Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
feces0.436273
homo sapiens0.432625
adult0.261845
united states of america0.238230
infant0.192000
china0.140014
crohn's disease0.136808
LOWER IN control0.126468
research facility0.125414
mouse0.120016
mus musculus0.114029
child0.102564
ulcerative colitis0.090226
guangzhou city prefecture0.086331
clostridium difficile intestinal infectious disease0.080808
age 1 year0.077670
formula fed0.076190
control0.075425
hospital0.075235
germany0.074074
biopsy0.071502
c57bl/60.068571
canada0.066116
terminal ileum0.061856
rectum0.059701
obsolete_juvenile stage0.059701
farm0.059574
australia0.058989
city0.057471
age 8 weeks0.057143
taconic farms0.057143
age < 3 years0.051680
wild0.051282
finland0.049140
state of georgia0.049140
diarrhea0.048544
state of california0.046296
italy0.046296
kingdom of spain0.045593
sigmoid colon0.041667
clostridium difficile infection0.041237
colonized germ free0.041237
seattle0.041237
female0.040486
antibiotic0.040000
rat0.038585
pig0.038585
sus scrofa0.038585
colon0.035088
caecum0.034582
biopsy site0.031579
state of oklahoma0.031496
tucson0.031250
phascolarctos cinereus0.031250
koala0.031250
cape otway0.031250
age 50-60 years0.031250
nanning city prefecture0.031250
LOWER IN rural community0.031250
age 1 month0.031008
juvenile organism0.030769
LOWER IN breast fed0.030769
hispanic or latin american0.030769
LOWER IN jackson laboratories0.030303
state of michigan0.030075
rattus norvegicus0.029851
c57bl/6j0.029851
monkey0.029851
jackson laboratories0.029412
age 3 months0.028986
age0.028986
LOWER IN male0.028986
jiangsu province0.028571
captive0.028369
state of new york0.027778
LOWER IN age 2 months0.021164
age 3-5 weeks0.021164
irritable bowel syndrome0.021053
after hcst0.021053
hematopoietic stem cell transplant0.021053
schizophrenia0.021053
breast fed0.021053
inflammatory bowel disease0.021053
LOWER IN vancomycin0.021053
valladolid0.021053
oslo0.021053
cftr s489x0.021053
age 7 months0.021053
eucalyptus viminalis diet0.021053
juvenile0.021053
pancreatitis0.021053
acute pancreatitis0.021053
stroke0.021053
children0.021053
age > 1 year0.021053
age one year0.021053
nephrolithiasis0.021053
rhesus macaque0.021053
equine grass sickness0.021053
age 3-60.021053
Fraction of dbbact annotations with this term covered by the query
TermScore
biopsy site0.750000
crohn's disease0.750000
terminal ileum0.750000
biopsy0.714286
ulcerative colitis0.666667
clostridium difficile intestinal infectious disease0.666667
age < 3 years0.666667
sigmoid colon0.666667
LOWER IN age 2 months0.666667
state of oklahoma0.666667
age 3-5 weeks0.666667
irritable bowel syndrome0.500000
acquired immunodeficiency syndrome0.500000
after hcst0.500000
hematopoietic stem cell transplant0.500000
tucson0.500000
schizophrenia0.500000
LOWER IN age 7 months0.500000
breast fed0.500000
inflammatory bowel disease0.500000
LOWER IN doxycycline0.500000
LOWER IN amoxicillin0.500000
LOWER IN vancomycin0.500000
before antibiotics0.500000
acute severe colitis0.500000
clostridium difficile infection0.500000
valladolid0.500000
new york county0.500000
chronic fatigue syndrome0.500000
oslo0.500000
LOWER IN age 30-400.500000
cftr s489x0.500000
colonized germ free0.500000
seattle0.500000
age 7 months0.500000
mammalian milk beverage0.500000
phascolarctos cinereus0.500000
koala0.500000
cape otway0.500000
LOWER IN eucalyptus obliqua0.500000
LOWER IN eucalyptus obliqua diet0.500000
eucalyptus viminalis0.500000
eucalyptus viminalis diet0.500000
juvenile0.500000
pancreatitis0.500000
acute pancreatitis0.500000
stroke0.500000
before hsct0.500000
low fiber0.500000
children0.500000
age > 1 year0.500000
age 6-14 years0.500000
hangzhou city prefecture0.500000
LOWER IN estonia0.500000
age one year0.500000
cefoperazone0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
little physical activity0.500000
LOWER IN physical activity0.500000
rhesus macaque0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
equine grass sickness0.500000
indomethacin0.500000
non-steroidal anti-inflammatory drug0.500000
adriatic sea coastal waters of italy0.500000
loggerhead sea turtle0.500000
caretta caretta0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
eucalyptus obliqua diet0.500000
LOWER IN non usa born0.500000
usa born0.500000
high fat diet + inulin0.500000
denver0.500000
red-eared slider turtle0.500000
trachemys scripta elegans0.500000
turtle farm0.500000
LOWER IN egypt0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
urocyon littoralis0.500000
perianal skin0.500000
LOWER IN bacterial vaginosis0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age >940.500000
age 13-140.500000
LOWER IN mexico0.500000
hmong0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
LOWER IN russia0.500000
LOWER IN plant diet0.500000
age<17 years0.500000
LOWER IN peru0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.876344
homo sapiens0.758065
united states of america0.376344
adult0.338710
china0.193548
research facility0.155914
infant0.129032
LOWER IN control0.123656
mouse0.102151
mus musculus0.102151
crohn's disease0.075269
