Summary for ontology term: zoological garden

Number of annotations with term: 141

Top positive-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__GemmigerAACGTAGGGTGCAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGACCGGCAAGTTGGAAGTGAAAACTATGGGCTCAACCCATAAATTGCTTTCAAAACTGCTGGCCTTGAGTAGTGCAGAGGTAGGTGGAATTCCCGG0.022388
d__BacteriaTACGTAGGGGGCGAGCGTTGTCCGGAATGACTGGGCGTAAAGGGCGTGTAGGCGGCCGATTAAGTGTGGAGTGAAAGTCCTGCTTTTAAGGTGGGAATTGCTTTGCAGACTGGTTGGCTTGAGTGCGGAAGAGGTAAGTGGAATTCCCAG0.022388
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGATGTGAAAGGCGGGGGCTCAACCCCTGGACTGCATTGGAAACTGTGAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.022388
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Lactobacillaceae;g__LactobacillusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGAAAAATAAGTCTAATGTGAAAGCCCTCGGCTTAACCGAGGAACTGCATCGGAAACTGTTTTTCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG0.022388
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__BlautiaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGCAGCAAGTCTGATGTGAAAGGCAGGGGCTTAACCCCTGGACTGCATTGGAAACTGCTGTGCTTGAGTGCCGGAGGGGTAAGCGGAATTCCTAG0.022388
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Ruminococcaceae;g__FaecalibacteriumAACGTAGGTCACAAGCGTTGTCCGGAATTACTGGGTGTAAAGGGAGCGCAGGCGGGAGAACAAGTTGGAAGTGAAATCCATGGGCTCAACCCATGAACTGCTTTCAAAACTGTTTTTCTTGAGTAGTGCAGAGGTAGGCGGAATTCCCGG0.022388
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales";f__"Prevotellaceae";g__PrevotellaTACGGAAGGTCCGGGCGTTATCCGGATTTATTGGGTTTAAAGGGAGCGTAGGCCGGAGATTAAGCGTGTTGTGAAATGTAGACGCTCAACGTCTGCACTGCAGCGCGAACTGGTTTCCTTGAGTACGCACAAAGTGGGCGGAATTCGTGG0.022388
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__FusicatenibacterTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAAGGCAAGTCTGATGTGAAAACCCAGGGCTTAACCCTGGGACTGCATTGGAAACTGTCTGGCTCGAGTGCCGGAGAGGTAAGCGGAATTCCTAG0.022388
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__SenegalimassiliaTACGTATGGGGCGAGCGTTATCCGGATTCATTGGGCGTAAAGCGCGCGTAGGCGGAGCGCTAAGCGGGACCTCTAACCCGAGGGCTCAACCCCCGGCCGGGTCCCGAACTGGCGCTCTCGAGTGCGGTAGGGGAGAGCGGAATTCCCGGT0.022388
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae;g__Clostridium XlVaTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGTAAAGCAAGTCTGAAGTGAAAGCCCGGGGCTCAACCCCGGGACTGCTTTGGAAACTGTTTAACTAGAGTGCTGGAGAGGTAAGCGGAATTCCTAG0.022388

Top negative-associated sequence

Taxonomy Sequence Recall
d__Bacteria;p__Firmicutes;c__Erysipelotrichia;o__Erysipelotrichales;f__ErysipelotrichaceaeTACGTAGGTGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGGGAGCAGGCGGCACTAAGGGTCTGTGGTGAAAGATCGAAGCTTAACTTCGGTAAGCCATGGAAACCGTAGAGCTAGAGTGTGTGAGAGGATCGTGGAATTCCATGT0.444444
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Bifidobacteriales;f__Bifidobacteriaceae;g__BifidobacteriumTACGTAGGGTGCAAGCGTTATCCGGAATTATTGGGCGTAAAGGGCTCGTAGGCGGTTCGTCGCGTCCGGTGTGAAAGTCCATCGCTTAACGGTGGATCCGCGCCGGGTACGGGCGGGCTTGAGTGCGGTAGGGGAGACTGGAATTCCCGG0.333333
d__BacteriaGACGGGGGGGGCAAGTGTTCTTCGGAATGACTGGGCGTAAAGGGCACGTAGGCGGTGAATCGGGTTGAAAGTGAAAGTCGCCAAAAACTGGTGGAATGCTCTCGAAACCAATTCACTTGAGTGAGACAGAGGAGAGTGGAATTTCGTGTG0.333333
d__Bacteria;p__"Actinobacteria";c__Actinobacteria;o__Coriobacteriales;f__Coriobacteriaceae;g__SlackiaTACGTAGGGGGCGAGCGTTATCCGGAATCATTGGGCGTAAAGCGCGCGCAGGCGGGCTTTCAAGCGGCGGCGTCGAAGCCGGGGGCTCAACCCCCGGAAGCGCCCCGAACTGGAAGCCTCGGATGCGGCAGGGGGAGGCGGAATTCCCGG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTGTCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGAAGACAGGTCAGATGTGAAATGTCGGGGCTCAACCCCGGAACTGCATTTGAAACCGTTTTTCTTGAGTATCGGAGAGGCAGGCGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGTGTAGGCGGGACTGCAAGTCAGATGTGAAAACTATGGGCTCAACCCATAGCCTGCATTTGAAACTGTAGTTCTTGAGTGGTGGAGAGGCAAATGGAATTCCTAG0.333333
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTACGTAGGGAGCGAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGAGTAGGCGGATTGGCAAGTCAGATGTGAAATGTCGGGGCTTAACCCCGGAACTGCATTTGAAACTGCTGACCTTGAGTGATGGAGAGGCAGGCGGAATTCCCAG0.222222
