Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGACGTGAAACTCCGGGGCTCAACTCCGGAACTGCGTTGGAAACTGTAAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.578096
adult0.477273
feces0.456236
child0.241379
united states of america0.210610
obsolete_juvenile stage0.170940
control0.141225
city0.125448
LOWER IN crohn's disease0.118812
india0.100503
infant0.083102
small village0.082192
LOWER IN ulcerative colitis0.080808
china0.078967
jiangsu province0.074074
rural community0.061224
female0.061224
age 8-120.061224
age 130.061224
biopsy0.060302
kingdom of norway0.058537
duodenum0.057692
juvenile organism0.057692
age0.054054
state of california0.050420
heterosexual0.042105
msw0.042105
age<17 years0.041667
commonwealth of pennsylvania0.041667
nanchang city prefecture0.041667
age 3-60.041667
age 30-500.041667
new delhi0.041667
toronto0.041667
glasgow0.041667
oslo0.041667
age 30-400.041667
age 13-140.041667
LOWER IN age < 1 year0.041667
africa0.041667
state of colorado0.041237
LOWER IN child0.041237
LOWER IN infant0.041237
atlanta0.040816
state of michigan0.040816
age < 3 years0.040816
LOWER IN finland0.040816
kingdom of denmark0.040816
biopsy site0.040000
small intestine0.040000
rectum0.039604
commonwealth of virginia0.039216
united kingdom0.039216
belgium0.038462
finland0.038462
kingdom of spain0.037736
LOWER IN adult0.037037
jordan0.021277
denver0.021277
LOWER IN egypt0.021277
azerbaijan0.021277
LOWER IN inflammatory bowel disease0.021277
lima0.021277
shantytown0.021277
mild0.021277
LOWER IN severe0.021277
gangcha region0.021277
LOWER IN gannan tibetan autonomous prefecture0.021277
irritable bowel syndrome0.021277
myanmar0.021277
thailand0.021277
karen0.021277
cron diet0.021277
LOWER IN india0.021277
physical activity0.021277
LOWER IN little physical activity0.021277
el salvador0.021277
estonia0.021277
LOWER IN age 3-60.021277
age 1-3 years0.021277
spondylitis0.021277
spondyloarthritis0.021277
atherosclerosis0.021277
poland0.021277
age 1-20.021277
LOWER IN age 0-10.021277
bangladesh0.021277
tunapuco0.021277
LOWER IN age 30-500.021277
LOWER IN age 60-790.021277
LOWER IN pancreatitis0.021277
LOWER IN acute pancreatitis0.021277
metabolic syndrome0.021277
LOWER IN amerindian0.021277
LOWER IN hunter gatherer0.021277
LOWER IN venezuela0.021277
sewage0.021277
influent0.021277
LOWER IN effluent0.021277
chlorocebus aethiops0.021277
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
LOWER IN crohn's disease0.666667
heterosexual0.666667
msw0.666667
india0.666667
child0.583333
LOWER IN ulcerative colitis0.571429
rural community0.500000
adult0.500000
age<17 years0.500000
jordan0.500000
commonwealth of pennsylvania0.500000
denver0.500000
LOWER IN egypt0.500000
nanchang city prefecture0.500000
azerbaijan0.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
new delhi0.500000
toronto0.500000
glasgow0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
thailand0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
age 130.500000
LOWER IN india0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
el salvador0.500000
estonia0.500000
LOWER IN age 3-60.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
spondylitis0.500000
spondyloarthritis0.500000
atherosclerosis0.500000
poland0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
metabolic syndrome0.500000
africa0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
vervet monkey0.500000
terminal ileum0.500000
sigmoid colon0.500000
children0.500000
age one year0.500000
LOWER IN age one month0.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
age 60-790.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
homo sapiens0.412214
obsolete_juvenile stage0.400000
state of colorado0.400000
biopsy0.400000
LOWER IN child0.400000
LOWER IN infant0.400000
city0.357143
atlanta0.333333
LOWER IN systemic lupus erythematosus0.333333
state of michigan0.333333
american diet0.333333
state of oklahoma0.333333
tibet autonomous region0.333333
amerindian0.333333
venezuela0.333333
LOWER IN obsolete_juvenile stage0.333333
caloric restriction diet0.333333
age < 3 years0.333333
LOWER IN finland0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.967391
feces0.913043
adult0.456522
united states of america0.358696
control0.184783
child0.152174
china0.141304
obsolete_juvenile stage0.108696
city0.076087
LOWER IN crohn's disease0.065217
india0.054348
infant0.054348
small village0.043478
LOWER IN ulcerative colitis0.043478
female0.043478
jiangsu province0.043478
rural community0.032609
state of california0.032609
biopsy0.032609
age 8-120.032609
duodenum0.032609
kingdom of norway0.032609
age 130.032609
juvenile organism0.032609
age0.032609
age<17 years0.021739
atlanta0.021739
commonwealth of virginia0.021739
commonwealth of pennsylvania0.021739
state of michigan0.021739
state of colorado0.021739
heterosexual0.021739
msw0.021739
nanchang city prefecture0.021739
biopsy site0.021739
LOWER IN child0.021739
belgium0.021739
age 3-60.021739
age 30-500.021739
kingdom of spain0.021739
new delhi0.021739
small intestine0.021739
toronto0.021739
LOWER IN adult0.021739
glasgow0.021739
oslo0.021739
age 30-400.021739
age 13-140.021739
finland0.021739
LOWER IN infant0.021739
united kingdom0.021739
age < 3 years0.021739
LOWER IN finland0.021739
LOWER IN age < 1 year0.021739
rectum0.021739
kingdom of denmark0.021739
africa0.021739
LOWER IN city0.010870
LOWER IN systemic lupus erythematosus0.010870
ulcerative colitis0.010870
jordan0.010870
age 17-290.010870
denver0.010870
italy0.010870
obesity0.010870
high bmi0.010870
LOWER IN egypt0.010870
american diet0.010870
germany0.010870
azerbaijan0.010870
right colon0.010870
LOWER IN inflammatory bowel disease0.010870
lima0.010870
shantytown0.010870
state of oklahoma0.010870
mild0.010870
LOWER IN severe0.010870
tibetan plateau0.010870
tibet autonomous region0.010870
gangcha region0.010870
LOWER IN gannan tibetan autonomous prefecture0.010870
left colon0.010870
irritable bowel syndrome0.010870
hunter gatherer0.010870
amerindian0.010870
venezuela0.010870
LOWER IN obsolete_juvenile stage0.010870
myanmar0.010870
thailand0.010870
karen0.010870
cron diet0.010870
caloric restriction diet0.010870
LOWER IN india0.010870
physical activity0.010870