control0.075269
germany0.064516
child0.064516
ulcerative colitis0.048387
guangzhou city prefecture0.048387
c57bl/60.048387
hospital0.043011
clostridium difficile intestinal infectious disease0.043011
age 1 year0.043011
formula fed0.043011
canada0.043011
biopsy0.037634
australia0.037634
farm0.037634
wild0.032258
terminal ileum0.032258
city0.032258
rectum0.032258
obsolete_juvenile stage0.032258
age 8 weeks0.032258
taconic farms0.032258
state of california0.026882
kingdom of spain0.026882
italy0.026882
diarrhea0.026882
age < 3 years0.026882
finland0.026882
state of georgia0.026882
female0.026882
antibiotic0.021505
clostridium difficile infection0.021505
colonized germ free0.021505
seattle0.021505
sigmoid colon0.021505
rat0.021505
caecum0.021505
colon0.021505
pig0.021505
sus scrofa0.021505
tucson0.016129
biopsy site0.016129
state of michigan0.016129
age 3 months0.016129
phascolarctos cinereus0.016129
koala0.016129
cape otway0.016129
juvenile organism0.016129
rattus norvegicus0.016129
LOWER IN breast fed0.016129
age0.016129
c57bl/6j0.016129
state of new york0.016129
age 50-60 years0.016129
nanning city prefecture0.016129
LOWER IN male0.016129
age 1 month0.016129
monkey0.016129
captive0.016129
state of oklahoma0.016129
hispanic or latin american0.016129
jackson laboratories0.016129
LOWER IN jackson laboratories0.016129
jiangsu province0.016129
LOWER IN rural community0.016129
irritable bowel syndrome0.010753
after hcst0.010753
hematopoietic stem cell transplant0.010753
schizophrenia0.010753
LOWER IN feces0.010753
state of minnesota0.010753
breast fed0.010753
commonwealth of pennsylvania0.010753
inflammatory bowel disease0.010753
LOWER IN metronidazole0.010753
LOWER IN vancomycin0.010753
LOWER IN antibiotic0.010753
valladolid0.010753
commonwealth of virginia0.010753
systemic lupus erythematosus0.010753
remission0.010753
kingdom of norway0.010753
oslo0.010753
LOWER IN adult0.010753
clostridium difficile colitis0.010753
cystic fibrosis0.010753
cftr s489x0.010753
age 7 months0.010753
eucalyptus viminalis diet0.010753
juvenile0.010753
Exp. ID User ID Description Date Region Flag Sequences
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in israel research facility mouse mus musculus feces antibiotic )2018-10-23v4No1 / 3
394amnon high in ulcerative colitis compared to control in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 8
294amnon high in irritable bowel syndrome compared to control in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 9
629amnon high in acquired immunodeficiency syndrome hiv infection compared to control in adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 10
655amnoncommon in patients after hematopoietic stem cell transplant (common after hcst, hematopoietic stem cell transplant, italy, feces, homo sapiens)2020-09-13v3No1 / 10
689amnoncommon non c. diff diarrhea, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 12
502amnon high in schizophrenia compared to control in homo sapiens feces adult united states of america 2019-03-12v4No1 / 13
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v4No1 / 14
185amnoncommon in patients with c. diff infection before treatment (common homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
779amnon high in crohn's disease compared to control in guangzhou city prefecture homo sapiens adult china feces 2021-04-28v4No1 / 15
797amnon high in age 1 year compared to age 7 months in breast fed germany infant homo sapiens feces 2021-06-13v3No1 / 15
94amnoncommon homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
659amnon high in before antibiotics compared to doxycycline metronidazole amoxicillin vancomycin antibiotic in ulcerative colitis acute severe colitis homo sapiens child feces 2020-09-19v4No1 / 16
728amnoncommon clostridium difficile infection, adult, hospital, valladolid, kingdom of spain, clostridium difficile intestinal infectious disease, feces, homo sapiens2021-01-05v3No1 / 16
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 17
12amnon high in chronic fatigue syndrome compared to control in homo sapiens feces new york county 2016-11-02v4No1 / 18
713amnondominant remission, crohn's disease, feces, homo sapiens2028-05-21v3No1 / 18
330amnon high in infant age 1 year compared to adult age 30-40 in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 19
689amnoncommon clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 19
292amnondominant homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 20
619amnondominant cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 20
797amnondominant age 7 months, formula fed, infant, germany, homo sapiens, feces2021-06-13v3No1 / 20
797amnondominant formula fed, age 3 months, infant, germany, homo sapiens, feces2021-06-13v3No1 / 20
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in homo sapiens feces infant )2016-12-01v4No1 / 21
779amnondominant crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 21
728amnondominant clostridium difficile infection, adult, hospital, valladolid, kingdom of spain, clostridium difficile intestinal infectious disease, feces, homo sapiens2021-01-05v3No1 / 21