d__Bacteria;p__Firmicutes;c__Bacilli;o__Lactobacillales;f__Enterococcaceae;g__EnterococcusTACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGTTTCTTAAGTCTGATGTGAAAGCCCCCGGCTCAACCGGGGAGGGTCATTGGAAACTGGGAGACTTGAGTGCAGAAGAGGAGAGTGGAATTCCATG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__ClostridialesTGGGGAATATTGCGCAATGGGGGAAACCCTGACGCAGCAACGCCGCGTGATTGAAGAAGGTCTTCGGATTGTAAAAATCTTTTATCAAGGACGAAGAAGTGACGGTACTTGATGAATAAGCTCCGGCTAACTACGTGCCAGCAGCCGCGG0.222222
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTGGGGAATATTGGGCAATGGGCGAAAGCCTGACCCAGCAACGCCGCGTGAAGGAAGAAGGTCTTCGGATTGTAAACTTCTTTTATCAGGGACGAAGTAAGTGACGGTACCTGATGAATAAGCCACGGCTAACTACGTGCCAGCAGCCGCG0.222222

Top COMMON/DOMINANT/HIGH sequence

Taxonomy Sequence F-Score
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAATAGCAAGTCTGAAGTGAAATCATAGGGCTCAACCCTGTAATTGCTTTGGAAACTGTTGATCTTGAGTACCGGAGGGGCAGGCGGAATTCCTGG0.206061
d__Bacteria;p__"Bacteroidetes"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGGCGGTTAAGTCAGCGGTGAAAGGCAGGGGCTCAACCCCGGCAGTGCCGTTGATACTGGCCGTCTTGAATGCGGTCGAGGCCGGCGGAATGTGGCG0.200000
d__BacteriaTACGTAGGGGGCGAGCGTTATCCGGAATTATTGGGCGTAAAGAGTACGTAGGTGGTTTCCTAAGCATGGGGTTTAAGGCAAAGGCTTAACCATTGTTCGCCCCATGAACTGGGTTACTTGAGTGCTGGAGGGGAAAGCGGAATTCCTAGT0.200000
d__Bacteria;p__Firmicutes;c__Bacilli;o__Bacillales;f__Staphylococcaceae;g__MacrococcusTAGGGAATCTTCCGCAATGGACGAAAGTCTGACGGAGCAACGCCGCGTGAGTGAAGAAGGTTTTCGGATCGTAAAACTCTGTTGTAAGGGAAGAACAAGTACGTTAGTAACTGAACGTACCTTGACGGTACCTTACCAGAAAGCCACGGC0.197674
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__LachnospiraceaeTACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGAACAGCAAGTCTGAAGTGAAATGTAGGGGCTCAACCCCTAACTTGCTTTGGAAACTGTTGATCTTGAGTACCGGAGGGGCAAGCGGAATTCCTGG0.197531
d__BacteriaTACGGGGGATGCGAGCGTTATCCGGATTCATTGGGTTTAAAGGGTGCGTAGGCTGTGCGTCAAGTCGGGGGTGAAATTCCGGTGCTCAACACCGGGGCTGCCCTTGATACTGTCGCGCTGGAGTGCGGATGCCGCCGGAGGAATGAGTGG0.197044
d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__RuminococcaceaeTACGTAGGTGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGCGCGTAGGCGGGGATGCAAGTCAGATGTGAAATCTATGGGCTTAACCCATAAACTGCATTTGAAACTGTATCTCTTGAGTGCTGGAGAGGTAGACGGAATTCCTTG0.190476
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGCAGGCGGCGCGCCAAGTCAGCGGTCAAAGTTCCGGGCTCAACCCGGTGTCGCCGTTGAAACTGGCGTGCTCGAGTGCGTGCGAGGAAGGCGGAATGCGTTGT0.190476
d__Bacteria;p__"Bacteroidetes";c__"Bacteroidia";o__"Bacteroidales"TACGGAGGATGCGAGCGTTATCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGACAGTTAAGTCAGCGGTCAAAACGGGCGGCTCAACCGCCTGCCGCCGTTGAAACTGGCAGTCTAGAGTGGGCGAGAAGTACGCGGAATGCGCGGT0.188235
d__BacteriaTACGTAGGGGGCAAGCGTTGTCCGGAATGATTGGGCGTAAAGGGCGCGTAGGCGGCCCGGTAAGTCTGGAGTGAAAGTCCTGCTTTTAAGGTGGGAATTGCTTTGGATACTGTCGGGCTTGAGTGCAGGAGAGGTAAGTGGAATTCCCAG0.187135

Annotations:

common ontology terms
term enrichment score
TermScore
zoological garden0.938272
captive0.403123
african lion safari0.203390
gorilla gorilla0.177440
toronto zoo0.165680
ceratotherium simum0.165342
white rhinoceros0.165342
state of tennessee0.144796
monkey0.135703
como zoo0.124224
chimpanzee0.101911
LOWER IN zoological garden0.099379
french republic0.097938
skin0.096866
state of minnesota0.090498
pan troglodytes0.088328
rhinoceros unicornis0.080000
greater one-horned rhinoceros0.080000
san diego zoo0.078431
canada0.068013
wild0.067797
LOWER IN wild0.067797
papio anubis0.067340
feces0.066797
diceros bicornis0.054422
black rhinoceros0.054422
panthera leo0.054422
lion0.054422
olive baboon0.054422
pongo abelii0.054422
sumatran orangutan0.054422
lincoln park zoo0.053691
saint louis0.053691
saint louis zoo0.053691
equus przewalskii0.053691
giraffa camelopardalis0.053691
giraffe0.053691
united states of america0.053248
chicago0.052288
pan troglodytes verus0.040816
ceratotherium simum simum0.040816
wolf0.039216
LOWER IN captive0.035714
LOWER IN pan troglodytes troglodytes0.027778
pan troglodytes troglodytes0.027778
LOWER IN rhinoceros unicornis0.027778
LOWER IN greater one-horned rhinoceros0.027778
republic of congo0.027586
nouabale-ndoki national park0.027586
gorilla gorilla gorilla0.027586
LOWER IN republic of congo0.027586
LOWER IN nouabale-ndoki national park0.027586
hippopotamus amphibius0.027586
western chimpanzee0.027586
andrias japonicus0.027586
japanese giant salamander0.027586
dicerorhinus sumatrensis0.027586
sumatran rhinoceros0.027586
african elephant0.027586
ammotragus lervia0.027586
