Summary for ontology term: zea mays

Number of annotations with term: 83

Top positive-associated sequence

Taxonomy Sequence Recall
d__BacteriaTACAGAGGAGCCAAGCGTTGTCCGGATTGACTGGGCGTAAAGCGCACGCAGGCGGATGTGCGCGTGGGGTGTGAAATCTGGCCGCTTAACGGCCAGGCGCCATCCCATACGGCACGTCTGGAGCAATGCAGAGGTCGGTGGAATTGCCGG0.037975
d__BacteriaTACGTAGGGTCCGAGCGTTGTCCGGAGTTACTGGGCGTAAAGCGCGCGCAGGCGGCTCGTTAAGACCGGCGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCGTTGGTGACTGGCGGGCTTGAAGCCAGCAGGGGCAGGTGGAATTCCCGG0.037975
d__Bacteria;p__"Acidobacteria";c__Acidobacteria_Gp6;g__Gp6TACAGAGGTGGCAAGCGTTGTTCGGAATTACTGGGCGTAAAGGGCGCGTAGGTGGCCTTTTGAGTCAGACGTGAAATCCCCCGGCTTAACCTGGGAACTGCGTCTGATACTGGAAGGCTCGAGTTCGGGAGAGGGATGTGGAATTCCAGG0.037975
d__Bacteria;p__candidate division WPS-1;g__WPS-1_genera_incertae_sedisGACAGAGGTGCCGAGCGTTAGGCGGAATCACTGGGCTTAAAGCGTGTGTAGGCGGACCGTTAAGTACCTTGTGAAATCCCACGGCTCAACCGTGGAACGGCTGGGTATACTGGCGGTCTTGAGCCACCTAGGGGCGAGCGGAACAAGCGG0.037975
d__Bacteria;p__"Proteobacteria";c__GammaproteobacteriaTACAGAGGGTGCAAGCGTTAATCGGATTTACTGGGCGTAAAGCGTGTGTAGGTGGCTACCTAAGTCGGTTGTGAAATCCCTGGGCTCAACCTGGGAATTGCAGTCGATACTGGGTAGCTCGAGTTCGGTAGAGGGTGACGGAATTCCCGG0.037975
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGCGCGTGTAGGCGGCCAGGTAGGTCCGTTGTGAAATCTCGAGGCTCAACTTCGAGCGGTCGACGGAAACCATCTGGCTAGAGTCCGGAAGAGGAGAGTAGAATTCCTGG0.037975
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGATTTACTGGGCGTAAAGCGCGTGTAGGCGGAGGGGAAAGTCCGGTGTGAAAGCCCCCGGCTCAACCGGGGAAGGTCGCTGGAAACTCCCCCCCTTGAGGACGACAGAGGGAAGTGGAATTGCTGG0.037975
d__BacteriaAACGTAGGTCCCGAGCGTTATCCGGATTTACTGGGCGTAAAGCGCGTTCAGGCGGCTTGGCAAGTCGGGCATGAAATCTCTCGGCTCAACCGGGAGGGGCTGTCCGAAACTGCTGAGCTTGAGGGCAGTAGAGGGTGGTGGAATTCCGGG0.037975
d__Bacteria;p__"Proteobacteria";c__Alphaproteobacteria;o__SphingomonadalesTACGGAGGGGGCTAGCGTTGTTCGGAATTACTGGGCGTAAAGCGCACGTAGGCGGCCATTTAAGTCAGAGGTGAAAGCCTGGAGCTCAACTCCAGAACTGCCTTTGAGACTGGATGGCTAGAATCTTGGAGAGGCGAGTGGAATTCCGAG0.037975
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__ActinomycetalesTACGTAGGGTGCAAGCGTTGTCCGGAATTATTGGGCGTAAAGAGCTCGTAGGCGGTTTGTTACGTCGGATGTGAAAACCCGAGGCTTAACCTCGGGCCTGCATTCGATACGGGCAGACTCGAGTGTGGTAGGGGAGACTGGAACTCCTGG0.037975

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__"Proteobacteria";c__Gammaproteobacteria;o__Xanthomonadales;f__XanthomonadaceaeTACGAAGGGTGCAAGCGTTACTCGGAATTACTGGGCGTAAAGCGTGCGTAGGTGGTTCGTTAAGTCTGATGTGAAAGCCCTGGGCTCAACCTGGGAATGGCATTGGATACTGGCGGACTGGAGTGCGGTAGAGGATGGCGGAATTCCCGG0.500000
d__BacteriaGACGTAGGGGGCGAGCGTTGTCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGCCCGGTAAGTCGGGTGTGAAATCCTGGGGCTCAACCCCAGGACTGCACTCGATACTGCCAGGCTAGAGGTAGGTAGGGGAGATCGGAATTCCTGG0.500000
d__BacteriaTACGAAGGTGGCAAGCGTTACTCGGAATTACTAGGCGTAAAGGGCAGGTAGGTGGTTCGGTAAGTCTGTTGTGTAAGCTCCCGGCTTAACTGGGAGAGGTCAACGGAAACTACCGGACTTGAGTATAGGAGAGGTTACTGGAATTCCCGG0.500000
d__Archaea;p__"Thaumarchaeota";o__Nitrososphaerales;f__Nitrososphaeraceae;g__NitrososphaeraTACCAGCACCCCGAGTGGTCGGGACGATTATTGGGCCTAAAGCATCCGTAGCTTGTTCTGCAAGTCCTCCGTTAAATCCACCTGCTCAACAGATGGGCTGCGGGGGATACTACAGGGCTAGGAGGCGGGAGAGGCAAGCGGTACTCAGTG0.500000
d__Bacteria;p__"Proteobacteria"TACAGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAGCGCACGTAGGTGGCGACGTAAGTCGGGTGTGAAATCCCTGGGCTCAACCTGGGAACGGCATTCGAGACTGTGTTGCTGGAGTACGGAAGAGGAGGGCGGAATTCCCGG0.500000
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Actinomycetales;f__Nocardioidaceae;g__NocardioidesTACGTAGGGTGCGAGCGTTGTCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTTGTCGCGTCGGGAGTGAAAACACTGGGCTTAACTCAGTGCTTGCTTCCGATACGGGCAGACTAGAGGTATTCAGGGGAGAACGGAATTCCTGG0.500000
d__Bacteria;p__"Actinobacteria";c__ActinobacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATCATTGGGCGTAAAGAGCGTGTAGGCGGCTTCGTCAGTCCGTTGTGAAAGTCCAGGGCTCAACCCTGGAATGCCGATGGATACTGCGGAGCTAGAGTCCGGAAGAGGCGAGTGGAATTCCTGG0.500000
