Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.463216
feces0.428571
adult0.303158
united states of america0.258169
infant0.162602
china0.143426
LOWER IN control0.142703
research facility0.120493
mouse0.116086
crohn's disease0.113514
mus musculus0.109718
child0.106952
ulcerative colitis0.093458
canada0.088889
c57bl/60.082192
clostridium difficile intestinal infectious disease0.076433
rectum0.074074
obsolete_juvenile stage0.074074
age 8 weeks0.072727
australia0.072289
city0.070671
taconic farms0.070175
hospital0.068966
control0.066225
diarrhea0.065789
biopsy0.064725
age < 3 years0.064725
age 1 year0.062370
finland0.060790
state of california0.057307
farm0.054570
terminal ileum0.052288
colon0.052288
caecum0.051613
wild0.051414
female0.050505
antibiotic0.049689
LOWER IN male0.040000
biopsy site0.039735
state of oklahoma0.039604
tucson0.039216
phascolarctos cinereus0.039216
koala0.039216
cape otway0.039216
age 50-60 years0.039216
nanning city prefecture0.039216
LOWER IN rural community0.039216
hispanic or latin american0.038462
state of michigan0.038095
guangzhou city prefecture0.037736
state of new york0.037736
LOWER IN jackson laboratories0.037736
rattus norvegicus0.037383
c57bl/6j0.037037
state of georgia0.037037
jackson laboratories0.036364
jiangsu province0.036364
age0.035714
rat0.035398
kingdom of spain0.035088
parkinson's disease0.026846
LOWER IN age 2 months0.026667
age > 1 year0.026667
irritable bowel syndrome0.026490
schizophrenia0.026490
LOWER IN vancomycin0.026490
inflammatory bowel disease0.026490
oslo0.026490
eucalyptus viminalis diet0.026490
pancreatitis0.026490
acute pancreatitis0.026490
stroke0.026490
sigmoid colon0.026490
children0.026490
age one year0.026490
nephrolithiasis0.026490
rhesus macaque0.026490
equine grass sickness0.026490
disease0.026490
age 3-60.026490
urocyon littoralis catalinae0.026490
santa catalina island fox0.026490
santa catalina island0.026490
urocyon littoralis0.026490
perianal skin0.026490
age >940.026490
LOWER IN russia0.026490
LOWER IN small village0.026490
clostridium difficile infection0.026144
clostridium difficile colitis0.026144
nanchang city prefecture0.026144
age 50-80 years0.026144
state of alabama0.026144
LOWER IN metronidazole0.025974
systemic lupus erythematosus0.025806
sichuan province0.025806
age 1 month0.025806
commonwealth of virginia0.025478
macaca mulatta0.025478
right colon0.025478
Fraction of dbbact annotations with this term covered by the query
TermScore
ulcerative colitis2.500000
diarrhea1.000000
parkinson's disease1.000000
LOWER IN male1.000000
crohn's disease0.777778
biopsy site0.750000
biopsy0.666667
age < 3 years0.666667
terminal ileum0.666667
colon0.666667
LOWER IN age 2 months0.666667
age > 1 year0.666667
state of oklahoma0.666667
canada0.666667
clostridium difficile intestinal infectious disease0.600000
irritable bowel syndrome0.500000
acquired immunodeficiency syndrome0.500000
tucson0.500000
schizophrenia0.500000
LOWER IN doxycycline0.500000
LOWER IN amoxicillin0.500000
LOWER IN vancomycin0.500000
before antibiotics0.500000
acute severe colitis0.500000
inflammatory bowel disease0.500000
new york county0.500000
chronic fatigue syndrome0.500000
oslo0.500000
LOWER IN age 30-400.500000
mammalian milk beverage0.500000
phascolarctos cinereus0.500000
koala0.500000
cape otway0.500000
LOWER IN eucalyptus obliqua0.500000
LOWER IN eucalyptus obliqua diet0.500000
eucalyptus viminalis0.500000
eucalyptus viminalis diet0.500000
pancreatitis0.500000
acute pancreatitis0.500000
stroke0.500000
low fiber0.500000
sigmoid colon0.500000
caecum0.500000
children0.500000
LOWER IN estonia0.500000
age one year0.500000
cefoperazone0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
little physical activity0.500000
LOWER IN physical activity0.500000
rhesus macaque0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
equine grass sickness0.500000
disease0.500000
indomethacin0.500000
non-steroidal anti-inflammatory drug0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
LOWER IN non usa born0.500000
usa born0.500000
eucalyptus obliqua diet0.500000
high fat diet + inulin0.500000
denver0.500000
red-eared slider turtle0.500000
trachemys scripta elegans0.500000
turtle farm0.500000
LOWER IN egypt0.500000
urocyon littoralis catalinae0.500000
santa catalina island fox0.500000
santa catalina island0.500000
urocyon littoralis0.500000
perianal skin0.500000
LOWER IN bacterial vaginosis0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age >940.500000
LOWER IN mexico0.500000
age 13-140.500000
hmong0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
LOWER IN russia0.500000
LOWER IN plant diet0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
LOWER IN rural community0.500000
estonia0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
farm 10.500000
LOWER IN farm 20.500000
glasgow0.500000
age 130.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.857143
homo sapiens0.775510
united states of america0.435374
adult0.367347
china0.183673
research facility0.149660
LOWER IN control0.149660
mouse0.102041
mus musculus0.102041
infant0.102041
child0.068027
control0.068027
crohn's disease0.061224
c57bl/60.061224
ulcerative colitis0.047619
australia0.047619
canada0.047619
hospital0.040816
clostridium difficile intestinal infectious disease0.040816
city0.040816
rectum0.040816
obsolete_juvenile stage0.040816
age 8 weeks0.040816
taconic farms0.040816
state of california0.034014
biopsy0.034014
diarrhea0.034014
age 1 year0.034014
age < 3 years0.034014
finland0.034014
wild0.034014
female0.034014
farm0.034014
antibiotic0.027211
terminal ileum0.027211
caecum0.027211
colon0.027211
kingdom of spain0.020408
tucson0.020408
biopsy site0.020408
state of michigan0.020408
phascolarctos cinereus0.020408
koala0.020408
cape otway0.020408
rat0.020408
rattus norvegicus0.020408
guangzhou city prefecture0.020408
age0.020408
c57bl/6j0.020408
state of new york0.020408
age 50-60 years0.020408
nanning city prefecture0.020408
LOWER IN male0.020408
state of oklahoma0.020408
hispanic or latin american0.020408
jackson laboratories0.020408
state of georgia0.020408
LOWER IN jackson laboratories0.020408
jiangsu province0.020408
LOWER IN rural community0.020408
irritable bowel syndrome0.013605
schizophrenia0.013605
LOWER IN feces0.013605
state of minnesota0.013605
LOWER IN metronidazole0.013605
LOWER IN vancomycin0.013605
LOWER IN antibiotic0.013605
commonwealth of pennsylvania0.013605
inflammatory bowel disease0.013605
commonwealth of virginia0.013605
systemic lupus erythematosus0.013605
kingdom of norway0.013605
oslo0.013605