barbary sheep0.027586
ailurus fulgens0.027586
red panda0.027586
rangifer tarandus0.027586
reindeer0.027586
camelus bactrianus0.027586
bactrian camel0.027586
macropus rufus0.027586
red kangaroo0.027586
pteropus giganteus0.027586
indian flying fox0.027586
canis lupus arctos0.027586
arctic wolf0.027586
eidolon helvum0.027586
fruit bat0.027586
pithecia pithecia0.027586
white-faced saki0.027586
ateles geoffroyi0.027586
black-handed spider monkey0.027586
saguinus imperator0.027586
emperor tamarin0.027586
przewalski horse0.027586
hippotragus niger0.027586
sable antelope0.027586
antidorcas marsupialis0.027586
springbok0.027586
connochaetes taurinus0.027586
blue wildebeest0.027586
equus hemionus0.027586
onager0.027586
aardvark0.027586
orycteropus afer0.027586
equus zebra0.027586
mountain zebra0.027586
myrmecophaga tridactyla0.027586
giant anteater0.027586
pygoscelis antarcticus0.027586
chinstrap penguin0.027586
pygoscelis papua0.027586
gentoo penguin0.027586
Fraction of dbbact annotations with this term covered by the query
TermScore
zoological garden0.933333
gorilla gorilla0.833333
ceratotherium simum0.800000
white rhinoceros0.800000
LOWER IN pan troglodytes troglodytes0.666667
pan troglodytes troglodytes0.666667
diceros bicornis0.666667
black rhinoceros0.666667
rhinoceros unicornis0.666667
greater one-horned rhinoceros0.666667
LOWER IN rhinoceros unicornis0.666667
LOWER IN greater one-horned rhinoceros0.666667
panthera leo0.666667
lion0.666667
papio anubis0.666667
olive baboon0.666667
pongo abelii0.666667
sumatran orangutan0.666667
lincoln park zoo0.500000
chimpanzee0.500000
saint louis0.500000
saint louis zoo0.500000
republic of congo0.500000
nouabale-ndoki national park0.500000
gorilla gorilla gorilla0.500000
LOWER IN republic of congo0.500000
LOWER IN nouabale-ndoki national park0.500000
hippopotamus amphibius0.500000
pan troglodytes verus0.500000
western chimpanzee0.500000
central chimpanzee0.500000
LOWER IN pan troglodytes verus0.500000
LOWER IN central chimpanzee0.500000
zoo0.500000
LOWER IN area designated as a nature reserve0.500000
andrias japonicus0.500000
japanese giant salamander0.500000
area designated as a nature reserve0.500000
LOWER IN zoo0.500000
dicerorhinus sumatrensis0.500000
sumatran rhinoceros0.500000
san diego zoo0.500000
ceratotherium simum simum0.500000
LOWER IN ceratotherium simum simum0.500000
dog breeding center0.500000
african elephant0.500000
african lion safari0.500000
ammotragus lervia0.500000
barbary sheep0.500000
ailurus fulgens0.500000
red panda0.500000
toronto zoo0.500000
rangifer tarandus0.500000
reindeer0.500000
camelus bactrianus0.500000
bactrian camel0.500000
macropus rufus0.500000
red kangaroo0.500000
equus przewalskii0.500000
pteropus giganteus0.500000
indian flying fox0.500000
canis lupus arctos0.500000
arctic wolf0.500000
LOWER IN dog breeding center0.500000
eidolon helvum0.500000
fruit bat0.500000
giraffa camelopardalis0.500000
giraffe0.500000
pithecia pithecia0.500000
white-faced saki0.500000
como zoo0.500000
ateles geoffroyi0.500000
black-handed spider monkey0.500000
saguinus imperator0.500000
emperor tamarin0.500000
przewalski horse0.500000
hippotragus niger0.500000
sable antelope0.500000
antidorcas marsupialis0.500000
springbok0.500000
connochaetes taurinus0.500000
blue wildebeest0.500000
equus hemionus0.500000
onager0.500000
aardvark0.500000
orycteropus afer0.500000
equus zebra0.500000
mountain zebra0.500000
myrmecophaga tridactyla0.500000
giant anteater0.500000
pygoscelis antarcticus0.500000
chinstrap penguin0.500000
pygoscelis papua0.500000
gentoo penguin0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
zambia0.500000
papio kindae0.500000
papio ursinus0.500000
pan troglodytes0.400000
Fraction of annotations for the query sequences containing the term
TermScore
zoological garden0.943262
feces0.716312
united states of america0.439716
captive0.418440
skin0.241135
canada0.226950
french republic0.134752
african lion safari0.127660
state of tennessee0.113475
gorilla gorilla0.099291
monkey0.099291
toronto zoo0.099291
ceratotherium simum0.092199
white rhinoceros0.092199
state of minnesota0.070922
como zoo0.070922
chimpanzee0.056738