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__FlavobacteriumTACGGAGGATCCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGTAGGCGGGTTTATAAGTCAGTGGTGAAAGCCCATCGCTCAACGATGGAACGGCCATTGATACTGTAGATCTTGAATTATTAGGAAGTAACTAGAATATGTAG0.500000
d__BacteriaTACGGAGGGCGCAAGCGTTGTTCGGAATCATTGGGCGTAAAGCGCGTGTAGGCGGCTTGGCAAGTCGAGTGTGAAATCCCGGGGCTCAACCCCGGAAGGTCGCTCGAAACTGCCTCGCTCGAGTCCCGGAGAGGAAGGCGGAATTCCCGG0.500000
d__Bacteria;p__"Bacteroidetes";c__Flavobacteriia;o__"Flavobacteriales";f__Flavobacteriaceae;g__FlavobacteriumTACGGAGGATCCAAGCGTTATCCGGAATCATTGGGTTTAAAGGGTCCGTAGGCGGTTTTGTAAGTCAGTGGTGAAAGCCCATCGCTCAACGGTGGAACGGCCATTGATACTGCAAGACTTGAATTATTAGGAAGTAACTAGAATATGTAG0.500000

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__BacteriaGACGTAGGGAGCGAGCGTTGTCCGGATTCATTGGGCGTAAAGAGCGCGTAGGCGGCCGTGCAAGTCGGTTGTGAAATCCCGGGGCTCAACCCCGGGACTGCGTCCGATACTGCACGGCTCGAGGCAGGTAGGGGAGAGTGGAATTCCCGG0.393939
d__Archaea;p__"Thaumarchaeota";o__Nitrososphaerales;f__Nitrososphaeraceae;g__NitrososphaeraTACCAGCACCCCGAGTGGTCGGGACGATTATTGGGCCTAAAGCATCCGTAGCCGGTTTTACAAGTCCTCCGTTAAATCCAACTGCTTAACAGATGGGCTGCGGAGGATACTATAAGACTAGGAGGCAGGAGAGGCAAGCGGTACTCAGTG0.344828
d__Bacteria;p__"Chloroflexi"AACGTAGGAGGCAAGCGTTATCCGGATTCACTGGGCTTAAAGCGCGTGCAGGCGGTCCGGTACGTCGGACGTGAAAGCTCCCGGCTCAACTGGGAGAGGCCGTTCGATACTGCCGGACTCGAGGGCAGGAGAGGGAGGTGGAATTCCGGG0.315789
TACGTAGGGGGCGAGCGTTGTCCGGATTGACTGGGCGTAAAGCGCGCGCAGGCGGCCTGACGCGCCGGCCGTGAAATCCCCCGGCTCAACCGGGGCGGGTCGGTCGGGACGGTCAGGCTGGAGGGTGTCAGAGGGGGGTGGAATGCCGCG0.294118
d__Archaea;p__"Thaumarchaeota";o__Nitrososphaerales;f__Nitrososphaeraceae;g__NitrososphaeraTACCAGCACCCCGAGTGGTCGGGACGATTATTGGGCCTAAAGCATCCGTAGCCGGCCTTACAAGTCCTCCGTTAAATCCAGCTGCTTAACAGATGGGCTGCGGAGGATACTATAAGACTAGGAGGCAGGAGAGGCAAGCGGTACTCAGTG0.293333
d__BacteriaTACGTAGGGACCGAGCGTTGTCCGGATTTATTGGGCGTAAAGAGCTCGTAGGCGGCCGCGCAAGTCGATTGTGAAAACTCGGGGCTCAACCCCGAGCCTGCGTTCGATACTGCACGGCTAGAGTCTGGTAGGGGGATCTGGAATTCCTGG0.280702
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAAGGCTTGTAGGTGGCCACGCCAAGTCGGATGTGAAATCTCCCGGCTCAACTGGGAGGGGTCATTCGATACTGGCGGGCTCGAGGCCGGTAGGGGGAAGTGGAATTCCCG0.280374
d__BacteriaTACGTAGGTGGCGAGCGTTGTCCGGATTTATTGGGCGTAAAGCGCGCGCAGGCGGTCCGTTACGTCCGTTGTGAAAGCTCCCGGCTCAACTGGGAGAGGTCTTCGGATACGGGCGGACTCGAGGAAGGTAGAGGAAGGTGGAATTCCCGG0.275362
d__Bacteria;p__"Verrucomicrobia";c__Spartobacteria;g__Spartobacteria_genera_incertae_sedisTACAGAGGTCTCAAGCGTTGTTCGGATTCATTGGGCGTAAAGGGTGCGTAGGCGGCGCGGTAAGTCGGGTGTGAAATTTCGAGGCTTAACTTCGAAACTGCATTCGATACTGCCGTGCTTGAGGACTGGAGAGGAGACTGGAATTTACGG0.272727
d__BacteriaGACGAACCGTGCGAACGTTGTTCGGATTCACTGGGCTTAAAGGGCGCGTAGGCGGTTGTCCACGTCCGGGGTGAAAGCTTTCGGCTTAACCGGAAAAGGGCCTTGGATACGGGGCAACTCGAGGGAGGTAGGGGCAGGTGGAACTTCCGG0.270833

Annotations:

common ontology terms
term enrichment score
TermScore
zea mays0.837877
united states0.419580
nicollet soil series0.419580
des moines0.419580
triticum aestivum0.379856
agricultural field0.355401
iowa0.346821
glycine max0.309392
shaanxi province0.278261
loess plateau0.244275
cambisol0.204082
ames0.194175
kanawha0.194175
subsurface drainage0.194175
kelley0.194175
silt loam0.178771
depth (soil) 60-90cm0.178218
depth (soil) 0-15cm0.163636
preston flats0.161616
luvisol0.161616
grand river watershed0.161616
rare charitable research reserve0.161616
red soil0.161616
heilongjiang province0.149533
black soil0.149533
mollisol0.149533
cambridge0.130081
soil0.128860
province of ontario0.122137
depth (soil) 15-30cm0.118812
depth (soil) 30-60cm0.118812
hunan province0.115108
zea mays subsp. mays0.107527
corn0.102041
whole plant0.102041
LOWER IN zea mays0.092593
ph 7.40.087912
maize field0.087912
depth 0-40cm0.087912
bernburg0.087912
crop rotation0.087912
ph 7.70.084211
agricultural feature0.082051
ph 7.60.074766