LOWER IN adult0.013605
clostridium difficile infection0.013605
clostridium difficile colitis0.013605
eucalyptus viminalis diet0.013605
nanchang city prefecture0.013605
pancreatitis0.013605
acute pancreatitis0.013605
stroke0.013605
sigmoid colon0.013605
children0.013605
LOWER IN age 2 months0.013605
sweden0.013605
age > 1 year0.013605
sichuan province0.013605
kingdom of denmark0.013605
age one year0.013605
age 50-80 years0.013605
parkinson's disease0.013605
state of alabama0.013605
nephrolithiasis0.013605
age 1 month0.013605
monkey0.013605
rhesus macaque0.013605
macaca mulatta0.013605
captive0.013605
equus caballus0.013605
horse0.013605
Exp. ID User ID Description Date Region Flag Sequences
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in israel research facility mouse mus musculus feces antibiotic )2018-10-23v4No1 / 2
394amnon high in ulcerative colitis compared to control in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 7
294amnon high in irritable bowel syndrome compared to control in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 8
629amnon high in acquired immunodeficiency syndrome hiv infection compared to control in adult amsterdam kingdom of the netherlands feces homo sapiens 2020-05-31v4No1 / 9
689amnoncommon non c. diff diarrhea, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 12
502amnon high in schizophrenia compared to control in homo sapiens feces adult united states of america 2019-03-12v4No1 / 12
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v4No1 / 13
185amnoncommon in patients with c. diff infection before treatment (common homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 13
659amnon high in before antibiotics compared to doxycycline metronidazole amoxicillin vancomycin antibiotic in ulcerative colitis acute severe colitis homo sapiens child feces 2020-09-19v4No1 / 15
94amnoncommon homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 15
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 15
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 16
12amnon high in chronic fatigue syndrome compared to control in homo sapiens feces new york county 2016-11-02v4No1 / 17
330amnon high in infant age 1 year compared to adult age 30-40 in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 18
689amnoncommon clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 19
292amnondominant homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 19
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in homo sapiens feces infant )2016-12-01v4No1 / 20
94amnondominant homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 21
185amnonhigh freq. in patients with c. diff infection before treatment (dominant homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 21
689amnondominant clostridium difficile infection, clostridium difficile colitis, hospital, adult, tucson, united states of america, feces, homo sapiens2028-03-11v4No1 / 22
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 22
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 23
541amnonlower in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus viminalis eucalyptus viminalis diet compared to eucalyptus obliqua eucalyptus obliqua diet in phascolarctos cinereus koala feces australia wild cape otway )2019-08-01v4No1 / 23
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, ulcerative colitis, inflammatory bowel disease, crohn's disease2018-11-14v4No1 / 24
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 24
399amnondominant feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 26
399amnon high in crohn's disease compared to control in feces united states of america homo sapiens 2018-11-16v4No1 / 26
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 29
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 29
390amnoncommon homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 30
404amnonnegatively correlated with fiber intake ( high in low fiber compared to plant fiber cell high fiber in homo sapiens feces adult colombia city )2018-11-20v4No1 / 31
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 33
284amnon high in age 1 year compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v4No1 / 34
669amnoncommon age 1 year, sweden, infant, feces, homo sapiens2020-09-26v4No1 / 35
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 35
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens infant united states of america 2017-11-05v4No1 / 36
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 37
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 38
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 39
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 43
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 44
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 45
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 45
591amnoncommon homo sapiens, feces, adult, age 50-80 years, united states of america, parkinson's disease2020-02-17v4No1 / 46
651amnoncommon parkinson's disease, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 48
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 49
650amnoncommon african american, state of new york, united states of america, homo sapiens, adult, feces2020-09-09v4No1 / 51
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 52
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 52
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 53
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 54
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 55
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 55
591amnoncommon homo sapiens, feces, adult, age 50-80 years, united states of america, control2020-02-17v4No1 / 55
650amnon high in female compared to male in feces adult homo sapiens united states of america state of new york 2020-09-10v4No1 / 56
651amnoncommon control, state of alabama, united states of america, adult, feces, homo sapiens2020-09-13v4No1 / 57
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 58
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 60
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 62
671amnon high in age 1 month compared to age 3 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 64
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 64
448amnoncommon equus caballus, horse, feces, farm, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 64
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 67
644amnon high in female compared to male in adult united states of america hispanic or latin american feces homo sapiens 2020-08-31v4No1 / 68