LOWER IN zoological garden0.056738
china0.056738
pan troglodytes0.049645
wild0.042553
LOWER IN wild0.042553
europe0.042553
rhinoceros unicornis0.042553
greater one-horned rhinoceros0.042553
female0.042553
san diego zoo0.042553
papio anubis0.035461
chicago0.028369
lincoln park zoo0.028369
saint louis0.028369
saint louis zoo0.028369
diceros bicornis0.028369
black rhinoceros0.028369
adult0.028369
panthera leo0.028369
lion0.028369
olive baboon0.028369
equus przewalskii0.028369
pongo abelii0.028369
sumatran orangutan0.028369
giraffa camelopardalis0.028369
giraffe0.028369
LOWER IN captive0.021277
pan troglodytes verus0.021277
canis lupus0.021277
wolf0.021277
ceratotherium simum simum0.021277
bovidae0.021277
republic of congo0.014184
nouabale-ndoki national park0.014184
LOWER IN united states of america0.014184
gorilla gorilla gorilla0.014184
LOWER IN republic of congo0.014184
LOWER IN nouabale-ndoki national park0.014184
cameroon0.014184
LOWER IN europe0.014184
LOWER IN cameroon0.014184
LOWER IN pan troglodytes troglodytes0.014184
italy0.014184
hippopotamus amphibius0.014184
pan troglodytes troglodytes0.014184
western chimpanzee0.014184
andrias japonicus0.014184
japanese giant salamander0.014184
japan0.014184
dicerorhinus sumatrensis0.014184
sumatran rhinoceros0.014184
LOWER IN rhinoceros unicornis0.014184
LOWER IN greater one-horned rhinoceros0.014184
LOWER IN ceratotherium simum0.014184
LOWER IN white rhinoceros0.014184
loxodonta africana0.014184
african elephant0.014184
macaca mulatta0.014184
macaque0.014184
sus scrofa0.014184
pig0.014184
acinonyx jubatus0.014184
cheetah0.014184
ammotragus lervia0.014184
barbary sheep0.014184
ailurus fulgens0.014184
red panda0.014184
ovis aries0.014184
sheep0.014184
rangifer tarandus0.014184
reindeer0.014184
camelus bactrianus0.014184
bactrian camel0.014184
macropus rufus0.014184
red kangaroo0.014184
wild horse0.014184
pteropus giganteus0.014184
indian flying fox0.014184
tragelaphus oryx0.014184
eland0.014184
canis lupus arctos0.014184
arctic wolf0.014184
eidolon helvum0.014184
Exp. ID User ID Description Date Region Flag Sequences
406amnoncommon feces, zoological garden, french republic, ceratotherium simum, white rhinoceros2018-11-21v4No1 / 1
406amnondominant feces, zoological garden, french republic, equus zebra, mountain zebra2018-11-21v4No1 / 7
620amnondominant feces, united states of america, zoological garden, gorilla gorilla, saint louis, saint louis zoo2020-05-06v4No1 / 8
406amnondominant feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 8
406amnondominant feces, zoological garden, french republic, connochaetes taurinus, blue wildebeest2018-11-21v4No1 / 8
406amnondominant feces, united states of america, zoological garden, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 8
411amnondominant feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 8
559amnondominant feces, united states of america, zoological garden, diceros bicornis, black rhinoceros, captive2019-11-03v4No1 / 9
399amnondominant feces, united states of america, state of tennessee, zoological garden, ailurus fulgens, red panda2018-11-16v4No1 / 9
565amnondominant zoological garden, skin, captive, canada, african lion safari, macropus rufus, red kangaroo2019-11-21v3No1 / 9
565amnondominant zoological garden, skin, equus przewalskii, captive, canada, toronto zoo, wild horse2019-11-21v3No1 / 9
565amnondominant zoological garden, skin, captive, canada, canis lupus arctos, toronto zoo, arctic wolf2019-11-21v3No1 / 9
406amnondominant feces, zoological garden, french republic, equus hemionus, onager2018-11-21v4No1 / 9
406amnondominant feces, zoological garden, french republic, aepyceros melampus, impala2018-11-21v4No1 / 9
742amnondominant feces, zoological garden, bird, captive, china, dalian city prefecture, pygoscelis papua, gentoo penguin2021-02-18v3No1 / 9
559amnondominant feces, united states of america, zoological garden, ceratotherium simum, white rhinoceros, captive2019-11-03v4No1 / 10
565amnondominant zoological garden, skin, captive, canada, tragelaphus oryx, toronto zoo, eland2019-11-21v3No1 / 10
