Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.478001
feces0.430164
adult0.310238
united states of america0.248595
china0.152944
LOWER IN control0.152350
infant0.149180
mouse0.119795
crohn's disease0.119545
research facility0.117365
child0.114473
mus musculus0.113025
ulcerative colitis0.098731
canada0.093645
c57bl/60.085308
clostridium difficile intestinal infectious disease0.080537
rectum0.077922
obsolete_juvenile stage0.077922
age 8 weeks0.076433
australia0.076364
city0.074720
taconic farms0.073620
biopsy0.068259
age < 3 years0.068259
diarrhea0.063898
finland0.063898
control0.063604
farm0.057061
colon0.055944
caecum0.055427
terminal ileum0.055172
female0.054645
wild0.054348
antibiotic0.052980
LOWER IN male0.042254
biopsy site0.041958
state of oklahoma0.041812
phascolarctos cinereus0.041379
koala0.041379
cape otway0.041379
age 50-60 years0.041379
nanning city prefecture0.041379
LOWER IN rural community0.041379
guangzhou city prefecture0.040541
hispanic or latin american0.040541
state of michigan0.040134
age 1 year0.040134
state of new york0.039735
LOWER IN jackson laboratories0.039735
rattus norvegicus0.039344
c57bl/6j0.038961
state of georgia0.038961
jackson laboratories0.038217
jiangsu province0.038217
kingdom of spain0.037855
hospital0.037500
rat0.037500
age0.037500
state of california0.035821
parkinson's disease0.028369
age > 1 year0.028169
irritable bowel syndrome0.027972
schizophrenia0.027972
inflammatory bowel disease0.027972
oslo0.027972
eucalyptus viminalis diet0.027972
nanchang city prefecture0.027972
pancreatitis0.027972
acute pancreatitis0.027972
stroke0.027972
sigmoid colon0.027972
children0.027972
age one year0.027972
nephrolithiasis0.027972
equine grass sickness0.027972
age 3-60.027972
urocyon littoralis catalinae0.027972
santa catalina island fox0.027972
santa catalina island0.027972
urocyon littoralis0.027972
perianal skin0.027972
age >940.027972
LOWER IN russia0.027972
LOWER IN small village0.027972
systemic lupus erythematosus0.027586
age 50-80 years0.027586
state of alabama0.027586
sichuan province0.027397
sus scrofa0.027027
pig0.027027
commonwealth of virginia0.026846
right colon0.026846
rural community0.026846
mouse chow0.026667
state of minnesota0.026490
commonwealth of pennsylvania0.026490
horse0.026490
disease0.026490
high fat diet0.026490
kingdom of denmark0.026144
Fraction of dbbact annotations with this term covered by the query
TermScore
ulcerative colitis2.500000
colon1.000000
parkinson's disease1.000000
LOWER IN male1.000000
crohn's disease0.777778
biopsy site0.750000
caecum0.750000
biopsy0.666667
age < 3 years0.666667
terminal ileum0.666667
age > 1 year0.666667
state of oklahoma0.666667
canada0.666667
clostridium difficile intestinal infectious disease0.600000
probiotic0.500000
irritable bowel syndrome0.500000
acquired immunodeficiency syndrome0.500000
schizophrenia0.500000
LOWER IN doxycycline0.500000
LOWER IN amoxicillin0.500000
before antibiotics0.500000
acute severe colitis0.500000
inflammatory bowel disease0.500000
new york county0.500000
chronic fatigue syndrome0.500000
oslo0.500000
LOWER IN age 30-400.500000
mammalian milk beverage0.500000
LOWER IN non c. diff diarrhea0.500000
phascolarctos cinereus0.500000
koala0.500000
cape otway0.500000
LOWER IN eucalyptus obliqua0.500000
LOWER IN eucalyptus obliqua diet0.500000
eucalyptus viminalis0.500000
eucalyptus viminalis diet0.500000
nanchang city prefecture0.500000
pancreatitis0.500000
acute pancreatitis0.500000
stroke0.500000
low fiber0.500000
sigmoid colon0.500000
children0.500000
LOWER IN age 2 months0.500000
LOWER IN estonia0.500000
age one year0.500000
cefoperazone0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
little physical activity0.500000
LOWER IN physical activity0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
equine grass sickness0.500000
indomethacin0.500000
non-steroidal anti-inflammatory drug0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
LOWER IN non usa born0.500000
usa born0.500000
eucalyptus obliqua diet0.500000
high fat diet + inulin0.500000
denver0.500000
red-eared slider turtle0.500000
trachemys scripta elegans0.500000
turtle farm0.500000
LOWER IN egypt0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
santa catalina island0.500000
urocyon littoralis0.500000
perianal skin0.500000
LOWER IN bacterial vaginosis0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age >940.500000
LOWER IN mexico0.500000
age 13-140.500000
hmong0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
LOWER IN russia0.500000
LOWER IN plant diet0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
LOWER IN rural community0.500000
estonia0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
farm 10.500000
LOWER IN farm 20.500000
glasgow0.500000
age 130.500000
age 1-3 weeks0.500000
spondyloarthritis0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.848921
homo sapiens0.776978
united states of america0.417266
adult0.359712
china0.194245
LOWER IN control0.158273
research facility0.143885
mouse0.107914
mus musculus0.107914
infant0.093525
child0.071942
crohn's disease0.064748
control0.064748
c57bl/60.064748
ulcerative colitis0.050360
australia0.050360
canada0.050360
clostridium difficile intestinal infectious disease0.043165
city0.043165
rectum0.043165
obsolete_juvenile stage0.043165
age 8 weeks0.043165
taconic farms0.043165
biopsy0.035971
diarrhea0.035971
age < 3 years0.035971
finland0.035971
wild0.035971
female0.035971
farm0.035971
antibiotic0.028777
terminal ileum0.028777
caecum0.028777
colon0.028777
state of california0.021583
kingdom of spain0.021583
biopsy site0.021583
state of michigan0.021583
age 1 year0.021583
hospital0.021583
phascolarctos cinereus0.021583
koala0.021583
cape otway0.021583
rat0.021583
rattus norvegicus0.021583
guangzhou city prefecture0.021583
age0.021583
c57bl/6j0.021583
state of new york0.021583
age 50-60 years0.021583
nanning city prefecture0.021583
LOWER IN male0.021583