LOWER IN depth (soil) 60-90cm0.067416
depth 40-100cm0.067416
depth 100-300cm0.067416
robinia pseudoacacia0.067416
reforestation0.067416
LOWER IN reforestation0.067416
LOWER IN robinia pseudoacacia0.067416
depth 0-15cm0.067416
depth 15-30cm0.067416
germany0.067039
ph<60.065217
ph>60.065217
LOWER IN depth (soil) 0-15cm0.065217
npk fertilizer0.063158
ph<50.063158
ph>50.063158
israel0.059524
LOWER IN agricultural field0.050420
canada0.049536
non-manured soil0.045977
LOWER IN non-manured soil0.045977
ph 7.10.045977
ph 8.10.045977
ph 8.30.045977
ph 6.20.045977
lower saxony0.045977
sandy soil0.045977
LOWER IN depth 0-40cm0.045977
LOWER IN rapeseed pre-crop0.045977
maize pre-crop0.045977
loess chernozem0.045977
mouldboard plough0.045977
LOWER IN maize pre-crop0.045977
rapeseed pre-crop0.045977
cultivator tillage0.045977
bretagne region0.045977
depth 30-45cm0.045977
fermented corn0.045977
LOWER IN fresh corn0.045977
LOWER IN manured soil0.044944
manured soil0.044944
ph 7.50.044944
ph 6.70.044944
ph 7.90.044944
LOWER IN brassica napus0.044944
brassica napus0.044944
conservation tillage0.044944
conventional tillage0.043956
ph 50.043011
ph 60.042105
LOWER IN triticum aestivum0.038095
french republic0.036036
china0.031123
LOWER IN depth 40-100cm0.023529
LOWER IN depth 100-300cm0.023529
10 years0.023529
Fraction of dbbact annotations with this term covered by the query
TermScore
zea mays0.800000
cambisol0.666667
non-manured soil0.500000
LOWER IN non-manured soil0.500000
united states0.500000
nicollet soil series0.500000
ames0.500000
des moines0.500000
ph 7.40.500000
depth (soil) 60-90cm0.500000
LOWER IN depth (soil) 60-90cm0.500000
kanawha0.500000
ph 7.10.500000
ph 8.10.500000
ph 8.30.500000
subsurface drainage0.500000
ph 6.20.500000
kelley0.500000
lower saxony0.500000
sandy soil0.500000
maize field0.500000
depth 0-40cm0.500000
shaanxi province0.500000
depth 40-100cm0.500000
depth 100-300cm0.500000
LOWER IN depth 40-100cm0.500000
LOWER IN depth 0-40cm0.500000
LOWER IN depth 100-300cm0.500000
LOWER IN rapeseed pre-crop0.500000
maize pre-crop0.500000
bernburg0.500000
loess chernozem0.500000
mouldboard plough0.500000
crop rotation0.500000
LOWER IN maize pre-crop0.500000
rapeseed pre-crop0.500000
cultivator tillage0.500000
robinia pseudoacacia0.500000
reforestation0.500000
10 years0.500000
LOWER IN 10 years0.500000
LOWER IN reforestation0.500000
LOWER IN robinia pseudoacacia0.500000
20 years0.500000
LOWER IN 20 years0.500000
LOWER IN 30 years0.500000
30 years0.500000
bretagne region0.500000
depth 0-15cm0.500000
preston flats0.500000
luvisol0.500000
grand river watershed0.500000
rare charitable research reserve0.500000
depth 15-30cm0.500000
depth 30-45cm0.500000
LOWER IN depth 15-30cm0.500000
LOWER IN depth 0-15cm0.500000
zea mays subsp. mays0.500000
fermented corn0.500000
days 2-300.500000
LOWER IN fresh corn0.500000
fresh corn0.500000
LOWER IN fermented corn0.500000
days 900.500000
red soil0.500000
triticum aestivum0.363636
heilongjiang province0.333333
black soil0.333333
mollisol0.333333
ph<60.333333
LOWER IN ph&gt;60.333333
ph>60.333333
LOWER IN ph&lt;60.333333
LOWER IN manured soil0.333333
manured soil0.333333
ph 7.50.333333
depth (soil) 0-15cm0.333333
iowa0.333333
depth (soil) 15-30cm0.333333
depth (soil) 30-60cm0.333333
ph 7.70.333333
LOWER IN depth (soil) 0-15cm0.333333
ph 6.70.333333
ph 7.90.333333
loess plateau0.333333
LOWER IN brassica napus0.333333
brassica napus0.333333
conservation tillage0.333333
corn0.333333
whole plant0.333333
LOWER IN time 00.333333
day 00.333333
LOWER IN day 00.333333
glycine max0.285714
npk fertilizer0.250000
LOWER IN npk fertilizer0.250000
agricultural field0.250000
conventional tillage0.250000
ph<50.250000
LOWER IN ph&gt;50.250000
Fraction of annotations for the query sequences containing the term