565amnondominant zoological garden, skin, captive, canada, eidolon helvum, toronto zoo, fruit bat2019-11-21v3No1 / 10
406amnondominant feces, zoological garden, french republic, hippotragus niger, sable antelope2018-11-21v4No1 / 10
620amnondominant feces, united states of america, zoological garden, gorilla gorilla, chicago, lincoln park zoo2020-05-06v4No1 / 11
729amnondominant feces, zoological garden, gorilla gorilla, monkey, europe2021-01-05v3No1 / 11
399amnondominant feces, united states of america, state of tennessee, zoological garden, gorilla gorilla2018-11-16v4No1 / 11
565amnondominant zoological garden, skin, captive, canada, ammotragus lervia, african lion safari, barbary sheep2019-11-21v3No1 / 11
565amnondominant zoological garden, skin, panthera leo, lion, captive, canada, toronto zoo2019-11-21v3No1 / 11
406amnondominant feces, zoological garden, french republic, antidorcas marsupialis, springbok2018-11-21v4No1 / 11
559amnondominant feces, united states of america, zoological garden, captive, rhinoceros unicornis, greater one-horned rhinoceros2019-11-03v4No1 / 12
565amnondominant zoological garden, skin, acinonyx jubatus, cheetah, captive, canada, african lion safari2019-11-21v3No1 / 12
399amnondominant feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 13
399amnondominant feces, united states of america, state of tennessee, zoological garden, ovis aries, sheep2018-11-16v4No1 / 13
625amnondominant feces, united states of america, zoological garden, gorilla gorilla, state of minnesota, como zoo2020-05-16v4No1 / 13
560amnondominant united states of america, female, zoological garden, ceratotherium simum, white rhinoceros, captive, san diego zoo, ceratotherium simum simum2019-11-04v4No1 / 14
565amnondominant zoological garden, skin, captive, canada, rangifer tarandus, african lion safari, reindeer2019-11-21v3No1 / 14
565amnondominant zoological garden, skin, captive, canada, elephas maximus, african lion safari, asian elephant2019-11-21v3No1 / 14
406amnondominant feces, united states of america, zoological garden, giraffa camelopardalis, giraffe2018-11-21v4No1 / 14
812amnondominant feces, zoological garden, captive, china, pygoscelis antarcticus, chinstrap penguin2021-06-22v3No1 / 14
620amnondominant feces, united states of america, zoological garden, pan troglodytes, chimpanzee, saint louis, saint louis zoo2020-05-06v4No1 / 15
560amnondominant united states of america, female, zoological garden, captive, san diego zoo, rhinoceros unicornis, greater one-horned rhinoceros2019-11-04v4No1 / 15
559amnondominant feces, united states of america, zoological garden, captive, dicerorhinus sumatrensis, sumatran rhinoceros2019-11-03v4No1 / 15
406amnondominant feces, zoological garden, gorilla gorilla, french republic, monkey, gorilla2018-11-21v4No1 / 15
406amnondominant feces, united states of america, zoological garden, switzerland, diceros bicornis, black rhinoceros2018-11-21v4No1 / 15
753amnondominant feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 16
399amnondominant feces, united states of america, state of tennessee, zoological garden, pan troglodytes, chimpanzee2018-11-16v4No1 / 16
565amnondominant zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 16
620amnondominant feces, united states of america, zoological garden, pan troglodytes, chicago, chimpanzee, lincoln park zoo2020-05-06v4No1 / 16
565amnondominant zoological garden, skin, captive, pongo abelii, canada, toronto zoo, sumatran orangutan2019-11-21v3No1 / 16
625amnondominant feces, united states of america, zoological garden, state of minnesota, pongo abelii, sumatran orangutan, como zoo2020-05-16v4No1 / 16
406amnondominant feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 17
565amnondominant zoological garden, skin, giraffa camelopardalis, giraffe, captive, canada, african lion safari2019-11-21v3No1 / 18
625amnondominant feces, united states of america, zoological garden, state of minnesota, pithecia pithecia, white-faced saki, como zoo2020-05-16v4No1 / 18
625amnondominant feces, united states of america, zoological garden, state of minnesota, saguinus imperator, como zoo, emperor tamarin2020-05-16v4No1 / 18
