Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCGAAGCAAGTCTGAAGTGAAAACCCAGGGCTCAACCCTGGGACTGCTTTGGAAACTGTTTTGCTAGAGTGTCGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.498580
feces0.438862
adult0.297359
united states of america0.233539
infant0.168363
LOWER IN control0.164448
china0.149195
crohn's disease0.135776
child0.119205
mouse0.109589
canada0.109375
research facility0.109050
mus musculus0.103004
clostridium difficile intestinal infectious disease0.091603
ulcerative colitis0.091255
australia0.089744
rectum0.088235
obsolete_juvenile stage0.088235
age 8 weeks0.086331
city0.084866
taconic farms0.082759
biopsy0.077821
age < 3 years0.077821
diarrhea0.072202
finland0.072202
wild0.065147
terminal ileum0.062992
antibiotic0.061069
c57bl/60.056872
caecum0.053215
farm0.052747
colon0.050314
biopsy site0.048000
control0.048000
state of oklahoma0.047809
LOWER IN rural community0.047619
phascolarctos cinereus0.047244
koala0.047244
cape otway0.047244
guangzhou city prefecture0.047244
age 50-60 years0.047244
nanning city prefecture0.047244
age 1 year0.046154
state of michigan0.045627
rattus norvegicus0.045627
LOWER IN jackson laboratories0.045113
c57bl/6j0.044118
jiangsu province0.044118
kingdom of spain0.043636
hospital0.043165
rat0.043165
age0.042857
state of california0.040134
female0.038710
age > 1 year0.032258
irritable bowel syndrome0.032000
schizophrenia0.032000
inflammatory bowel disease0.032000
oslo0.032000
eucalyptus viminalis diet0.032000
nanchang city prefecture0.032000
pancreatitis0.032000
acute pancreatitis0.032000
stroke0.032000
sigmoid colon0.032000
children0.032000
age one year0.032000
nephrolithiasis0.032000
equine grass sickness0.032000
age 3-60.032000
perianal skin0.032000
urocyon littoralis0.032000
santa catalina island0.032000
santa catalina island fox0.032000
urocyon littoralis catalinae0.032000
age >940.032000
LOWER IN russia0.032000
LOWER IN small village0.032000
commonwealth of pennsylvania0.031496
systemic lupus erythematosus0.031496
sichuan province0.031496
rural community0.031250
horse0.031008
sus scrofa0.030769
pig0.030769
state of minnesota0.030534
commonwealth of virginia0.030534
equus caballus0.030534
right colon0.030534
kingdom of denmark0.030075
disease0.030075
LOWER IN feces0.029412
kingdom of norway0.029197
ileum0.029197
LOWER IN adult0.028986
united kingdom0.028777
diet0.027586
probiotic0.016260
new york county0.016260
chronic fatigue syndrome0.016260
Fraction of dbbact annotations with this term covered by the query
TermScore
canada1.000000
crohn's disease0.777778
biopsy site0.750000
biopsy0.666667
age < 3 years0.666667
terminal ileum0.666667
age > 1 year0.666667
state of oklahoma0.666667
clostridium difficile intestinal infectious disease0.600000
LOWER IN rural community0.600000
ulcerative colitis0.571429
probiotic0.500000
irritable bowel syndrome0.500000
schizophrenia0.500000
inflammatory bowel disease0.500000
new york county0.500000
chronic fatigue syndrome0.500000
oslo0.500000
LOWER IN age 30-400.500000
mammalian milk beverage0.500000
LOWER IN non c. diff diarrhea0.500000
phascolarctos cinereus0.500000
koala0.500000
cape otway0.500000
LOWER IN eucalyptus obliqua0.500000
LOWER IN eucalyptus obliqua diet0.500000
eucalyptus viminalis0.500000
eucalyptus viminalis diet0.500000
nanchang city prefecture0.500000
pancreatitis0.500000
acute pancreatitis0.500000
guangzhou city prefecture0.500000
stroke0.500000
low fiber0.500000
sigmoid colon0.500000
children0.500000
LOWER IN age 2 months0.500000
LOWER IN estonia0.500000
age one year0.500000
cefoperazone0.500000
age 50-60 years0.500000
nanning city prefecture0.500000
nephrolithiasis0.500000
little physical activity0.500000
LOWER IN physical activity0.500000
native american0.500000
arapaho0.500000
cheyenne0.500000
equine grass sickness0.500000
indomethacin0.500000
non-steroidal anti-inflammatory drug0.500000
age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 13-140.500000
eucalyptus obliqua diet0.500000
neomycin0.500000
denver0.500000
perianal skin0.500000
urocyon littoralis0.500000
santa catalina island0.500000
santa catalina island fox0.500000
urocyon littoralis catalinae0.500000
LOWER IN egypt0.500000
LOWER IN bacterial vaginosis0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age >940.500000
age 13-140.500000
