Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.567176
feces0.462764
adult0.341356
united states of america0.244497
LOWER IN control0.185349
infant0.184959
china0.156997
crohn's disease0.149289
child0.135338
clostridium difficile intestinal infectious disease0.100840
ulcerative colitis0.100418
obsolete_juvenile stage0.096774
city0.093604
research facility0.088300
biopsy0.086768
age < 3 years0.085837
diarrhea0.079051
finland0.079051
mouse0.072029
mus musculus0.068571
antibiotic0.067227
rectum0.066116
farm0.058968
australia0.058394
caecum0.058394
control0.054054
biopsy site0.053097
state of oklahoma0.052863
LOWER IN rural community0.052632
guangzhou city prefecture0.052174
age 50-60 years0.052174
nanning city prefecture0.052174
age 1 year0.051502
state of michigan0.050209
rattus norvegicus0.050209
jiangsu province0.049587
kingdom of spain0.048980
c57bl/6j0.048387
hospital0.047244
rat0.047244
age0.046875
state of california0.043636
female0.043165
age > 1 year0.035714
irritable bowel syndrome0.035398
schizophrenia0.035398
commonwealth of pennsylvania0.035398
inflammatory bowel disease0.035398
oslo0.035398
nanchang city prefecture0.035398
pancreatitis0.035398
acute pancreatitis0.035398
stroke0.035398
terminal ileum0.035398
sigmoid colon0.035398
children0.035398
sichuan province0.035398
age one year0.035398
nephrolithiasis0.035398
equine grass sickness0.035398
age 3-60.035398
age >940.035398
LOWER IN russia0.035398
LOWER IN small village0.035398
systemic lupus erythematosus0.034783
horse0.034783
rural community0.034483
equus caballus0.034188
sus scrofa0.033898
pig0.033898
state of minnesota0.033613
commonwealth of virginia0.033613
kingdom of denmark0.033058
disease0.033058
LOWER IN feces0.032520
kingdom of norway0.032000
LOWER IN adult0.032000
united kingdom0.031496
diet0.030303
colon0.027972
probiotic0.018018
new york county0.018018
chronic fatigue syndrome0.018018
LOWER IN age 30-400.018018
milk0.018018
LOWER IN non c. diff diarrhea0.018018
low fiber0.018018
LOWER IN age 2 months0.018018
LOWER IN estonia0.018018
cefoperazone0.018018
little physical activity0.018018
LOWER IN physical activity0.018018
native american0.018018
arapaho0.018018
cheyenne0.018018
indomethacin0.018018
non-steroidal anti-inflammatory drug0.018018
LOWER IN age 8-120.018018
LOWER IN age 13-140.018018
neomycin0.018018
Fraction of dbbact annotations with this term covered by the query
TermScore
biopsy0.800000
crohn's disease0.777778
biopsy site0.750000
age < 3 years0.666667
age > 1 year0.666667
state of oklahoma0.666667
clostridium difficile intestinal infectious disease0.600000
LOWER IN rural community0.600000
ulcerative colitis0.571429
probiotic0.500000
irritable bowel syndrome0.500000
schizophrenia0.500000
commonwealth of pennsylvania0.500000
inflammatory bowel disease0.500000
new york county0.500000
chronic fatigue syndrome0.500000
oslo0.500000
LOWER IN age 30-400.500000
milk0.500000
LOWER IN non c. diff diarrhea0.500000
nanchang city prefecture0.500000
pancreatitis0.500000
acute pancreatitis0.500000
guangzhou city prefecture0.500000
stroke0.500000
low fiber0.500000
terminal ileum0.500000
sigmoid colon0.500000
children0.500000
LOWER IN age 2 months0.500000
sichuan province0.500000
LOWER IN estonia0.500000
age one year0.500000
cefoperazone0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
little physical activity0.500000
LOWER IN physical activity0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
equine grass sickness0.500000
indomethacin0.500000
non-steroidal anti-inflammatory drug0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
neomycin0.500000
denver0.500000
LOWER IN egypt0.500000
LOWER IN bacterial vaginosis0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age >940.500000
age 13-140.500000
thailand0.500000
hmong0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
toronto0.500000
LOWER IN russia0.500000
LOWER IN plant diet0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
estonia0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
farm 10.500000
LOWER IN farm 20.500000
glasgow0.500000
age 130.500000
age 1-3 weeks0.500000
spondylitis0.500000
spondyloarthritis0.500000
stomach neoplasm0.500000
gastric carcinoma0.500000
atherosclerosis0.500000
shantytown0.500000
lima0.500000
LOWER IN el salado0.500000
bangladesh0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN thailand0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN age one month0.500000
LOWER IN age <1 year0.500000
LOWER IN wound0.500000
LOWER IN ulcer0.500000
epilithic0.500000
homo sapiens0.422535
infant0.411765
antibiotic0.400000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.880734
homo sapiens0.862385
united states of america0.394495
adult0.339450
china0.211009
LOWER IN control0.192661
infant0.119266
research facility0.091743
child0.082569
crohn's disease0.082569
mouse0.055046
mus musculus0.055046
ulcerative colitis0.055046
clostridium difficile intestinal infectious disease0.055046
city0.055046
control0.055046
obsolete_juvenile stage0.055046
biopsy0.045872
diarrhea0.045872
age < 3 years0.045872
finland0.045872
antibiotic0.036697
australia0.036697
rectum0.036697
caecum0.036697
farm0.036697
state of california0.027523
kingdom of spain0.027523
biopsy site0.027523
state of michigan0.027523
age 1 year0.027523
hospital0.027523
rat0.027523
rattus norvegicus0.027523
guangzhou city prefecture0.027523
female0.027523
age0.027523
c57bl/6j0.027523
age 50-60 years0.027523
nanning city prefecture0.027523
state of oklahoma0.027523
jiangsu province0.027523
LOWER IN rural community0.027523