729amnondominant feces, zoological garden, monkey, captive, europe, pan troglodytes verus, western chimpanzee2021-01-05v3No1 / 19
565amnondominant zoological garden, skin, captive, canada, camelus bactrianus, african lion safari, bactrian camel2019-11-21v3No1 / 20
565amnondominant zoological garden, skin, captive, canada, pteropus giganteus, african lion safari, indian flying fox2019-11-21v3No1 / 20
565amnondominant zoological garden, skin, ceratotherium simum, white rhinoceros, captive, canada, african lion safari2019-11-21v3No1 / 20
666amnondominant feces, zoological garden, italy, hippopotamus amphibius2020-09-25v3No1 / 21
399amnondominant feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 21
406amnondominant feces, zoological garden, french republic, ceratotherium simum, white rhinoceros2018-11-21v4No1 / 21
406amnondominant feces, zoological garden, french republic, ceratotherium simum, white rhinoceros2018-11-21v4No1 / 21
399amnoncommon feces, united states of america, state of tennessee, zoological garden, ailurus fulgens, red panda2018-11-16v4No1 / 22
625amnondominant feces, united states of america, zoological garden, state of minnesota, ateles geoffroyi, como zoo, black-handed spider monkey2020-05-16v4No1 / 22
399amnondominant feces, united states of america, state of tennessee, zoological garden, panthera leo, lion2018-11-16v4No1 / 23
399amnondominant feces, united states of america, state of tennessee, zoological garden, loxodonta africana, african elephant2018-11-16v4No1 / 28
406amnoncommon feces, united states of america, zoological garden, myrmecophaga tridactyla, giant anteater2018-11-21v4No1 / 44
406amnoncommon feces, united states of america, zoological garden, equus przewalskii, przewalski horse2018-11-21v4No1 / 50
338amnonhigher in wild salamanders compared to zoo grown salamanders ( high in pond area designated as a nature reserve compared to zoological garden zoo in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 51
812amnoncommon feces, zoological garden, captive, china, pygoscelis antarcticus, chinstrap penguin2021-06-22v3No1 / 56
753amnon high in zoological garden captive canis lupus wolf compared to farm canis lupus familiaris dog dog breeding center in feces adult china 2021-03-12v4No1 / 57
742amnoncommon feces, zoological garden, bird, captive, china, dalian city prefecture, pygoscelis papua, gentoo penguin2021-02-18v3No1 / 70
399amnoncommon feces, united states of america, state of tennessee, zoological garden, panthera leo, lion2018-11-16v4No1 / 79
565amnoncommon zoological garden, skin, captive, canada, eidolon helvum, toronto zoo, fruit bat2019-11-21v3No1 / 83
406amnonhigher in captive bovidae compared to wild ( high in zoological garden compared to wild in feces bovidae )2018-11-21v4No1 / 84
565amnoncommon zoological garden, skin, captive, canada, rangifer tarandus, african lion safari, reindeer2019-11-21v3No1 / 96
753amnoncommon feces, zoological garden, adult, captive, canis lupus, china, wolf2021-03-12v4No1 / 98
406amnoncommon feces, zoological garden, south africa, aardvark, orycteropus afer2018-11-21v4No1 / 107
565amnoncommon zoological garden, skin, captive, canada, pteropus giganteus, african lion safari, indian flying fox2019-11-21v3No1 / 109
565amnoncommon zoological garden, skin, equus przewalskii, captive, canada, toronto zoo, wild horse2019-11-21v3No1 / 112
565amnoncommon zoological garden, skin, captive, canada, canis lupus arctos, toronto zoo, arctic wolf2019-11-21v3No1 / 114
565amnoncommon zoological garden, skin, captive, canada, camelus bactrianus, african lion safari, bactrian camel2019-11-21v3No1 / 122
565amnoncommon zoological garden, skin, ceratotherium simum, white rhinoceros, captive, canada, african lion safari2019-11-21v3No1 / 122
565amnoncommon zoological garden, skin, acinonyx jubatus, cheetah, captive, canada, african lion safari2019-11-21v3No1 / 123
753amnon high in farm canis lupus familiaris dog dog breeding center compared to zoological garden captive canis lupus wolf in feces adult china 2021-03-12v4No1 / 127
625amnoncommon feces, united states of america, zoological garden, state of minnesota, saguinus imperator, como zoo, emperor tamarin2020-05-16v4No1 / 132