94amnondominant homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (dominant homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
689amnondominant clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 22
779amnoncommon crohn's disease, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 22
619amnondominant control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 22
655amnondominant in patients after hematopoietic stem cell transplant (dominant after hcst, hematopoietic stem cell transplant, italy, feces, homo sapiens)2020-09-13v3No1 / 22
713amnoncommon remission, crohn's disease, feces, homo sapiens2028-05-21v3No1 / 22
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 23
779amnondominant ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 23
797amnoncommon formula fed, age 1 year, infant, germany, homo sapiens, feces2021-06-13v3No1 / 23
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 24
541amnonlower in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus viminalis eucalyptus viminalis diet compared to eucalyptus obliqua eucalyptus obliqua diet in phascolarctos cinereus koala feces australia wild cape otway )2019-08-01v4No1 / 24
641amnoncommon united states of america, state of georgia, research facility, juvenile organism, juvenile, feces, chelonia mydas, green turtle2020-08-23v3No1 / 24
641amnondominant united states of america, state of georgia, research facility, juvenile organism, juvenile, feces, chelonia mydas, green turtle2020-08-23v3No1 / 24
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, ulcerative colitis, inflammatory bowel disease, crohn's disease2018-11-14v4No1 / 25
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 25
779amnoncommon ulcerative colitis, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 25
714amnondominant germany, biopsy, sigmoid colon, terminal ileum, homo sapiens2028-05-21v3No1 / 25
399amnondominant feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 27
399amnon high in crohn's disease compared to control in feces united states of america homo sapiens 2018-11-16v4No1 / 27
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
390amnoncommon homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 31
655amnoncommon in patients before hematopoietic stem cell transplant (common before hsct, italy, feces, homo sapiens)2020-09-13v3No1 / 31
797amnon high in formula fed compared to breast fed in age 7 months germany infant feces homo sapiens 2021-06-13v3No1 / 31
404amnonnegatively correlated with fiber intake ( high in low fiber compared to plant fiber cell high fiber in homo sapiens feces adult colombia city )2018-11-20v4No1 / 32
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 34
284amnon high in age 1 year compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v4No1 / 35
669amnoncommon age 1 year, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 35
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens infant united states of america 2017-11-05v4No1 / 37
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 38
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 39
797amnon high in age 3 months compared to age 1 month in formula fed germany infant homo sapiens feces 2021-06-13v3No1 / 39
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 40
714amnoncommon germany, biopsy, sigmoid colon, terminal ileum, homo sapiens2028-05-21v3No1 / 40
825amnoncommon control, age 6-14 years, hangzhou city prefecture, china, child, homo sapiens, feces2021-08-12v3No1 / 40
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 45
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 46
591amnoncommon homo sapiens, feces, adult, age 50-80 years, united states of america, parkinson's disease2020-02-17v4No1 / 47
779amnoncommon control, feces, china, adult, homo sapiens, guangzhou city prefecture2021-04-28v4No1 / 47
651amnoncommon parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 49
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 50
797amnoncommon breast fed, age 2 years, child, germany, homo sapiens, feces2021-06-13v3No1 / 50
650amnoncommon african american, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 52
797amnon high in infant age 1 year compared to child age 2 years in formula fed germany homo sapiens feces 2021-06-13v3No1 / 52
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 54
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
591amnoncommon homo sapiens, feces, adult, age 50-80 years, united states of america, control2020-02-17v4No1 / 56
650amnon high in female compared to male in feces adult homo sapiens united states of america state of new york 2020-09-10v4No1 / 57
651amnoncommon control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 58
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 59
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
619amnoncommon control, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 61
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
671amnon high in age 1 month compared to age 3 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 64