irritable bowel syndrome0.018349
schizophrenia0.018349
LOWER IN feces0.018349
state of minnesota0.018349
commonwealth of pennsylvania0.018349
inflammatory bowel disease0.018349
commonwealth of virginia0.018349
systemic lupus erythematosus0.018349
kingdom of norway0.018349
oslo0.018349
LOWER IN adult0.018349
nanchang city prefecture0.018349
pancreatitis0.018349
acute pancreatitis0.018349
stroke0.018349
terminal ileum0.018349
sigmoid colon0.018349
colon0.018349
children0.018349
age > 1 year0.018349
sichuan province0.018349
kingdom of denmark0.018349
age one year0.018349
nephrolithiasis0.018349
equus caballus0.018349
horse0.018349
united kingdom0.018349
equine grass sickness0.018349
disease0.018349
age 3-60.018349
age >940.018349
rural community0.018349
LOWER IN russia0.018349
diet0.018349
LOWER IN small village0.018349
sus scrofa0.018349
pig0.018349
israel0.009174
probiotic0.009174
new york county0.009174
chronic fatigue syndrome0.009174
LOWER IN age 30-400.009174
milk0.009174
LOWER IN breast milk0.009174
LOWER IN non c. diff diarrhea0.009174
colombia0.009174
low fiber0.009174
LOWER IN plant fiber cell0.009174
LOWER IN high fiber0.009174
LOWER IN age 2 months0.009174
LOWER IN age < 1 year0.009174
LOWER IN estonia0.009174
cefoperazone0.009174
little physical activity0.009174
LOWER IN physical activity0.009174
native american0.009174
arapaho0.009174
Exp. ID User ID Description Date Sequences
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in israel research facility mouse mus musculus feces antibiotic )2018-10-231 / 3
394amnon high in ulcerative colitis compared to control in homo sapiens feces adult united states of america state of california 2018-11-061 / 8
294amnon high in irritable bowel syndrome compared to control in homo sapiens feces adult kingdom of spain 2018-02-091 / 9
502amnon high in schizophrenia compared to control in homo sapiens feces adult united states of america 2019-03-121 / 13
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-191 / 14
185amnoncommon in patients with c. diff infection before treatment (common homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-201 / 14
94amnoncommon homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-121 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child inflammatory bowel disease crohn's disease ulcerative colitis compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-131 / 16
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-031 / 17
12amnon high in chronic fatigue syndrome compared to control in homo sapiens feces new york county 2016-11-021 / 18
330amnon high in infant age 1 year compared to adult age 30-40 in homo sapiens feces kingdom of norway oslo 2018-05-131 / 19
292amnonhighfreq homo sapiens, china, adult, feces, crohn's disease2018-02-051 / 20
24amnonappears on transition to cow milk ( high in milk compared to breast milk in homo sapiens feces infant )2016-12-011 / 21
94amnonhighfreq homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-121 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (highfreq homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-201 / 22
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-131 / 23
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in homo sapiens feces australia hospital diarrhea )2018-11-041 / 24
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, inflammatory bowel disease, crohn's disease, ulcerative colitis2018-11-141 / 25
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, pancreatitis, acute pancreatitis2018-12-091 / 25
399amnonhighfreq feces, united states of america, research facility, rat, rattus norvegicus2018-11-161 / 27
399amnon high in crohn's disease compared to control in feces united states of america homo sapiens 2018-11-161 / 27
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-191 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in homo sapiens feces china guangzhou city prefecture adult )2018-05-151 / 30
390amnoncommon homo sapiens, feces, diarrhea, clostridium difficile intestinal infectious disease, australia, hospital2018-11-041 / 31
404amnonnegatively correlated with fiber intake ( high in low fiber compared to plant fiber cell high fiber in homo sapiens feces adult colombia city )2018-11-201 / 32
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-141 / 34
284amnon high in age 1 year compared to age 2 months in homo sapiens female feces state of california infant 2018-01-271 / 35
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-121 / 36
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens infant united states of america 2017-11-051 / 37
390amnoncommon homo sapiens, feces, diarrhea, australia, hospital2018-11-041 / 38
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-131 / 39
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-141 / 40
36amnoncommon homo sapiens, feces, sichuan province2016-12-061 / 44
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in homo sapiens feces infant age < 3 years )2017-11-131 / 45
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-141 / 46
428amnon high in acute pancreatitis pancreatitis compared to control in homo sapiens adult feces china nanchang city prefecture 2018-12-091 / 46
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-061 / 50
292amnoncommon homo sapiens, china, adult, feces, ulcerative colitis2018-02-051 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, china, stroke, adult, guangzhou city prefecture)2018-05-151 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in homo sapiens feces adult age 50-60 years china nanning city prefecture )2018-01-271 / 54