666amnoncommon feces, zoological garden, italy, hippopotamus amphibius2020-09-25v3No1 / 146
565amnoncommon zoological garden, skin, captive, canada, elephas maximus, african lion safari, asian elephant2019-11-21v3No1 / 149
565amnoncommon zoological garden, skin, panthera leo, lion, captive, canada, toronto zoo2019-11-21v3No1 / 150
411amnon high in wild papio kindae papio ursinus compared to zoological garden papio anubis in feces papio zambia monkey baboon 2018-11-23v4No1 / 151
565amnoncommon zoological garden, skin, captive, pongo abelii, canada, toronto zoo, sumatran orangutan2019-11-21v3No1 / 174
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pithecia pithecia, white-faced saki, como zoo2020-05-16v4No1 / 179
565amnoncommon zoological garden, skin, captive, canada, ammotragus lervia, african lion safari, barbary sheep2019-11-21v3No1 / 205
406amnoncommon feces, zoological garden, gorilla gorilla, french republic, monkey, gorilla2018-11-21v4No1 / 239
559amnon high in rhinoceros unicornis greater one-horned rhinoceros compared to ceratotherium simum white rhinoceros in feces united states of america zoological garden captive 2019-11-03v4No1 / 249
399amnoncommon feces, united states of america, state of tennessee, zoological garden, loxodonta africana, african elephant2018-11-16v4No1 / 252
625amnoncommon feces, united states of america, zoological garden, state of minnesota, ateles geoffroyi, como zoo, black-handed spider monkey2020-05-16v4No1 / 256
559amnoncommon feces, united states of america, zoological garden, captive, dicerorhinus sumatrensis, sumatran rhinoceros2019-11-03v4No1 / 267
406amnonhigher in captive white rhinoceros compared to wild ( high in zoological garden french republic compared to south africa wild in feces ceratotherium simum white rhinoceros bovidae )2018-11-21v4No1 / 277
729amnon high in wild pan troglodytes troglodytes cameroon central chimpanzee compared to zoological garden captive europe pan troglodytes verus eastern chimpanzee in feces monkey 2021-01-05v3No1 / 288
411amnoncommon feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 292
625amnoncommon feces, united states of america, zoological garden, gorilla gorilla, state of minnesota, como zoo2020-05-16v4No1 / 293
565amnoncommon zoological garden, skin, giraffa camelopardalis, giraffe, captive, canada, african lion safari2019-11-21v3No1 / 310
399amnoncommon feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 319
406amnonlower in captive bovidae compared to wild ( high in wild compared to zoological garden in feces bovidae )2018-11-21v4No1 / 319
338amnonlower in wild salamanders compared to zoo grown salamanders ( high in zoological garden zoo compared to pond area designated as a nature reserve in skin andrias japonicus japanese giant salamander japan )2018-05-21v4No1 / 334
729amnon high in zoological garden captive europe pan troglodytes verus eastern chimpanzee compared to pan troglodytes troglodytes cameroon central chimpanzee in feces monkey 2021-01-05v3No1 / 337
729amnoncommon feces, zoological garden, monkey, europe, pan troglodytes verus, western chimpanzee2021-01-05v3No1 / 343
620amnon high in wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park compared to united states of america zoological garden pan troglodytes in feces chimpanzee 2020-05-06v4No1 / 351
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chicago, chimpanzee, lincoln park zoo2020-05-06v4No1 / 358
565amnoncommon zoological garden, skin, captive, canada, african lion safari, macropus rufus, red kangaroo2019-11-21v3No1 / 360
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in feces papio zambia monkey baboon 2018-11-23v4No1 / 364
620amnon high in wild republic of congo nouabale-ndoki national park compared to united states of america zoological garden in feces gorilla gorilla gorilla 2020-05-06v4No1 / 368
565amnoncommon zoological garden, skin, papio anubis, captive, olive baboon, canada, toronto zoo2019-11-21v3No1 / 368
560amnoncommon united states of america, female, zoological garden, ceratotherium simum, white rhinoceros, captive, san diego zoo, ceratotherium simum simum2019-11-04v4No1 / 373