state of oklahoma0.021583
hispanic or latin american0.021583
jackson laboratories0.021583
state of georgia0.021583
LOWER IN jackson laboratories0.021583
jiangsu province0.021583
LOWER IN rural community0.021583
irritable bowel syndrome0.014388
schizophrenia0.014388
LOWER IN feces0.014388
state of minnesota0.014388
commonwealth of pennsylvania0.014388
inflammatory bowel disease0.014388
commonwealth of virginia0.014388
systemic lupus erythematosus0.014388
kingdom of norway0.014388
oslo0.014388
LOWER IN adult0.014388
eucalyptus viminalis diet0.014388
nanchang city prefecture0.014388
pancreatitis0.014388
acute pancreatitis0.014388
stroke0.014388
sigmoid colon0.014388
children0.014388
age > 1 year0.014388
sichuan province0.014388
kingdom of denmark0.014388
age one year0.014388
age 50-80 years0.014388
parkinson's disease0.014388
state of alabama0.014388
nephrolithiasis0.014388
equus caballus0.014388
horse0.014388
equine grass sickness0.014388
disease0.014388
united kingdom0.014388
age 3-60.014388
urocyon littoralis catalinae0.014388
santa catalina island fox0.014388
santa catalina island0.014388
urocyon littoralis0.014388
perianal skin0.014388
ileum0.014388
right colon0.014388
age >940.014388
rural community0.014388
Exp. ID User ID Description Date Region Flag Sequences
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in israel research facility mouse mus musculus feces antibiotic )2018-10-23v4No1 / 2
394amnon high in ulcerative colitis compared to control in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 7
294amnon high in irritable bowel syndrome compared to control in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 8
629amnon high in acquired immunodeficiency syndrome hiv infection compared to control in adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 9
502amnon high in schizophrenia compared to control in homo sapiens feces adult united states of america 2019-03-12v4No1 / 12
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v4No1 / 13
185amnoncommon in patients with c. diff infection before treatment (common homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 13
659amnon high in before antibiotics compared to doxycycline metronidazole amoxicillin vancomycin antibiotic in ulcerative colitis acute severe colitis homo sapiens child feces 2020-09-19v4No1 / 15
94amnoncommon homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 15
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 15
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 16
12amnon high in chronic fatigue syndrome compared to control in homo sapiens feces new york county 2016-11-02v4No1 / 17
330amnon high in infant age 1 year compared to adult age 30-40 in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 18
292amnondominant homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 19
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in homo sapiens feces infant )2016-12-01v4No1 / 20
94amnondominant homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 21
185amnonhigh freq. in patients with c. diff infection before treatment (dominant homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 21
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 22
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 23
541amnonlower in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus viminalis eucalyptus viminalis diet compared to eucalyptus obliqua eucalyptus obliqua diet in phascolarctos cinereus koala feces australia wild cape otway )2019-08-01v4No1 / 23
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, ulcerative colitis, inflammatory bowel disease, crohn's disease2018-11-14v4No1 / 24
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 24
399amnondominant feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 26
399amnon high in crohn's disease compared to control in feces united states of america homo sapiens 2018-11-16v4No1 / 26
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 29
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 29
390amnoncommon homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 30
404amnonnegatively correlated with fiber intake ( high in low fiber compared to plant fiber cell high fiber in homo sapiens feces adult colombia city )2018-11-20v4No1 / 31
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 33
284amnon high in age 1 year compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v4No1 / 34
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 35
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens infant united states of america 2017-11-05v4No1 / 36
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 37
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 38
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 39
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 43
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 44
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 45
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 45
591amnoncommon homo sapiens, feces, adult, age 50-80 years, united states of america, parkinson's disease2020-02-17v4No1 / 46
651amnoncommon parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 48
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 49
650amnoncommon african american, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 51
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 52
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 52
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 53
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 54
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 55
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 55
591amnoncommon homo sapiens, feces, adult, age 50-80 years, united states of america, control2020-02-17v4No1 / 55
650amnon high in female compared to male in feces adult homo sapiens united states of america state of new york 2020-09-10v4No1 / 56
