Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGACGTGAAACTCCGGGGCTCAACTCCGGAACTGCGTTGGAAACTGTAAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.420640
feces0.361755
adult0.320533
child0.203863
united states of america0.171402
obsolete_juvenile stage0.139860
control0.122182
LOWER IN crohn's disease0.108527
city0.096819
rural community0.090226
india0.078125
13-year-old human stage0.078125
female0.068830
small village0.064865
LOWER IN ulcerative colitis0.063492
state of california0.063291
infant0.063291
fourth decade human stage0.061538
china0.059925
jiangsu province0.053333
israel0.052632
heterosexual0.048780
msw0.048780
germany0.048780
africa0.048387
age 8-120.048387
6-12 year-old child stage0.048387
LOWER IN under-1-year-old human stage0.048000
1-year-old human stage0.047619
biopsy0.046693
amsterdam0.046154
kingdom of norway0.046154
state of new york0.045113
duodenum0.044610
kingdom of the netherlands0.044118
juvenile organism0.044118
age0.043165
central african republic0.033058
age<17 years0.032787
immature stage0.032787
age 4-10 years0.032787
iga positive fraction0.032787
LOWER IN iga negative fraction0.032787
peru0.032787
age 3-60.032787
new delhi0.032787
glasgow0.032787
oslo0.032787
age 13-140.032787
chuquisaca department0.032787
atlanta0.032258
adolescent stage0.032258
food allergy0.032258
nanchang city prefecture0.032258
toronto0.032258
14-year-old human stage0.032258
age < 3 years0.032258
age 5-13 years0.032258
biopsy site0.031746
fifth decade human stage0.031746
LOWER IN finland0.031746
kingdom of denmark0.031746
bolivia0.031746
state of michigan0.031496
state of colorado0.031496
LOWER IN infant0.031496
commonwealth of virginia0.031250
2-5 year-old child stage0.031250
rectum0.031250
obesity0.030769
LOWER IN child0.030769
small intestine0.030769
united kingdom0.030769
finland0.030303
belgium0.029851
commonwealth of pennsylvania0.029412
LOWER IN adult0.028369
pregnancy0.028169
kingdom of spain0.025316
jordan0.016667
LOWER IN insomnia0.016667
17-29-years-old human0.016667
sesame allergy0.016667
denver0.016667
LOWER IN egypt0.016667
LOWER IN iga igg negative fraction0.016667
age 9-17 years0.016667
teenager0.016667
milk allergy0.016667
azerbaijan0.016667
age 2-5 years0.016667
third trimester0.016667
LOWER IN inflammatory bowel disease0.016667
cornell university0.016667
lima0.016667
shantytown0.016667
mild0.016667
LOWER IN severe0.016667
gangcha region0.016667
LOWER IN gannan tibetan autonomous prefecture0.016667
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
central african republic0.666667
LOWER IN crohn&#39;s disease0.636364
heterosexual0.600000
msw0.600000
LOWER IN ulcerative colitis0.500000
age<17 years0.500000
immature stage0.500000
jordan0.500000
LOWER IN insomnia0.500000
17-29-years-old human0.500000
age 4-10 years0.500000
sesame allergy0.500000
denver0.500000
LOWER IN egypt0.500000
iga positive fraction0.500000
LOWER IN iga negative fraction0.500000
LOWER IN iga igg negative fraction0.500000
peru0.500000
age 9-17 years0.500000
teenager0.500000
milk allergy0.500000
azerbaijan0.500000
africa0.500000
age 2-5 years0.500000
third trimester0.500000
age 8-120.500000
6-12 year-old child stage0.500000
LOWER IN inflammatory bowel disease0.500000
cornell university0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
irritable bowel syndrome0.500000
new delhi0.500000
india0.500000
glasgow0.500000
oslo0.500000
gaz:000521000.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
13-year-old human stage0.500000
rem sleep behavior disorder0.500000
LOWER IN cuba0.500000
LOWER IN india0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
el salvador0.500000
LOWER IN age 3-60.500000
spondyloarthritis0.500000
spondylitis0.500000
republic of congo0.500000
nouabale-ndoki national park0.500000
atherosclerosis0.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN venezuela0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
sewage0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
vervet monkey0.500000
children0.500000
bangui0.500000
LOWER IN madagascar0.500000
LOWER IN antananarivo0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
chuquisaca department0.500000
age >940.500000
ninth decade human stage0.500000
tenth decade human stage0.500000
LOWER IN soldiers0.500000
LOWER IN young adult stage0.500000
LOWER IN under-1-year-old human stage0.428571
rural community0.400000
obsolete_juvenile stage0.400000
1-year-old human stage0.375000
atlanta0.333333
adolescent stage0.333333
food allergy0.333333
american diet0.333333
nanchang city prefecture0.333333
madagascar0.333333
state of oklahoma0.333333
first trimester0.333333
tibet autonomous region0.333333
fourth decade human stage0.333333
venezuela0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.974576
feces0.932203
adult0.491525
united states of america0.330508
control0.177966
child0.161017
china0.135593