559amnoncommon feces, united states of america, zoological garden, diceros bicornis, black rhinoceros, captive2019-11-03v4No1 / 382
559amnon high in ceratotherium simum white rhinoceros compared to rhinoceros unicornis greater one-horned rhinoceros in feces united states of america zoological garden captive 2019-11-03v4No1 / 382
729amnon high in wild cameroon compared to zoological garden captive europe in feces gorilla gorilla monkey 2021-01-05v3No1 / 383
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, chicago, lincoln park zoo2020-05-06v4No1 / 384
399amnoncommon feces, united states of america, state of tennessee, zoological garden, gorilla gorilla2018-11-16v4No1 / 395
399amnoncommon feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 404
399amnoncommon feces, united states of america, state of tennessee, zoological garden, pan troglodytes, chimpanzee2018-11-16v4No1 / 407
625amnoncommon feces, united states of america, zoological garden, state of minnesota, pongo abelii, sumatran orangutan, como zoo2020-05-16v4No1 / 414
560amnoncommon united states of america, female, zoological garden, captive, san diego zoo, rhinoceros unicornis, greater one-horned rhinoceros2019-11-04v4No1 / 419
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chimpanzee, saint louis, saint louis zoo2020-05-06v4No1 / 433
399amnoncommon feces, united states of america, state of tennessee, zoological garden, ovis aries, sheep2018-11-16v4No1 / 451
406amnoncommon feces, zoological garden, french republic, connochaetes taurinus, blue wildebeest2018-11-21v4No1 / 467
406amnoncommon feces, zoological garden, french republic, ceratotherium simum, white rhinoceros2018-11-21v4No1 / 474
406amnoncommon feces, zoological garden, french republic, antidorcas marsupialis, springbok2018-11-21v4No1 / 477
406amnoncommon feces, zoological garden, french republic, equus zebra, mountain zebra2018-11-21v4No1 / 527
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, saint louis, saint louis zoo2020-05-06v4No1 / 530
729amnoncommon feces, zoological garden, gorilla gorilla, monkey, captive, europe2021-01-05v3No1 / 542
406amnoncommon feces, united states of america, zoological garden, giraffa camelopardalis, giraffe2018-11-21v4No1 / 581
559amnoncommon feces, united states of america, zoological garden, captive, rhinoceros unicornis, greater one-horned rhinoceros2019-11-03v4No1 / 582
406amnoncommon feces, united states of america, zoological garden, switzerland, diceros bicornis, black rhinoceros2018-11-21v4No1 / 600
559amnoncommon feces, united states of america, zoological garden, ceratotherium simum, white rhinoceros, captive2019-11-03v4No1 / 652
729amnon high in zoological garden captive europe compared to wild cameroon in feces gorilla gorilla monkey 2021-01-05v3No1 / 656
560amnon high in rhinoceros unicornis greater one-horned rhinoceros compared to ceratotherium simum white rhinoceros ceratotherium simum simum in united states of america female zoological garden captive san diego zoo 2019-11-04v4No1 / 656
406amnoncommon feces, zoological garden, french republic, aepyceros melampus, impala2018-11-21v4No1 / 661
565amnoncommon zoological garden, skin, captive, canada, tragelaphus oryx, toronto zoo, eland2019-11-21v3No1 / 674
560amnon high in ceratotherium simum white rhinoceros ceratotherium simum simum compared to rhinoceros unicornis greater one-horned rhinoceros in united states of america female zoological garden captive san diego zoo 2019-11-04v4No1 / 677
406amnoncommon feces, zoological garden, french republic, equus hemionus, onager2018-11-21v4No1 / 885
620amnon high in united states of america zoological garden pan troglodytes compared to wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park in feces chimpanzee 2020-05-06v4No1 / 964
620amnon high in united states of america zoological garden compared to wild republic of congo nouabale-ndoki national park in feces gorilla gorilla gorilla 2020-05-06v4No1 / 1019
406amnoncommon feces, zoological garden, french republic, hippotragus niger, sable antelope2018-11-21v4No1 / 1075

Problems / suggestions? Please email info AT dbbact DOT org