hmong0.500000
LOWER IN karen0.500000
LOWER IN myanmar0.500000
toronto0.500000
LOWER IN russia0.500000
LOWER IN plant diet0.500000
age<17 years0.500000
LOWER IN peru0.500000
LOWER IN small village0.500000
LOWER IN tunapuco0.500000
estonia0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
farm 10.500000
LOWER IN farm 20.500000
glasgow0.500000
age 130.500000
age 1-3 weeks0.500000
spondyloarthritis0.500000
spondylitis0.500000
gastric carcinoma0.500000
stomach neoplasm0.500000
atherosclerosis0.500000
shantytown0.500000
lima0.500000
LOWER IN el salado0.500000
bangladesh0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN external acoustic meatus0.500000
LOWER IN ear canal0.500000
LOWER IN amerindian0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.842975
homo sapiens0.785124
united states of america0.371901
adult0.314050
china0.198347
LOWER IN control0.173554
research facility0.132231
infant0.107438
mouse0.099174
mus musculus0.099174
child0.074380
crohn's disease0.074380
australia0.057851
canada0.057851
ulcerative colitis0.049587
clostridium difficile intestinal infectious disease0.049587
city0.049587
rectum0.049587
control0.049587
obsolete_juvenile stage0.049587
c57bl/60.049587
age 8 weeks0.049587
taconic farms0.049587
biopsy0.041322
diarrhea0.041322
age < 3 years0.041322
finland0.041322
wild0.041322
antibiotic0.033058
terminal ileum0.033058
caecum0.033058
colon0.033058
farm0.033058
state of california0.024793
kingdom of spain0.024793
biopsy site0.024793
state of michigan0.024793
age 1 year0.024793
hospital0.024793
phascolarctos cinereus0.024793
koala0.024793
cape otway0.024793
rat0.024793
rattus norvegicus0.024793
guangzhou city prefecture0.024793
female0.024793
age0.024793
c57bl/6j0.024793
age 50-60 years0.024793
nanning city prefecture0.024793
state of oklahoma0.024793
LOWER IN jackson laboratories0.024793
jiangsu province0.024793
LOWER IN rural community0.024793
irritable bowel syndrome0.016529
schizophrenia0.016529
LOWER IN feces0.016529
state of minnesota0.016529
commonwealth of pennsylvania0.016529
inflammatory bowel disease0.016529
commonwealth of virginia0.016529
systemic lupus erythematosus0.016529
kingdom of norway0.016529
oslo0.016529
LOWER IN adult0.016529
eucalyptus viminalis diet0.016529
nanchang city prefecture0.016529
pancreatitis0.016529
acute pancreatitis0.016529
stroke0.016529
sigmoid colon0.016529
children0.016529
age > 1 year0.016529
sichuan province0.016529
kingdom of denmark0.016529
age one year0.016529
nephrolithiasis0.016529
equus caballus0.016529
horse0.016529
equine grass sickness0.016529
disease0.016529
united kingdom0.016529
age 3-60.016529
perianal skin0.016529
urocyon littoralis0.016529
santa catalina island0.016529
santa catalina island fox0.016529
urocyon littoralis catalinae0.016529
ileum0.016529
right colon0.016529
age >940.016529
rural community0.016529
LOWER IN russia0.016529
diet0.016529
LOWER IN small village0.016529
sus scrofa0.016529
pig0.016529
israel0.008264
probiotic0.008264
new york county0.008264
Exp. ID User ID Description Date Region Flag Sequences
385amnoncolonize probiotic supplemented mice following antibiotics treatment ( high in probiotic compared to control in israel research facility mouse mus musculus feces antibiotic )2018-10-23v4No1 / 3
394amnon high in ulcerative colitis compared to control in homo sapiens feces adult united states of america state of california 2018-11-06v4No1 / 8
294amnon high in irritable bowel syndrome compared to control in homo sapiens feces adult kingdom of spain 2018-02-09v4No1 / 9
502amnon high in schizophrenia compared to control in homo sapiens feces adult united states of america 2019-03-12v4No1 / 13
51amnonlower in stool compared to biopsies ( high in biopsy site biopsy compared to feces in homo sapiens united states of america )2017-01-19v4No1 / 14
185amnoncommon in patients with c. diff infection before treatment (common homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 14
94amnoncommon homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 16
395amnonhigher in kids with ibd compared to healthy donors ( high in child ulcerative colitis inflammatory bowel disease crohn's disease compared to control in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 16