obsolete_juvenile stage0.084746
LOWER IN crohn&#39;s disease0.059322
city0.059322
female0.059322
rural community0.050847
state of california0.042373
india0.042373
13-year-old human stage0.042373
infant0.042373
small village0.033898
LOWER IN ulcerative colitis0.033898
israel0.033898
germany0.033898
jiangsu province0.033898
fourth decade human stage0.033898
state of new york0.025424
heterosexual0.025424
msw0.025424
kingdom of the netherlands0.025424
amsterdam0.025424
biopsy0.025424
africa0.025424
age 8-120.025424
6-12 year-old child stage0.025424
duodenum0.025424
kingdom of norway0.025424
juvenile organism0.025424
age0.025424
1-year-old human stage0.025424
LOWER IN under-1-year-old human stage0.025424
atlanta0.016949
age<17 years0.016949
immature stage0.016949
adolescent stage0.016949
commonwealth of virginia0.016949
commonwealth of pennsylvania0.016949
state of michigan0.016949
food allergy0.016949
age 4-10 years0.016949
state of colorado0.016949
obesity0.016949
iga positive fraction0.016949
LOWER IN iga negative fraction0.016949
peru0.016949
nanchang city prefecture0.016949
biopsy site0.016949
central african republic0.016949
pregnancy0.016949
LOWER IN child0.016949
belgium0.016949
age 3-60.016949
2-5 year-old child stage0.016949
fifth decade human stage0.016949
kingdom of spain0.016949
small intestine0.016949
new delhi0.016949
LOWER IN adult0.016949
toronto0.016949
glasgow0.016949
oslo0.016949
age 13-140.016949
14-year-old human stage0.016949
finland0.016949
LOWER IN infant0.016949
united kingdom0.016949
LOWER IN finland0.016949
age < 3 years0.016949
rectum0.016949
kingdom of denmark0.016949
bolivia0.016949
chuquisaca department0.016949
age 5-13 years0.016949
LOWER IN city0.008475
LOWER IN systemic lupus erythematosus0.008475
ulcerative colitis0.008475
jordan0.008475
LOWER IN insomnia0.008475
low bmi0.008475
LOWER IN body mass index0.008475
LOWER IN high bmi0.008475
17-29-years-old human0.008475
sesame allergy0.008475
south korea0.008475
denver0.008475
italy0.008475
high bmi0.008475
LOWER IN egypt0.008475
LOWER IN iga igg negative fraction0.008475
age 9-17 years0.008475
teenager0.008475
american diet0.008475
milk allergy0.008475
azerbaijan0.008475
Exp. ID User ID Description Date Region Flag Sequences
290amnon high in small village rural community compared to city in feces homo sapiens adult china 2018-02-01v4No1 / 21
297amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v4No1 / 38
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 39
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
566amnon high in control compared to insomnia in feces homo sapiens adult china 2019-11-24v4No1 / 71
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 75
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult state of new york )2020-09-09v4No1 / 75
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 76
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 79
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
830amnon high in iga positive fraction compared to iga negative fraction iga igg negative fraction in feces homo sapiens peru age 9-17 years teenager 2021-09-10v4No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
804amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 100
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 109
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 115
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 121
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in feces homo sapiens toronto )2016-10-27v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v4No1 / 125
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
779amnon high in control compared to crohn's disease in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 127
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v4No1 / 138
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 140
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
330amnon high in adult fourth decade human stage compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 157
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage compared to age 3-6 2-5 year-old child stage in feces homo sapiens china )2018-12-30v4No1 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, india, 13-year-old human stage2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years 2-year-old human stage 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v4No1 / 180
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 197
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant india )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 306
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant under-1-year-old human stage in feces homo sapiens india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564
517amnon high in feces compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org