Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGACGTGAAACTCCGGGGCTCAACTCCGGAACTGCGTTGGAAACTGTAAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.462465
feces0.386515
adult0.369886
child0.196319
united states of america0.183756
obsolete_juvenile stage0.147059
control0.128617
city0.101744
LOWER IN crohn's disease0.100000
rural community0.095238
india0.083507
female0.077951
infant0.069284
small village0.068768
LOWER IN ulcerative colitis0.067797
state of california0.067720
china0.065359
jiangsu province0.059259
germany0.057554
heterosexual0.051724
msw0.051724
age 8-120.051282
age 130.051282
amsterdam0.050000
biopsy0.050000
kingdom of the netherlands0.048780
kingdom of norway0.048780
duodenum0.047619
juvenile organism0.047619
age0.045455
age<17 years0.034783
age 3-60.034783
age 30-500.034783
new delhi0.034783
glasgow0.034783
oslo0.034783
age 30-400.034783
age 13-140.034783
chuquisaca department0.034783
LOWER IN infant0.034483
LOWER IN age &lt; 1 year0.034483
atlanta0.034188
nanchang city prefecture0.034188
toronto0.034188
age < 3 years0.034188
africa0.034188
age 5-13 years0.034188
state of michigan0.033898
state of colorado0.033898
LOWER IN child0.033898
kingdom of denmark0.033898
state of new york0.033613
biopsy site0.033613
small intestine0.033613
LOWER IN finland0.033613
bolivia0.033613
united kingdom0.033333
commonwealth of virginia0.033058
rectum0.033058
commonwealth of pennsylvania0.032000
belgium0.032000
finland0.032000
pregnancy0.031008
LOWER IN adult0.030534
israel0.028777
kingdom of spain0.028369
ulcerative colitis0.017699
jordan0.017699
LOWER IN insomnia0.017699
age 17-290.017699
denver0.017699
LOWER IN egypt0.017699
azerbaijan0.017699
third trimester0.017699
LOWER IN inflammatory bowel disease0.017699
lima0.017699
shantytown0.017699
mild0.017699
LOWER IN severe0.017699
gangcha region0.017699
LOWER IN gannan tibetan autonomous prefecture0.017699
irritable bowel syndrome0.017699
parkinson's disease0.017699
myanmar0.017699
karen0.017699
cron diet0.017699
rem sleep behavior disorder0.017699
LOWER IN cuba0.017699
LOWER IN india0.017699
physical activity0.017699
LOWER IN little physical activity0.017699
el salvador0.017699
estonia0.017699
LOWER IN age 3-60.017699
LOWER IN colon0.017699
nouabale-ndoki national park0.017699
republic of congo0.017699
spondyloarthritis0.017699
spondylitis0.017699
atherosclerosis0.017699
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
LOWER IN crohn&#39;s disease0.666667
heterosexual0.600000
msw0.600000
LOWER IN ulcerative colitis0.571429
india0.571429
age<17 years0.500000
ulcerative colitis0.500000
jordan0.500000
LOWER IN insomnia0.500000
age 17-290.500000
denver0.500000
LOWER IN egypt0.500000
azerbaijan0.500000
third trimester0.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
new delhi0.500000
glasgow0.500000
parkinson's disease0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
rem sleep behavior disorder0.500000
LOWER IN cuba0.500000
age 130.500000
LOWER IN india0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
el salvador0.500000
estonia0.500000
LOWER IN age 3-60.500000
LOWER IN colon0.500000
nouabale-ndoki national park0.500000
republic of congo0.500000
spondyloarthritis0.500000
spondylitis0.500000
atherosclerosis0.500000
poland0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN caecum0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sewage0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
vervet monkey0.500000
sigmoid colon0.500000
colon0.500000
children0.500000
age one year0.500000
LOWER IN age one month0.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
age 60-790.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
rural community0.400000
obsolete_juvenile stage0.400000
LOWER IN infant0.400000
LOWER IN age &lt; 1 year0.400000
atlanta0.333333
LOWER IN systemic lupus erythematosus0.333333
amsterdam0.333333
american diet0.333333
nanchang city prefecture0.333333
biopsy0.333333
state of oklahoma0.333333
first trimester0.333333
tibet autonomous region0.333333
amerindian0.333333
venezuela0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.972973
feces0.927928
adult0.495495
united states of america0.342342
control0.180180
child0.144144
china0.135135
obsolete_juvenile stage0.090090
city0.063063
female0.063063
rural community0.054054
LOWER IN crohn&#39;s disease0.054054
state of california0.045045
india0.045045
infant0.045045
small village0.036036
LOWER IN ulcerative colitis0.036036
germany0.036036
jiangsu province0.036036
heterosexual0.027027
msw0.027027
amsterdam0.027027
kingdom of the netherlands0.027027
biopsy0.027027
age 8-120.027027
duodenum0.027027
kingdom of norway0.027027
age 130.027027
juvenile organism0.027027
age0.027027
age<17 years0.018018
atlanta0.018018
commonwealth of virginia0.018018
state of new york0.018018
commonwealth of pennsylvania0.018018
state of michigan0.018018
state of colorado0.018018
nanchang city prefecture0.018018
biopsy site0.018018
israel0.018018
pregnancy0.018018
LOWER IN child0.018018
belgium0.018018
age 3-60.018018
age 30-500.018018
kingdom of spain0.018018
new delhi0.018018
small intestine0.018018
toronto0.018018
LOWER IN adult0.018018
glasgow0.018018
oslo0.018018
age 30-400.018018
age 13-140.018018
finland0.018018
LOWER IN infant0.018018
united kingdom0.018018
age < 3 years0.018018
LOWER IN finland0.018018
LOWER IN age &lt; 1 year0.018018
rectum0.018018
kingdom of denmark0.018018
africa0.018018
age 5-13 years0.018018
bolivia0.018018
chuquisaca department0.018018
LOWER IN city0.009009
LOWER IN systemic lupus erythematosus0.009009
ulcerative colitis0.009009
jordan0.009009
LOWER IN insomnia0.009009
LOWER IN body mass index0.009009
LOWER IN high bmi0.009009
low bmi0.009009
age 17-290.009009
south korea0.009009
denver0.009009
italy0.009009
high bmi0.009009
obesity0.009009
LOWER IN egypt0.009009
american diet0.009009
azerbaijan0.009009
right colon0.009009
third trimester0.009009
LOWER IN inflammatory bowel disease0.009009
lima0.009009
shantytown0.009009
state of oklahoma0.009009
mild0.009009
LOWER IN severe0.009009
first trimester0.009009
tibetan plateau0.009009
tibet autonomous region0.009009
gangcha region0.009009
LOWER IN gannan tibetan autonomous prefecture0.009009
left colon0.009009
irritable bowel syndrome0.009009
hunter gatherer0.009009
amerindian0.009009
Exp. ID User ID Description Date Region Flag Sequences
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 20