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in indomethacin non-steroidal anti-inflammatory drug compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 71
448amnon high in equine grass sickness disease compared to control in equus caballus horse feces farm united kingdom 2019-01-08v4No1 / 71
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 71
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v4No1 / 75
644amnonlower in individuals born in latin america compared to indivuals born in usa ( high in usa born compared to non usa born in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 76
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 76
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet + inulin2020-02-10v4No1 / 77
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic neomycin ampicillin compared to control in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v4No1 / 79
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 80
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 81
590amnoncommon china, red-eared slider turtle, trachemys scripta elegans, age 3-5 weeks, intestine, turtle farm, farm, hainan autonomous prefecture2020-02-10v4No1 / 82
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 85
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 87
582amnoncommon urocyon littoralis catalinae, santa catalina island fox, santa catalina island, united states of america, wild, urocyon littoralis, perianal skin, rectum2020-01-22v4No1 / 87
601amnoncommon homo sapiens, feces, china, adult, control2020-03-30v4No1 / 92
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada ileum terminal ileum 2019-07-29v4No1 / 103
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 106
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 106
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada colon right colon 2019-07-29v4No1 / 107
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 108
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 109
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 113
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 116
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 117
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 117
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 119
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 119
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 120
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v4No1 / 129
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v4No1 / 131
644amnonlower in individuals born in mexico compared to cuba ( high in cuba compared to mexico in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 133
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 133
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 134
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v4No1 / 134
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 137
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 144
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 147
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 148
589amnoncommon mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, mouse chow, low fat diet, united states of america, state of georgia2020-02-10v4No1 / 150
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 161
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 161
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 167
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 168
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 169
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 170
589amnoncommon in high fat diet supplemented with cellulose in mice feces (common mouse, mus musculus, c57bl/6, research facility, feces, jackson laboratories, united states of america, state of georgia, high fat diet)2020-02-10v4No1 / 171
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 182
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 183
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 188
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 188
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 188
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 196
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 207
669amnon high in age 1 year compared to age 2 months in sweden infant feces homo sapiens 2020-09-26v4No1 / 212
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 213
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 215
671amnon high in state of california compared to state of oregon in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 217
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 217
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 220
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 226
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 230
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 236
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 238
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 262
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 280
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 294
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to metronidazole neomycin vancomycin antibiotic in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 301
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 318
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 342
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 372
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 383
582amnon high in perianal skin rectum compared to ear canal external acoustic meatus in wild united states of america santa catalina island urocyon littoralis santa catalina island fox urocyon littoralis catalinae 2020-01-22v4No1 / 399
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 421
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 473
650amnon high in european caucasian compared to asian in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 474
657amnoncommon research facility, china, qinghai province, rumen liquid, rumen, age < 1 year, lamb, sheep, ovis aries2020-09-13v4No1 / 516
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 556
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 566
372amnon high in mouse chow compared to high fat diet in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 578
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 835
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1080

Problems / suggestions? Please email info AT dbbact DOT org