Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGACGTGAAACTCCGGGGCTCAACTCCGGAACTGCGTTGGAAACTGTAAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.494306
feces0.398922
adult0.384220
child0.211921
united states of america0.173684
obsolete_juvenile stage0.153846
control0.128224
city0.107527
LOWER IN crohn's disease0.105263
rural community0.101266
india0.087912
female0.087719
infant0.073171
small village0.072508
LOWER IN ulcerative colitis0.071429
china0.070922
jiangsu province0.062016
germany0.061069
heterosexual0.054545
msw0.054545
age 8-120.054054
age 130.054054
amsterdam0.052632
biopsy0.052632
kingdom of the netherlands0.051282
kingdom of norway0.051282
juvenile organism0.051282
duodenum0.050633
age0.048387
state of california0.044944
age<17 years0.036697
nanchang city prefecture0.036697
age 3-60.036697
age 30-500.036697
new delhi0.036697
toronto0.036697
glasgow0.036697
oslo0.036697
age 30-400.036697
age 13-140.036697
chuquisaca department0.036697
LOWER IN infant0.036364
LOWER IN age &lt; 1 year0.036364
atlanta0.036036
age < 3 years0.036036
africa0.036036
age 5-13 years0.036036
state of michigan0.035714
state of colorado0.035714
LOWER IN child0.035714
kingdom of denmark0.035714
biopsy site0.035398
small intestine0.035398
LOWER IN finland0.035398
bolivia0.035398
united kingdom0.035088
commonwealth of virginia0.034783
commonwealth of pennsylvania0.034783
rectum0.034783
belgium0.033613
finland0.033613
pregnancy0.033058
LOWER IN adult0.032520
israel0.030534
kingdom of spain0.030534
jordan0.018692
LOWER IN insomnia0.018692
age 17-290.018692
denver0.018692
LOWER IN egypt0.018692
azerbaijan0.018692
third trimester0.018692
LOWER IN inflammatory bowel disease0.018692
lima0.018692
shantytown0.018692
mild0.018692
LOWER IN severe0.018692
gangcha region0.018692
LOWER IN gannan tibetan autonomous prefecture0.018692
irritable bowel syndrome0.018692
parkinson's disease0.018692
myanmar0.018692
karen0.018692
cron diet0.018692
rem sleep behavior disorder0.018692
LOWER IN india0.018692
physical activity0.018692
LOWER IN little physical activity0.018692
el salvador0.018692
estonia0.018692
LOWER IN age 3-60.018692
village0.018692
nouabale-ndoki national park0.018692
republic of congo0.018692
spondyloarthritis0.018692
spondylitis0.018692
atherosclerosis0.018692
poland0.018692
age 1-20.018692
LOWER IN age 0-10.018692
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
LOWER IN crohn&#39;s disease0.666667
heterosexual0.600000
msw0.600000
LOWER IN ulcerative colitis0.571429
india0.571429
age<17 years0.500000
jordan0.500000
LOWER IN insomnia0.500000
age 17-290.500000
denver0.500000
LOWER IN egypt0.500000
nanchang city prefecture0.500000
azerbaijan0.500000
third trimester0.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
new delhi0.500000
toronto0.500000
glasgow0.500000
parkinson's disease0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
rem sleep behavior disorder0.500000
age 130.500000
LOWER IN india0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
el salvador0.500000
estonia0.500000
LOWER IN age 3-60.500000
village0.500000
nouabale-ndoki national park0.500000
republic of congo0.500000
spondyloarthritis0.500000
spondylitis0.500000
atherosclerosis0.500000
poland0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
vervet monkey0.500000
sigmoid colon0.500000
children0.500000
age one year0.500000
LOWER IN age one month0.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
age 60-790.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
rural community0.444444
obsolete_juvenile stage0.400000
LOWER IN infant0.400000
LOWER IN age &lt; 1 year0.400000
child0.347826
atlanta0.333333
LOWER IN systemic lupus erythematosus0.333333
amsterdam0.333333
american diet0.333333
biopsy0.333333
state of oklahoma0.333333
first trimester0.333333
tibet autonomous region0.333333
amerindian0.333333
venezuela0.333333
LOWER IN obsolete_juvenile stage0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.971429
feces0.923810
adult0.466667
united states of america0.314286
control0.180952
child0.152381
china0.142857
obsolete_juvenile stage0.095238
city0.066667
female0.066667
rural community0.057143
LOWER IN crohn&#39;s disease0.057143
india0.047619
infant0.047619
small village0.038095
LOWER IN ulcerative colitis0.038095
germany0.038095
jiangsu province0.038095
state of california0.028571
heterosexual0.028571
msw0.028571
amsterdam0.028571
kingdom of the netherlands0.028571
biopsy0.028571
age 8-120.028571
duodenum0.028571
kingdom of norway0.028571
age 130.028571
juvenile organism0.028571
age0.028571
age<17 years0.019048
atlanta0.019048
commonwealth of virginia0.019048
commonwealth of pennsylvania0.019048
state of michigan0.019048
state of colorado0.019048
nanchang city prefecture0.019048
biopsy site0.019048
israel0.019048
pregnancy0.019048
LOWER IN child0.019048
belgium0.019048
age 3-60.019048
age 30-500.019048
kingdom of spain0.019048
new delhi0.019048
small intestine0.019048
toronto0.019048
LOWER IN adult0.019048
glasgow0.019048
oslo0.019048
age 30-400.019048
age 13-140.019048
finland0.019048
LOWER IN infant0.019048
united kingdom0.019048
age < 3 years0.019048
LOWER IN finland0.019048
LOWER IN age &lt; 1 year0.019048
rectum0.019048
kingdom of denmark0.019048
africa0.019048
age 5-13 years0.019048
bolivia0.019048
chuquisaca department0.019048
LOWER IN city0.009524
LOWER IN systemic lupus erythematosus0.009524
ulcerative colitis0.009524
jordan0.009524
LOWER IN insomnia0.009524
age 17-290.009524
denver0.009524
italy0.009524
high bmi0.009524
obesity0.009524
LOWER IN egypt0.009524
american diet0.009524
azerbaijan0.009524
right colon0.009524
third trimester0.009524
LOWER IN inflammatory bowel disease0.009524
lima0.009524
shantytown0.009524
state of oklahoma0.009524
mild0.009524
LOWER IN severe0.009524
first trimester0.009524
tibetan plateau0.009524
tibet autonomous region0.009524
gangcha region0.009524
LOWER IN gannan tibetan autonomous prefecture0.009524
left colon0.009524
irritable bowel syndrome0.009524
hunter gatherer0.009524
amerindian0.009524
venezuela0.009524
LOWER IN obsolete_juvenile stage0.009524
parkinson's disease0.009524
myanmar0.009524
thailand0.009524
Exp. ID User ID Description Date Region Flag Sequences
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 38
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
566amnon high in control compared to insomnia in homo sapiens feces china adult 2019-11-24v4No1 / 71
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 89
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
629amnoncommon msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 97
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 112
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 125
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
629amnoncommon amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 141
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 197
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org