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 37
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 38
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 55
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 66
566amnon high in control compared to insomnia in homo sapiens feces china adult 2019-11-24v4No1 / 70
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in state of new york united states of america homo sapiens adult feces )2020-09-09v4No1 / 74
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 74
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 75
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 78
643amnoncommon adult, south korea, feces, homo sapiens2020-08-30v4No1 / 80
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 81
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 81
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 82
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 83
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 84
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 85
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 87
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 88
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 92
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 92
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 94
629amnoncommon msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 96
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 96
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 102
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 104
683amnoncommon state of california, united states of america, adult, feces, homo sapiens2028-03-04v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 105
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 106
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 106
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 107
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 108
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 108
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 109
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 109
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 111
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 113
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 114
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 116
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 117
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 119
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 120
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 120
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 124
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 124
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 127
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 129
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 131
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 133
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 133
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 133
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 135
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 136
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 137
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 137
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 139
629amnoncommon amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 140
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 144
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 144
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 149
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 154
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 156
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 156
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 161
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 161
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 167
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 168
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 169
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 172
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 179
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 182
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 196
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 196
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 207
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 215
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 217
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 220
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 226
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 247
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 252
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 262
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 262
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 278
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 287
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 294
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to metronidazole neomycin vancomycin antibiotic in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 301
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 305
650amnon high in asian compared to caucasian european in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 316
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 318
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 327
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 372
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 386
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 389
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 415
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 421
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 439
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 445
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 456
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 458
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 544
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 556
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 563
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 605
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 616
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 751

Problems / suggestions? Please email info AT dbbact DOT org