query sequences containing the term
TermScore
feces1.000000
sus scrofa1.000000
wild boar0.833333
united states of america0.666667
state of alabama0.500000
wild0.500000
italy0.333333
farm0.166667
pig0.166667
state of vermont0.166667
LOWER IN state of alabama0.166667
LOWER IN wild0.166667
LOWER IN wild boar0.166667
LOWER IN farm0.166667
LOWER IN pig0.166667
LOWER IN state of vermont0.166667

Problems / suggestions? Please email info AT dbbact DOT org