TermScore
soil0.915663
zea mays0.879518
agricultural field0.614458
triticum aestivum0.397590
china0.385542
united states0.361446
nicollet soil series0.361446
des moines0.361446
iowa0.361446
glycine max0.337349
silt loam0.192771
loess plateau0.192771
shaanxi province0.192771
ames0.120482
kanawha0.120482
subsurface drainage0.120482
kelley0.120482
cambisol0.120482
depth (soil) 0-15cm0.108434
depth (soil) 60-90cm0.108434
heilongjiang province0.096386
agricultural feature0.096386
black soil0.096386
mollisol0.096386
preston flats0.096386
luvisol0.096386
grand river watershed0.096386
canada0.096386
province of ontario0.096386
cambridge0.096386
rare charitable research reserve0.096386
hunan province0.096386
red soil0.096386
depth (soil) 15-30cm0.072289
depth (soil) 30-60cm0.072289
germany0.072289
LOWER IN zea mays0.060241
zea mays subsp. mays0.060241
corn0.060241
whole plant0.060241
israel0.060241
ph 7.40.048193
ph 7.70.048193
maize field0.048193
depth 0-40cm0.048193
bernburg0.048193
ph 7.60.048193
crop rotation0.048193
ph<60.036145
npk fertilizer0.036145
ph>60.036145
LOWER IN depth (soil) 0-15cm0.036145
LOWER IN depth (soil) 60-90cm0.036145
depth 40-100cm0.036145
depth 100-300cm0.036145
LOWER IN agricultural field0.036145
robinia pseudoacacia0.036145
reforestation0.036145
LOWER IN reforestation0.036145
LOWER IN robinia pseudoacacia0.036145
depth 0-15cm0.036145
depth 15-30cm0.036145
ph<50.036145
ph>50.036145
non-manured soil0.024096
LOWER IN manured soil0.024096
manured soil0.024096
LOWER IN non-manured soil0.024096
ph 7.50.024096
ph 7.10.024096
ph 8.10.024096
ph 8.30.024096
ph 6.20.024096
ph 60.024096
ph 6.70.024096
ph 7.90.024096
rhizosphere0.024096
ph 50.024096
lower saxony0.024096
sandy soil0.024096
LOWER IN depth 0-40cm0.024096
LOWER IN brassica napus0.024096
LOWER IN rapeseed pre-crop0.024096
maize pre-crop0.024096
loess chernozem0.024096
conventional tillage0.024096
mouldboard plough0.024096
LOWER IN maize pre-crop0.024096
brassica napus0.024096
rapeseed pre-crop0.024096
cultivator tillage0.024096
conservation tillage0.024096
LOWER IN triticum aestivum0.024096
bretagne region0.024096
french republic0.024096
depth 30-45cm0.024096
fermented corn0.024096
LOWER IN fresh corn0.024096
LOWER IN ph&gt;60.012048
LOWER IN ph&lt;60.012048
Exp. ID User ID Description Date Region Flag Sequences
768sheryoDom inant in maize fields in Brittany, France (dominant zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1
412amnondominant soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 1
801sheryoDominant in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (dominant united states, ph 7.5, nicollet soil series, depth (soil) 0-15cm, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 3
801sheryoDominant at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (dominant subsurface drainage, ph 6.2, depth (soil) 0-15cm, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 3
837sheryoDominant in agricultural field at depths 0-40cm, shaanxi, China (dominant depth 0-40cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 3
801sheryoDominant at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (dominant ph 6, depth (soil) 15-30cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 4
801sheryoDominant at depth 60-90cm in corn and soybean agriculture fields, Iowa USA (dominant depth (soil) 60-90cm, ph 7.9, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-16v4No1 / 4
414amnondominant soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 5
801sheryoDominant at depth 0-15cm in corn agriculture fields, Iowa USA (dominant kanawha, ph 7.1, nicollet soil series, depth (soil) 0-15cm, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 5
