Search result for sequence:
TACGGAGGGTGCAAGCGTTGTCCGGATTTATTGGGTTTAAAGGGTGCGTAGGCGGCTTTTTAAGTCTGGGGTGAAAGCCCGTTGCTCAACAACGGAACTGCCCTGGAAACTGGAGAGCTTGAGTACAGACGAGGGTGGCGGAATGGACGG
common ontology terms
term enrichment score
TermScore
glacier0.646154
snow0.500000
ice0.500000
stratovolcano0.375000
depth 0-5cm0.315789
glacial ice0.285714
shetland islands0.285714
south shetland glacier0.285714
snow field0.272727
state of oregon0.214286
sweden0.184615
filtered 0.2um0.181818
subsurface0.166667
depth 20-100cm0.166667
lapland0.166667
depth 0-20cm0.153846
state of colorado0.142857
surface0.133333
finland0.117647
kingdom of norway0.111111
sediment0.047619
united states of america0.015936
Fraction of dbbact annotations with this term covered by the query
TermScore
ice0.666667
glacier0.600000
stratovolcano0.500000
snow0.500000
glacial ice0.500000
shetland islands0.500000
south shetland glacier0.500000
subsurface0.500000
depth 20-100cm0.500000
lapland0.500000
depth 0-5cm0.333333
depth 0-20cm0.333333
snow field0.250000
surface0.200000
state of oregon0.166667
filtered 0.2um0.166667
finland0.142857
sweden0.133333
kingdom of norway0.125000
state of colorado0.111111
sediment0.031250
united states of america0.008097
Fraction of annotations for the query sequences containing the term
TermScore
glacier0.700000
united states of america0.500000
snow0.500000
ice0.400000
snow field0.300000
stratovolcano0.300000
state of oregon0.300000
depth 0-5cm0.300000
sweden0.300000
glacial ice0.200000
shetland islands0.200000
south shetland glacier0.200000
state of colorado0.200000
filtered 0.2um0.200000
subsurface0.100000
depth 20-100cm0.100000
sediment0.100000
surface0.100000
depth 0-20cm0.100000
kingdom of norway0.100000
finland0.100000
lapland0.100000

Problems / suggestions? Please email info AT dbbact DOT org