292amnoncommon homo sapiens, china, adult, feces, crohn's disease2018-02-051 / 55
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-031 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-061 / 56
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in homo sapiens feces united states of america )2017-12-041 / 59
333amnoncommon in healthy controls feces (common homo sapiens, feces, china, guangzhou city prefecture, adult, control)2018-05-151 / 61
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-121 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-141 / 65
448amnoncommon equus caballus, horse, feces, united kingdom, farm, equine grass sickness, disease2019-01-081 / 65
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-151 / 68
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in indomethacin non-steroidal anti-inflammatory drug compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-061 / 72
448amnon high in equine grass sickness disease compared to control in equus caballus horse feces united kingdom farm 2019-01-081 / 72
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in homo sapiens feces china )2018-12-301 / 76
516amnoncommon adult, state of ohio, united states of america, feces, homo sapiens2019-05-291 / 77
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic neomycin ampicillin compared to control in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-201 / 80
292amnoncommon homo sapiens, china, adult, feces, control2018-02-051 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-311 / 82
249amnoncommon homo sapiens, feces, united states of america2017-11-221 / 86
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-131 / 88
215amnoncommon homo sapiens, feces, united states of america2017-10-231 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-311 / 107
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-301 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-221 / 110
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-031 / 114
239amnoncommon homo sapiens, feces, united states of america2017-11-081 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-221 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-221 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-091 / 120
438amnoncommon feces, homo sapiens, china, age >94, jiangsu province, adult2018-12-301 / 121
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-301 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-181 / 135
10amnoncommon homo sapiens, feces, toronto2016-10-271 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-161 / 145
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-131 / 148
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-271 / 149
290amnoncommon homo sapiens, feces, china, adult, city2018-02-011 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-121 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-221 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-131 / 169
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-131 / 170
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in sus scrofa pig jinhua city prefecture china jinhua pig feces farm )2018-12-061 / 171
179amnoncommon mus musculus, mouse, oral cavity, mouth, research facility, united states of america, balb/c2017-08-131 / 183
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-161 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in crohn's disease obsolete_juvenile stage child compared to control adult in homo sapiens feces glasgow )2017-02-261 / 189
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-121 / 189
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-041 / 189
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-091 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-121 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in stomach neoplasm gastric carcinoma compared to control in adult stomach zhejiang province china homo sapiens )2019-06-261 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-101 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-011 / 218
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-071 / 227
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-011 / 231
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-211 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, nephrolithiasis)2018-01-271 / 239
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-131 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, china, nanning city prefecture, control)2018-01-271 / 281
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-281 / 295
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-271 / 319
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-181 / 343
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-131 / 373
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-041 / 384
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-061 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-131 / 422
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-301 / 474
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-141 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-121 / 567
372amnon high in mouse chow compared to high fat diet in mouse mus musculus feces research facility united states of america 2018-09-071 / 579
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-051 / 836
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-221 / 1081

Problems / suggestions? Please email info AT dbbact DOT org