651amnoncommon control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 57
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 58
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 60
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 62
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 64
448amnoncommon equus caballus, horse, feces, farm, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 64
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 67
644amnon high in female compared to male in adult united states of america hispanic or latin american feces homo sapiens 2020-08-31v4No1 / 68
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in indomethacin non-steroidal anti-inflammatory drug compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 71
448amnon high in equine grass sickness disease compared to control in equus caballus horse feces farm united kingdom 2019-01-08v4No1 / 71
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 71
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v4No1 / 75
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 76
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 76
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v4No1 / 77
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic neomycin ampicillin compared to control in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v4No1 / 79
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 80
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 81
590amnoncommon china, red-eared slider turtle, trachemys scripta elegans, age 3-5 weeks, intestine, turtle farm, farm, hainan autonomous prefecture2020-02-10v4No1 / 82
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 85
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 87
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, perianal skin, rectum2020-01-22v4No1 / 87
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v4No1 / 92
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada ileum terminal ileum 2019-07-29v4No1 / 103
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 106
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 106
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada colon right colon 2019-07-29v4No1 / 107
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 108
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 109
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 113
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 116
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 117
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 117
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 119
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 119
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 120
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v4No1 / 129
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v4No1 / 131
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 133
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 133
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 134
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v4No1 / 134
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 137
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 144
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 147
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 148
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v4No1 / 150
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 161
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 161
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 167
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 168
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 169
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 170
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 171
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 182
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 183
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 188
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 188
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 196
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 207
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 213
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 215
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 217
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 220
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 226
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 230
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 238
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 262
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 280
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 294
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 318
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 342
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 372
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 383
582amnon high in perianal skin rectum compared to ear canal external acoustic meatus in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 399
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 421
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 473
650amnon high in european caucasian compared to asian in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 474
657amnoncommon research facility, china, qinghai province, rumen liquid, rumen, age < 1 year, lamb, sheep, ovis aries2020-09-13v4No1 / 516
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 556
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 566
372amnon high in mouse chow compared to high fat diet in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 578
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 835
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1080

Problems / suggestions? Please email info AT dbbact DOT org