Summary for ontology term: young adult stage

Number of annotations with term: 10

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Rikenellaceae";g__AlistipesTACGGAGGATTCAAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGTTTGATAAGTTAGAGGTGAAATTTCAGGGCTCAACCCTGAACGTGCCTCTAATACTGTTGAGCTAGAGAGTAGTTGCGGTAGGCGGAATGTATGG0.100000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__PhascolarctobacteriumTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGCTTAATAAGTCGAGCGTGAAACTGCGGGGCTCAACCCCGTATGGCGCTGGAAACTGTTAGGCTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT0.100000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__VeillonellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGCGGATCAGTTAGTCTGTCTTAAAAGTTCGGGGCTTAACCCCGTGATGGGATGGAAACTGCTGATCTAGAGTATCGGAGAGGAAAGTGGAATTCCTAGT0.100000
d__Bacteria;p__"Proteobacteria";c__Epsilonproteobacteria;o__Campylobacterales;f__Campylobacteraceae;g__CampylobacterTACGGAGGGTGCAAGCGTTACTCGGAATCACTGGGCGTAAAGGACGCGTAGGCGGATTATCAAGTCTCTTGTGAAATCCTATGGCTTAACCATAGAACTGCTTGGGAAACTGATAATCTAGAGTGAGGGAGAGGCAGATGGAATTGGTGG0.100000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGACGGGTTTTTAAGTCAGCTGTGAAAGTTTGGGGCTCAACCTTAAAATTGCAGTTGAAACTGGAGACCTTGAGTACGGTTGAGGCAGGCGGAATTCGTGG0.100000
d__BacteriaTACGTAGGATGCAAGCGTTATCCGGAATGACTGGGCGTAAAGGGTGCGTAGGCGGTAAATCAAGTTGGCAGCGTAATTCCGGGGCTTAACCGCGGAACTACTGCCAAAACTGGTGAACTAGAGTGTGTCAGGGGTAAGTGGAATTCCTAG0.100000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAACCTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.100000
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Porphyromonadaceae";g__CoprobacterTACGGAAGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGAAGGATAAGTCAGCGGTGAAATGCTTCAGCTCAACTGGAGAATTGCCGATGAAACTGTTTTTCTAGAGTATAAAAGAGGTATGCGGAATGCGTGG0.100000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGCGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGAATGGCTTTGGAAACTGTGCGGCTAGAGTACCGGAGGGGTAAGCGGAATTCCTAG0.100000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVbTACGTAGGGGGCAAGCGTTATCCGGAATTACTGGGTGTAAAGGGAGAGTAGGCGGCATGGTAAGTTAGATGTGAAAGCCTCGGGCTTAACCTGAGGATTGCATTTAAAACTATCAAGCTAGAGTACAGGAGAGGAAAGCGGAATTCCTAG0.100000