801sheryoDominant at depth 30-60cm in corn and soybean agriculture fields, Iowa USA (dominant ph 6.7, depth (soil) 30-60cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-16v4No1 / 5
306amnonincreases after 90 days of fermentation of insiled whole plant corn ( high in fermented corn days 90 compared to fresh corn day 0 in zea mays subsp. mays corn whole plant israel )2018-03-19v4No1 / 5
414amnondominant soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 6
801sheryoDominant at depth 15-30cm in corn agriculture fields, Iowa USA (dominant kanawha, depth (soil) 15-30cm, nicollet soil series, ph 7.7, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 6
801sheryoDominant at depth 60-90cm in corn agriculture fields, Iowa USA (dominant depth (soil) 60-90cm, ph 8.3, kanawha, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 6
837sheryoDominant in agricultural field at depths 100-300cm, shaanxi, China (dominant depth 100-300cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 6
842sheryoDominant in soil depth of 0-15cm in a zea mays agricultural field in Ontario, Canada (dominant depth 0-15cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 6
842sheryoDominant in soil depth of 15-30cm in a zea mays agricultural field in Ontario, Canada (dominant depth 15-30cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 6
801sheryoDominant in soybean and corn agriculture fields at depth 60-90cm, Iowa USA (dominant ph 7.7, depth (soil) 60-90cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 8
837sheryoDominant in agricultural field at depths 40-100cm, shaanxi, China (dominant depth 40-100cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 8
801sheryoDominant in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (dominant ph 7.4, depth (soil) 15-30cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 9
801sheryoDominant in soybean and corn agriculture fields at depth 30-60cm, Iowa USA (dominant depth (soil) 30-60cm, ph 7.4, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 9
801sheryoDominant at depth 30-60cm in corn agriculture fields, Iowa USA (dominant ph 8.1, depth (soil) 30-60cm, kanawha, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 9
306amnonhigh freq. at whole plant corn at time 0 (dominant zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 9
412amnondominant soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 11
842sheryoDominant in soil depth of 30-45cm in a zea mays agricultural field in Ontario, Canada (dominant depth 30-45cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 12
761sheryoDominant in maize rhizosphere sandy soil maize field in Germany (dominant zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 13
306amnonincreases after 2-30 days of fermentation of insiled whole plant corn ( high in fermented corn days 2-30 compared to fresh corn time 0 in zea mays subsp. mays corn whole plant israel )2018-03-19v4No1 / 19
764sheryoHigh in rapeseed pre-crop compared to maize pre-crop in leoss soil in wheat field grown under conservation tillage and crop rotation in germany ( high in brassica napus rapeseed pre-crop compared to maize pre-crop zea mays in ph 7.6 crop rotation cultivator tillage conservation tillage triticum aestivum soil germany bernburg )2021-04-12v3No1 / 30
764sheryoHigh in maize pre-crop compared to rapeseed pre-crop in leoss soil in wheat field grown under conservation tillage and crop rotation in germany ( high in maize pre-crop zea mays compared to rapeseed pre-crop brassica napus in ph 7.6 crop rotation cultivator tillage conservation tillage triticum aestivum soil germany bernburg )2021-04-12v3No1 / 31
837sheryoHigher in agricultural field at depths 40-100cm compared to 0-40cm, shaanxi, China ( high in depth 40-100cm compared to depth 0-40cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 42