368amnon high in systemic lupus erythematosus compared to control in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 17
12amnon high in chronic fatigue syndrome compared to control in homo sapiens feces new york county 2016-11-02v4No1 / 18
330amnon high in infant age 1 year compared to adult age 30-40 in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 19
292amnonhighfreq homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 20
24amnonappears on transition to cow milk ( high in mammalian milk beverage compared to breast milk in homo sapiens feces infant )2016-12-01v4No1 / 21
94amnonhighfreq homo sapiens, clostridium difficile intestinal infectious disease, feces, state of michigan, diarrhea2017-03-12v4No1 / 22
185amnonhigh freq. in patients with c. diff infection before treatment (highfreq homo sapiens, feces, united states of america, state of minnesota, clostridium difficile intestinal infectious disease)2017-08-20v4No1 / 22
241amnoncommon in babies age < 3 years in finland (common homo sapiens, feces, infant, age < 3 years, finland)2017-11-13v4No1 / 23
390amnonhigher in patients with c. diff diarrhea compared to non-c. diff diarrhea ( high in clostridium difficile intestinal infectious disease compared to non c. diff diarrhea in homo sapiens feces australia hospital diarrhea )2018-11-04v4No1 / 24
541amnonlower in koalas eating Eucalyptus obliqua leaves comapred to Eucalyptus viminalis ( high in eucalyptus viminalis eucalyptus viminalis diet compared to eucalyptus obliqua eucalyptus obliqua diet in phascolarctos cinereus koala feces australia wild cape otway )2019-08-01v4No1 / 24
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, child, ulcerative colitis, inflammatory bowel disease, crohn's disease2018-11-14v4No1 / 25
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, pancreatitis, acute pancreatitis, china2018-12-09v4No1 / 25
399amnonhighfreq feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 27
399amnon high in crohn's disease compared to control in feces united states of america homo sapiens 2018-11-16v4No1 / 27
320amnoncommon homo sapiens, feces, adult, crohn's disease2018-04-19v4No1 / 30
333amnonhigher in stroke patients compared to healthy controls ( high in stroke compared to control in homo sapiens feces guangzhou city prefecture adult china )2018-05-15v4No1 / 30
390amnoncommon homo sapiens, feces, clostridium difficile intestinal infectious disease, australia, hospital, diarrhea2018-11-04v4No1 / 31
404amnonnegatively correlated with fiber intake ( high in low fiber compared to plant fiber cell high fiber in homo sapiens feces adult colombia city )2018-11-20v4No1 / 32
19amnonhigher in CD compared to control in biopsies ( high in crohn's disease compared to control in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 34
284amnon high in age 1 year compared to age 2 months in homo sapiens female feces state of california infant 2018-01-27v4No1 / 35
240amnoncommon in infants age <3 years (common homo sapiens, feces, finland, infant, age < 3 years)2017-11-12v4No1 / 36
233amnon high in age age > 1 year compared to age < 1 year in feces homo sapiens infant united states of america 2017-11-05v4No1 / 37
390amnoncommon homo sapiens, feces, australia, hospital, diarrhea2018-11-04v4No1 / 38
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, infant, age 1 year2018-05-13v4No1 / 39
19amnoncommon in biopsies of children (IBD study) (common rectum, terminal ileum, sigmoid colon, caecum, colon, biopsy, children, homo sapiens, united states of america)2016-11-14v4No1 / 40
36amnoncommon homo sapiens, feces, sichuan province2016-12-06v4No1 / 44
241amnonhigher in babies from finland compared to estonia ( high in finland compared to estonia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 45
273amnoncommon feces, homo sapiens, kingdom of denmark, infant, age one year2018-01-14v4No1 / 46
428amnon high in pancreatitis acute pancreatitis compared to control in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 46
441amnonhigher after antibiotic treatment ( high in antibiotic cefoperazone compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 50
292amnoncommon homo sapiens, adult, feces, ulcerative colitis, china2018-02-05v4No1 / 53
333amnoncommon in stroke patient feces (common feces, homo sapiens, stroke, adult, guangzhou city prefecture, china)2018-05-15v4No1 / 53