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__AtopobiumTACGTAGGGGGCAAGCGTTATCCGGATTCATTGGGCGTAAAGCGCTCGTAGGCGGTCTGTTAGGTCGGGAGTTAAATCCGGGGGCTCAACCCCCGCTCGCTCCCGATACCGGCAGACTTGAGTTTGGTAGGGGAAGGTGGAATTCCTAGT0.500000
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Veillonellaceae;g__SelenomonasTACGTAGGTGGCGAGCGTTGTCCGGAATCATTGGGCGTAAAGGGAGCGCAGGCGGGCATGTAAGTCTTTCTTAAAAGTGCGGGGCTCAACCCCGTGATGGGAAAGAAACTATGTGTCTTGAGTACAGGAGAGGAAAGCGGAATTCCCAGT0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Actinomycetaceae;g__ActinomycesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTTGTAGGCGGTTTGTCGCGTCTGCCGTGAAATCCTCTGGCTTAACTGGGGGCGTGCGGTGGGTACGGGCAGGCTTGAGTGCGGTAGGGGAGACTGGAACTCCTGG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGCTTGTCGCGTCTGCTGTGAAAACGCGGGGCTCAACTCCGCGCGTGCAGTGGGTACGGGCAGGCTGGAGTGCGGCAGGGGTGGCTGGAATTCCTGG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Streptococcaceae;g__StreptococcusTACGTAGGTCCCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTAGATAAGTCTGAAGTTAAAGGCTGTGGCTTAACCATAGTACGCTTTGGAAACTGTTTAACTTGAGTGCAAGAGGGGAGAGTGGAATTCCATGT0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Bacillales_Incertae Sedis XI;g__GemellaTACGTAGGTGGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGCGCGCGCAGGTGGTTTAATAAGTCTGATGTGAAAGCCCACGGCTCAACCGTGGAGGGTCATTGGAAACTGTTAAACTTGAGTGCAGGAGAGAAAAGTGGAATTCCTAG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Micrococcaceae;g__RothiaTACGTAGGGCGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTTGTAGGCGGTTGGTCGCGTCTGCTGTGAAAGGCTGGGGCTTAACCCTGGTTTTGCAGTGGGTACGGGCTAACTAGAGTGCAGTAGGGGAGACTGGAATTCCTGG0.500000
d__Bacteria;p__"Proteobacteria";c__Deltaproteobacteria;o__Desulfovibrionales;f__Desulfovibrionaceae;g__DesulfovibrioTACGGAGGGTGCAAGCGTTAATCGGAATCACTGGGCGTAAAGCGCACGTAGGCTGTTATGTAAGTCAGGGGTGAAATCCCACGGCTCAACCGTGGAACTGCCCTTGATACTGCACGACTCGAATCCGGGAGAGGGTGGCGGAATTCCAGG0.500000
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__OribacteriumTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAATGGCAAGTCTGAAGTGAAATACCCGGGCTCAACCTGGGAACTGCTTTGGAAACTGTTGTTCTAGAGTGTTGGAGAGGTAAGTGGAATTCCTGG0.500000
d__Bacteria;p__Firmicutes;c__Bacilli;o__LactobacillalesTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTCCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGGAACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAGAACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.173913
d__Bacteria;p__Firmicutes;c__Negativicutes;o__Selenomonadales;f__Acidaminococcaceae;g__PhascolarctobacteriumTACGTAGGTGGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCATGTAGGCGGCTTAATAAGTCGAGCGTGAAACTGCGGGGCTCAACCCCGTATGGCGCTGGAAACTGTTAGGCTTGAGTGCAGGAGAGGAAAGGGGAATTCCCAGT0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAACCTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.166667
d__Bacteria;p__"Bacteroidetes"TACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGGCGGACCTTTAAGTCAGCTGTGAAATACGGCGGCTCAACCGTCGAACTGCAGTTGATACTGGAGGTCTTGAGTGCACACAGGGATGCTGGAATTCATGG0.166667
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__Bacteroidaceae;g__BacteroidesTACGGAGGATCCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGCAGACGGGAGATTAAGTCAGTTGTGAAAGTTTGCGGCTCAACCGTAAAATTGCAGTTGATACTGGTTTCCTTGAGTGCAGTTGAGGCAGGCGGAATTCGTGG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__FusicatenibacterTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGATGTGAAACCCCAGGGCTTAACCCTGGGACTGCATTGGAAACTGTCTGGCTCGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumTACGTAGGTCCCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.166667
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Pasteurellales;f__PasteurellaceaeTACGGAGGGTGCGAGCGTTACTCGGAATAACTGGGCGTAAAGGGCACGCAGGCGGTGACTTAAGTGAGGTGTGAAAGCCCCGGGCTTAACCTGGGAATTGCATTTCATACTGGGTCGCTAGAGTACTTTAGGGAGGGGTAGAATTCCACG0.166667
d__Bacteria;p__"Proteobacteria";c__Betaproteobacteria;o__Burkholderiales;f__Sutterellaceae;g__ParasutterellaTACGTAGGGTGCGAGCGTTACTCGGAATTACTGGGCGTAAAGGGTGCGCAGGCGGTTGAGTAAGACAGATGTGAAATCCCCGAGCTTAACTCGGGAATGGCATATGTGACTGCTCGACTAGAGTGTGTCAGAGGGAGGTGGAATTCCACG0.166667
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTCCCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAAGACAAGTTGGAAGTGAAATCTATGGGCTCAACCCATAAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.166667

Annotations:

common ontology terms
Exp. ID User ID Description Date Region Flag Sequences
430amnondominant feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 18
438amnondominant feces, homo sapiens, china, young adult stage2018-12-30v4No1 / 19
484amnondominant feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 20
575amnonhigh freq. in professional martial arts athletes (dominant feces, homo sapiens, adult, high physical activity, china, athlete, young adult stage)2020-01-05v3No1 / 21
575amnoncommon in professional martial arts athletes (common feces, homo sapiens, adult, high physical activity, china, athlete, young adult stage)2020-01-05v3No1 / 63
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 76
430amnoncommon feces, homo sapiens, united states of america, city, adult, state of arizona, 20-year-old human stage2018-12-15v4No1 / 87
438amnoncommon feces, homo sapiens, china, young adult stage2018-12-30v4No1 / 101
438amnonhigher in students and soldiers age 19-24 compared to older adults ( high in soldiers young adult stage compared to adult age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage in feces homo sapiens china )2018-12-30v4No1 / 238
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617

Problems / suggestions? Please email info AT dbbact DOT org