306amnondecreases after 2-30 days of fermentation of insiled whole plant corn ( high in fresh corn day 0 compared to fermented corn in zea mays subsp. mays corn whole plant israel )2018-03-19v4No1 / 45
837sheryoHigher in agricultural field at depths 100-300cm compared to 0-40cm, shaanxi, China ( high in depth 100-300cm compared to depth 0-40cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 81
764sheryoHigh in rapeseed pre-crop compared to maize pre-crop leoss soil in wheat field grown under conventional tillage and crop rotation in germany ( high in brassica napus rapeseed pre-crop compared to maize pre-crop zea mays in soil germany bernburg loess chernozem conventional tillage mouldboard plough ph 7.6 triticum aestivum crop rotation )2021-04-12v3No1 / 91
837sheryoHigher in agricultural field at depths0-40cm compared to 40-100cm, shaanxi, China ( high in depth 0-40cm compared to depth 40-100cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 95
306amnoncommon at whole plant corn at time 0 (common zea mays subsp. mays, corn, whole plant, israel)2018-03-19v4No1 / 96
414amnon high in non-manured soil compared to manured soil in agricultural feature soil zea mays glycine max triticum aestivum heilongjiang province black soil mollisol china 2018-11-26v4No1 / 104
414amnon high in manured soil compared to non-manured soil in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 118
764sheryoHigh in maize pre-crop compared to rapeseed pre-crop leoss soil in wheat field grown under conventional tillage and crop rotation in germany ( high in maize pre-crop zea mays compared to brassica napus rapeseed pre-crop in soil germany bernburg loess chernozem conventional tillage mouldboard plough ph 7.6 triticum aestivum crop rotation )2021-04-12v3No1 / 173
801sheryoHigher at depth 60-90cm compared to depth 0-15cm in corn and soybean agriculture fields, Iowa USA ( high in depth (soil) 60-90cm compared to depth (soil) 0-15cm in subsurface drainage glycine max kelley nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-16v4No1 / 321
801sheryoHigher at depth 60-90cm compared to depth 0-15cm in corn agriculture fields, Iowa USA ( high in depth (soil) 60-90cm compared to depth (soil) 0-15cm in kanawha nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-15v4No1 / 369
801sheryoHigher at depth 60-90cm compared to depth0-15cm in soybean and corn agriculture fields , Iowa USA ( high in depth (soil) 60-90cm compared to depth (soil) 0-15cm in united states nicollet soil series glycine max zea mays ames des moines iowa agricultural field soil )2021-06-15v4No1 / 386
412amnonhigh in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in manured soil compared to non-manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 395
837sheryoHigher in agricultural field at depths 0-40cm compared to 100-300cm, shaanxi, China ( high in depth 0-40cm compared to depth 100-300cm in agricultural field zea mays triticum aestivum silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 431
412amnonlower in pig manured soil with wheat-maize rotation compared to non-manured soil ( high in non-manured soil compared to manured soil in soil hunan province red soil cambisol zea mays triticum aestivum china )2018-11-26v4No1 / 437
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in kanawha nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-15v4No1 / 501
801sheryoCommon at depth 15-30cm in corn agriculture fields, Iowa USA (common kanawha, depth (soil) 15-30cm, nicollet soil series, ph 7.7, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 598