286amnonhigher in feces of individuals with kidney stones ( high in nephrolithiasis compared to control in homo sapiens feces adult age 50-60 years nanning city prefecture china )2018-01-27v4No1 / 54
292amnoncommon homo sapiens, adult, feces, crohn's disease, china2018-02-05v4No1 / 55
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, systemic lupus erythematosus2018-09-03v4No1 / 56
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
63amnonhigher in individuals with low physical activity ( high in little physical activity compared to physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 59
333amnoncommon in healthy controls feces (common homo sapiens, feces, guangzhou city prefecture, adult, control, china)2018-05-15v4No1 / 61
502amnoncommon homo sapiens, feces, adult, united states of america, schizophrenia2019-03-12v4No1 / 63
242amnoncommon in native-americans (common homo sapiens, feces, united states of america, state of oklahoma, native american, arapaho, cheyenne)2017-11-14v4No1 / 65
448amnoncommon equus caballus, horse, feces, farm, equine grass sickness, disease, united kingdom2019-01-08v4No1 / 65
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 68
441amnonhigher in mice treated with indomethacin NSAID compared to non-treated controls ( high in indomethacin non-steroidal anti-inflammatory drug compared to control in mus musculus mouse c57bl/6j feces research facility united states of america )2019-01-06v4No1 / 72
448amnon high in equine grass sickness disease compared to control in equus caballus horse feces farm united kingdom 2019-01-08v4No1 / 72
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus viminalis diet2019-08-01v4No1 / 72
438amnonhigher in kindergarten compared to primary and middle school kids ( high in age 3-6 compared to age 8-12 age 13-14 in homo sapiens feces china )2018-12-30v4No1 / 76
516amnoncommon homo sapiens, feces, united states of america, state of ohio, adult2019-05-29v4No1 / 77
541amnoncommon phascolarctos cinereus, koala, feces, australia, wild, cape otway, eucalyptus obliqua diet2019-08-01v4No1 / 77
434amnonhigher in antibiotics treated rats compared to controls ( high in antibiotic neomycin ampicillin compared to control in rat rattus norvegicus sprague dawley feces caecum research facility switzerland )2018-12-20v4No1 / 80
292amnoncommon homo sapiens, adult, feces, control, china2018-02-05v4No1 / 81
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
249amnoncommon homo sapiens, feces, united states of america2017-11-22v4No1 / 86
582amnoncommon rectum, perianal skin, urocyon littoralis, wild, united states of america, santa catalina island, santa catalina island fox, urocyon littoralis catalinae2020-01-22v4No1 / 88
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada ileum terminal ileum 2019-07-29v4No1 / 104
215amnoncommon homo sapiens, feces, united states of america2017-10-23v4No1 / 107
213amnonlower in patients with bacterial vaginosis compared to healthy controls ( high in control compared to bacterial vaginosis in homo sapiens vagina south africa )2017-10-31v4No1 / 107
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada colon right colon 2019-07-29v4No1 / 108
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
410amnonlower in feces compared to rectal biopsies in children with treatment naive uc ( high in rectum biopsy biopsy site compared to feces in homo sapiens child united states of america ulcerative colitis )2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, feces2019-07-30v4No1 / 120
438amnoncommon feces, homo sapiens, age >94, jiangsu province, adult, china2018-12-30v4No1 / 121
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, colon, right colon, taconic farms2019-07-30v4No1 / 130
538amnoncommon mus musculus, mouse, research facility, c57bl/6, age 8 weeks, canada, taconic farms, ileum, terminal ileum2019-07-30v4No1 / 132
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
400amnonhigher in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in hmong china compared to karen myanmar in homo sapiens feces thailand rural community )2018-11-18v4No1 / 135
538amnon high in taconic farms compared to jackson laboratories in mus musculus mouse research facility c57bl/6 age 8 weeks canada feces 2019-07-29v4No1 / 135