LOWER IN little physical activity0.010870
LOWER IN age 1 year0.010870
el salvador0.010870
estonia0.010870
LOWER IN age 3-60.010870
LOWER IN colon0.010870
Exp. ID User ID Description Date Sequences
290amnon high in rural community small village compared to city in homo sapiens feces china adult 2018-02-011 / 21
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-121 / 38
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-031 / 39
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-061 / 56
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-301 / 67
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-141 / 75
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-131 / 76
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-181 / 79
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-311 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-031 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-121 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-061 / 84
247amnoncommon homo sapiens, italy, feces, obesity, high bmi2017-11-211 / 85
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-061 / 86
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-131 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-071 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-121 / 93
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-091 / 93
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-181 / 95
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-301 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-221 / 97
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-271 / 105
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-301 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-131 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-151 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-221 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-011 / 109
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-301 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-211 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-221 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to ulcerative colitis severe in homo sapiens child united states of america feces )2018-11-221 / 110
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-031 / 114
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-301 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-081 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-221 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-091 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, india, new delhi, duodenum, small intestine)2018-07-301 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-061 / 121
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-271 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to crohn's disease obsolete_juvenile stage child in glasgow feces homo sapiens )2017-02-261 / 125
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-131 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-181 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-071 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-301 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-121 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-091 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-271 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-121 / 138
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-041 / 140
132amnoncommon homo sapiens, feces, united states of america2017-04-161 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-131 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-261 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-211 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-131 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-131 / 157
290amnoncommon homo sapiens, feces, china, adult, city2018-02-011 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-121 / 162
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-301 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-071 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-121 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-131 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-161 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-181 / 183
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-091 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-121 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-101 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-011 / 218
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-071 / 227
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-151 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-191 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-131 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-221 / 263
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-301 / 279
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-091 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-281 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-131 / 306
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-271 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-141 / 328
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-131 / 373
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-261 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-161 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-081 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-061 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-131 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-211 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-161 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-241 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-141 / 459
352amnon high in small intestine duodenum compared to feces in homo sapiens india new delhi 2018-07-301 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-141 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-081 / 564
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-301 / 617

Problems / suggestions? Please email info AT dbbact DOT org