842sheryoHigher in soil depth 15-30cm compared soil depth of 0-15cm to in a zea mays agricultural field in Ontario, Canada ( high in depth 15-30cm compared to depth 0-15cm in zea mays preston flats agricultural field soil luvisol grand river watershed canada province of ontario cambridge rare charitable research reserve )2021-11-14v3No1 / 598
801sheryoCommon in soybean and corn agriculture fields at depth 60-90cm, Iowa USA (common ph 7.7, depth (soil) 60-90cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 650
801sheryoCommon at depth 60-90cm in corn and soybean agriculture fields, Iowa USA (common depth (soil) 60-90cm, ph 7.9, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-16v4No1 / 667
842sheryoCommon in soil depth of 30-45cm in a zea mays agricultural field in Ontario, Canada (common depth 30-45cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 676
801sheryoCommon at depth 30-60cm in corn agriculture fields, Iowa USA (common ph 8.1, depth (soil) 30-60cm, kanawha, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 703
412amnon high in ph<5 compared to ph>5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 706
761sheryoCommon in maize rhizosphere sandy soil maize field in Germany (common zea mays, rhizosphere, ph 5, lower saxony, sandy soil, germany, maize field)2021-04-06v3No1 / 742
801sheryoCommon at depth 30-60cm in corn and soybean agriculture fields, Iowa USA (common ph 6.7, depth (soil) 30-60cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 760
801sheryoCommon at depth 60-90cm in corn agriculture fields, Iowa USA (common depth (soil) 60-90cm, ph 8.3, kanawha, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 764
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph<5, china2018-11-26v4No1 / 823
801sheryoCommon in soybean and corn agriculture fields at depth 30-60cm, Iowa USA (common depth (soil) 30-60cm, ph 7.4, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 839
801sheryoCommon at depth 15-30cm in corn and soybean agriculture fields, Iowa USA (common ph 6, depth (soil) 15-30cm, subsurface drainage, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 841
412amnoncommon soil, hunan province, red soil, cambisol, zea mays, triticum aestivum, ph>5, china2018-11-26v4No1 / 856
801sheryoCommon at depth 0-15cm in corn agriculture fields, Iowa USA (common kanawha, ph 7.1, nicollet soil series, depth (soil) 0-15cm, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 862
801sheryoCommon in soybean and corn agriculture fields at depth 15-30cm, Iowa USA (common ph 7.4, depth (soil) 15-30cm, united states, nicollet soil series, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 905
842sheryoHigher in soil depth of 0-15cm compared to soil depth 15-30cm in a zea mays agricultural field in Ontario, Canada ( high in depth 0-15cm compared to depth 15-30cm in zea mays preston flats agricultural field soil luvisol grand river watershed canada province of ontario cambridge rare charitable research reserve )2021-11-14v3No1 / 924
842sheryoCommon in soil depth of 15-30cm in a zea mays agricultural field in Ontario, Canada (common depth 15-30cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 944
414amnon high in ph<6 npk fertilizer compared to ph>6 in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 963
412amnon high in ph>5 compared to ph<5 in soil hunan province red soil cambisol zea mays triticum aestivum china 2018-11-26v4No1 / 1005
768sheryoCommon in maize fields in Brittany, France (common zea mays, maize field, cambisol, bretagne region, french republic, soil)2021-04-18v3No1 / 1034
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in corn and soybean agriculture fields, Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in subsurface drainage glycine max kelley nicollet soil series des moines united states agricultural field iowa zea mays soil )2021-06-16v4No1 / 1036