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
241amnonlower in babies from russia compared to finland ( high in finland compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 148
74amnonHigher in animal product diet compared to plant diet ( high in diet animal product diet compared to plant diet in homo sapiens feces united states of america )2017-02-27v4No1 / 149
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
276amnon high in united states of america city state of oklahoma compared to peru small village tunapuco rural community in feces homo sapiens adult 2018-01-22v4No1 / 168
241amnonlower in babies from russia compared to estonia ( high in estonia compared to russia in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 169
123amnon high in high fat diet diet compared to normal diet mouse chow in mus musculus mouse feces research facility united states of america c57bl/6j 2017-04-13v4No1 / 170
424amnonfarm dependent in feces of pigs with same genetic background ( high in farm 1 compared to farm 2 in sus scrofa pig jinhua city prefecture jinhua pig feces farm china )2018-12-06v4No1 / 171
179amnoncommon mus musculus, mouse, oral cavity, research facility, united states of america, balb/c, mouth2017-08-13v4No1 / 183
399amnoncommon feces, united states of america, research facility, rat, rattus norvegicus2018-11-16v4No1 / 184
73amnonhigh in children with Crohn's disease compared to healthy adult controls ( high in obsolete_juvenile stage child crohn's disease compared to control adult in homo sapiens feces glasgow )2017-02-26v4No1 / 189
197amnon high in india compared to finland in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 189
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 189
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
520amnonhigher in gastric cancer compared to paired normal tissue ( high in gastric carcinoma stomach neoplasm compared to control in homo sapiens zhejiang province stomach adult china )2019-06-26v3No1 / 214
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
25amnon high in antibiotic compared to control in oryctolagus cuniculus caecum rex rabbit sichuan province research facility 2016-12-01v4No1 / 231
53amnon high in shantytown lima compared to el salado small village in homo sapiens feces city 2017-01-21v4No1 / 237
286amnoncommon in feces of individuals with kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, nephrolithiasis, china)2018-01-27v4No1 / 239
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
286amnoncommon in feces of individuals without kidney stones (common homo sapiens, feces, adult, age 50-60 years, nanning city prefecture, control, china)2018-01-27v4No1 / 281
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
400amnonlower in people from thailand compared to 2nd generation immigrants to usa ( high in united states of america compared to thailand rural community in homo sapiens feces )2018-11-18v4No1 / 343
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
63amnon high in female compared to male in homo sapiens feces united states of america 2017-12-04v4No1 / 384
582amnon high in rectum perianal skin compared to external acoustic meatus ear canal in urocyon littoralis catalinae santa catalina island fox urocyon littoralis santa catalina island united states of america wild 2020-01-22v4No1 / 400
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
438amnonhigher in centenarians compared to adults ( high in age >94 compared to age 30-50 age 60-79 in homo sapiens feces china )2018-12-30v4No1 / 474
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
240amnonlower in infants age<1 year compared to 1-3 years in baby feces ( high in age age > 1 year compared to age <1 year in homo sapiens feces infant finland )2017-11-12v4No1 / 567
372amnon high in mouse chow compared to high fat diet in mouse mus musculus feces research facility united states of america 2018-09-07v4No1 / 579
232amnonlower in diabetec foot ulcers compared to non-ulcer skin in diabetic patients ( high in control compared to wound ulcer in homo sapiens skin australia foot diabetes mellitus )2017-11-05v4No1 / 836
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081

Problems / suggestions? Please email info AT dbbact DOT org