619amnoncommon cystic fibrosis, cftr s489x, colonized germ free, seattle, united states of america, feces, research facility, mus musculus, mouse2020-05-04v3No1 / 64
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
448amnoncommon equus caballus, horse, feces, farm, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 65
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 68
644amnon high in female compared to male in adult united states of america hispanic or latin american feces homo sapiens 2020-08-31v4No1 / 69
797amnon high in formula fed compared to breast fed in germany age 1 month infant feces homo sapiens 2021-06-13v3No1 / 69
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in indomethacin non-steroidal anti-inflammatory drug compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 72
448amnon high in equine grass sickness disease compared to control in equus caballus horse feces farm united kingdom 2019-01-08v4No1 / 72
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 72
810amnoncommon in sea turtle feces from sea turtle rescue center (common adriatic sea coastal waters of italy, feces, mediterranean sea, research facility, italy, loggerhead sea turtle, caretta caretta)2021-06-22v3No1 / 72
797amnon high in formula fed compared to breast fed in age 3 months germany infant feces homo sapiens 2021-06-13v3No1 / 75
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 77
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 77
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v4No1 / 78
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic neomycin ampicillin compared to control in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v4No1 / 80
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
590amnoncommon china, red-eared slider turtle, trachemys scripta elegans, age 3-5 weeks, intestine, turtle farm, farm, hainan autonomous prefecture2020-02-10v4No1 / 83
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, perianal skin, rectum2020-01-22v4No1 / 88
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v4No1 / 93
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada ileum terminal ileum 2019-07-29v4No1 / 104
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada colon right colon 2019-07-29v4No1 / 108
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 120
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v4No1 / 130
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v4No1 / 132
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v4No1 / 135
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 148
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v4No1 / 151
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 170
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 171
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 172
529amnoncommon in patients that underwent low anterior resection (common homo sapiens, feces, taiwan, taipei city, adult, low anterior resection)2019-07-18v3No1 / 172
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 183
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 185
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 189
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
669amnon high in age 1 year compared to age 2 months in sweden infant feces homo sapiens 2020-09-26v4No1 / 212
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
671amnon high in state of california compared to state of oregon in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 217
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 231
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to metronidazole neomycin vancomycin antibiotic in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 301
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 347
537amnonlower in feces of deer mice grown in captivity compared to wild caught ( high in wild compared to captive research facility in feces canada peromyscus maniculatus deer mice age 3-5 weeks province of ontario algonquin provincial park )2019-07-28v3No1 / 358
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 384
582amnon high in perianal skin rectum compared to ear canal external acoustic meatus in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 400
666amnoncommon rattus rattus, rat, italy, feces2020-09-25v3No1 / 406
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
650amnon high in european caucasian compared to asian in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 475
657amnoncommon research facility, china, qinghai province, rumen liquid, rumen, age < 1 year, lamb, sheep, ovis aries2020-09-13v4No1 / 517
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
372amnon high in mouse chow compared to high fat diet in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 579
729amnon high in captive zoological garden europe compared to wild cameroon in gorilla gorilla monkey feces 2021-01-05v3No1 / 656
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081

Problems / suggestions? Please email info AT dbbact DOT org