801sheryoHigher at depth 0-15cm compared to depth 60-90cm in soybean and corn agriculture fields , Iowa USA ( high in depth (soil) 0-15cm compared to depth (soil) 60-90cm in united states nicollet soil series glycine max zea mays ames des moines iowa agricultural field soil )2021-06-15v4No1 / 1102
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, npk fertilizer, ph<6, china2018-11-26v4No1 / 1105
842sheryoCommon in soil depth of 0-15cm in a zea mays agricultural field in Ontario, Canada (common depth 0-15cm, zea mays, preston flats, agricultural field, soil, luvisol, grand river watershed, canada, province of ontario, cambridge, rare charitable research reserve)2021-11-14v3No1 / 1147
801sheryoCommon at depth 0-15cm in corn and soybean agriculture fields, Iowa USA (common subsurface drainage, ph 6.2, depth (soil) 0-15cm, glycine max, kelley, nicollet soil series, des moines, united states, agricultural field, iowa, zea mays, soil)2021-06-15v4No1 / 1202
837sheryoCommon in agricultural field at depths 100-300cm, shaanxi, China (common depth 100-300cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1220
801sheryoCommon in soybean and corn agriculture fields at depth 0-15cm, Iowa USA (common united states, ph 7.5, nicollet soil series, depth (soil) 0-15cm, glycine max, zea mays, ames, des moines, iowa, agricultural field, soil)2021-06-15v4No1 / 1226
837sheryoCommon in agricultural field at depths 40-100cm, shaanxi, China (common depth 40-100cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1263
414amnoncommon soil, heilongjiang province, agricultural feature, triticum aestivum, glycine max, zea mays, black soil, mollisol, ph>6, china2018-11-26v4No1 / 1282
414amnon high in ph>6 compared to ph<6 npk fertilizer in soil heilongjiang province agricultural feature triticum aestivum glycine max zea mays black soil mollisol china 2018-11-26v4No1 / 1451
837sheryoCommon in agricultural field at depths 0-40cm, shaanxi, China (common depth 0-40cm, agricultural field, zea mays, triticum aestivum, silt loam, china, loess plateau, shaanxi province, soil)2021-09-26v4No1 / 1470
837sheryoHigher in soil of agricultural feild compared to after 20 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 20 years robinia pseudoacacia reforestation in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2892
837sheryoHigher in soil of agricultural feild compared to after 30 years reforestation with Black locust trees , shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to robinia pseudoacacia 30 years reforestation in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 2927
837sheryoHigher in soil in agricultural feild compared after 10 years reforestation with Black locust trees, shaanxi, China ( high in triticum aestivum zea mays agricultural field compared to 10 years reforestation robinia pseudoacacia in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 2994
837sheryoHigher in soil after 10 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 10 years compared to agricultural field wheat zea mays in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 3932
837sheryoHigher in soil after 30 years reforestation with Black locust trees compared to agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 30 years compared to zea mays triticum aestivum agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-27v4No1 / 5596
837sheryoHigher in soil after 20 years reforestation with Black locust trees compared agricultural feild, shaanxi, China ( high in robinia pseudoacacia reforestation 20 years compared to triticum aestivum zea mays agricultural field in silt loam china loess plateau shaanxi province soil )2021-09-26v4No1 / 5661

Problems / suggestions? Please email info AT dbbact DOT org