Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGACGTGAAACTCCGGGGCTCAACTCCGGAACTGCGTTGGAAACTGTAAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.553283
adult0.439711
feces0.431017
child0.253968
united states of america0.197236
obsolete_juvenile stage0.168067
control0.133814
city0.120275
LOWER IN crohn's disease0.116505
india0.098522
rural community0.094637
infant0.081744
small village0.080537
LOWER IN ulcerative colitis0.079208
china0.073446
jiangsu province0.072727
age 8-120.060000
age 130.060000
female0.059701
biopsy0.059113
duodenum0.056604
kingdom of norway0.056604
juvenile organism0.056604
age0.053097
state of california0.048980
heterosexual0.041237
msw0.041237
age<17 years0.040816
commonwealth of pennsylvania0.040816
nanchang city prefecture0.040816
age 3-60.040816
age 30-500.040816
new delhi0.040816
toronto0.040816
glasgow0.040816
oslo0.040816
age 30-400.040816
age 13-140.040816
LOWER IN age < 1 year0.040816
africa0.040816
chuquisaca department0.040816
age 5-13 years0.040816
LOWER IN child0.040404
LOWER IN infant0.040404
atlanta0.040000
state of colorado0.040000
age < 3 years0.040000
kingdom of denmark0.040000
state of michigan0.039604
biopsy site0.039216
small intestine0.039216
LOWER IN finland0.039216
bolivia0.039216
united kingdom0.038835
rectum0.038835
commonwealth of virginia0.038462
belgium0.037736
finland0.037037
LOWER IN adult0.036364
kingdom of spain0.035714
jordan0.020833
age 17-290.020833
denver0.020833
LOWER IN egypt0.020833
azerbaijan0.020833
LOWER IN inflammatory bowel disease0.020833
lima0.020833
shantytown0.020833
mild0.020833
LOWER IN severe0.020833
gangcha region0.020833
LOWER IN gannan tibetan autonomous prefecture0.020833
irritable bowel syndrome0.020833
myanmar0.020833
thailand0.020833
karen0.020833
cron diet0.020833
LOWER IN india0.020833
physical activity0.020833
LOWER IN little physical activity0.020833
el salvador0.020833
estonia0.020833
LOWER IN age 3-60.020833
age 1-3 years0.020833
spondylitis0.020833
spondyloarthritis0.020833
atherosclerosis0.020833
age 1-20.020833
LOWER IN age 0-10.020833
bangladesh0.020833
tunapuco0.020833
LOWER IN age 30-500.020833
LOWER IN age 60-790.020833
LOWER IN pancreatitis0.020833
LOWER IN acute pancreatitis0.020833
LOWER IN nepal0.020833
LOWER IN himalayas0.020833
LOWER IN amerindian0.020833
LOWER IN hunter gatherer0.020833
LOWER IN venezuela0.020833
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
LOWER IN crohn's disease0.666667
heterosexual0.666667
msw0.666667
india0.666667
LOWER IN ulcerative colitis0.571429
age<17 years0.500000
child0.500000
jordan0.500000
commonwealth of pennsylvania0.500000
age 17-290.500000
denver0.500000
LOWER IN egypt0.500000
nanchang city prefecture0.500000
azerbaijan0.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
new delhi0.500000
toronto0.500000
glasgow0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
thailand0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
age 130.500000
LOWER IN india0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
el salvador0.500000
estonia0.500000
LOWER IN age 3-60.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
spondylitis0.500000
spondyloarthritis0.500000
atherosclerosis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
africa0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
vervet monkey0.500000
terminal ileum0.500000
sigmoid colon0.500000
children0.500000
age one year0.500000
LOWER IN age one month0.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
LOWER IN forearm0.500000
LOWER IN arm0.500000
chuquisaca department0.500000
age 5-13 years0.500000
age 60-790.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
LOWER IN mouth mucosa0.500000
adult0.432836
rural community0.428571
obsolete_juvenile stage0.400000
biopsy0.400000
LOWER IN child0.400000
LOWER IN infant0.400000
homo sapiens0.387324
atlanta0.333333
LOWER IN systemic lupus erythematosus0.333333
state of colorado0.333333
american diet0.333333
state of oklahoma0.333333
tibet autonomous region0.333333
amerindian0.333333
venezuela0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.968085
feces0.914894
adult0.446809
united states of america0.351064
control0.180851
child0.170213
china0.138298
obsolete_juvenile stage0.106383
city0.074468
LOWER IN crohn's disease0.063830
rural community0.053191
india0.053191
infant0.053191
small village0.042553
LOWER IN ulcerative colitis0.042553
female0.042553
jiangsu province0.042553
state of california0.031915
biopsy0.031915
age 8-120.031915
duodenum0.031915
kingdom of norway0.031915
age 130.031915
juvenile organism0.031915
age0.031915
age<17 years0.021277
atlanta0.021277
commonwealth of virginia0.021277
commonwealth of pennsylvania0.021277
state of michigan0.021277
state of colorado0.021277
heterosexual0.021277
msw0.021277
nanchang city prefecture0.021277
biopsy site0.021277
LOWER IN child0.021277
belgium0.021277
age 3-60.021277
age 30-500.021277
kingdom of spain0.021277
new delhi0.021277
small intestine0.021277
toronto0.021277
LOWER IN adult0.021277
glasgow0.021277
oslo0.021277
age 30-400.021277
age 13-140.021277
finland0.021277
LOWER IN infant0.021277
united kingdom0.021277
age < 3 years0.021277
LOWER IN finland0.021277
LOWER IN age < 1 year0.021277
rectum0.021277
kingdom of denmark0.021277
africa0.021277
chuquisaca department0.021277
bolivia0.021277
age 5-13 years0.021277
LOWER IN city0.010638
LOWER IN systemic lupus erythematosus0.010638
ulcerative colitis0.010638
jordan0.010638
age 17-290.010638
denver0.010638
italy0.010638
obesity0.010638
high bmi0.010638
LOWER IN egypt0.010638
american diet0.010638
germany0.010638
azerbaijan0.010638
right colon0.010638
LOWER IN inflammatory bowel disease0.010638
lima0.010638
shantytown0.010638
state of oklahoma0.010638
mild0.010638
LOWER IN severe0.010638
tibetan plateau0.010638
tibet autonomous region0.010638
gangcha region0.010638
LOWER IN gannan tibetan autonomous prefecture0.010638
left colon0.010638
irritable bowel syndrome0.010638
hunter gatherer0.010638
amerindian0.010638
venezuela0.010638
LOWER IN obsolete_juvenile stage0.010638
myanmar0.010638
thailand0.010638
karen0.010638
cron diet0.010638
caloric restriction diet0.010638
LOWER IN india0.010638
physical activity0.010638
LOWER IN little physical activity0.010638
LOWER IN age 1 year0.010638
el salvador0.010638
Exp. ID User ID Description Date Sequences
290amnon high in rural community small village compared to city in homo sapiens feces china adult 2018-02-011 / 21
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-121 / 38
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-031 / 39
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-061 / 56
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-301 / 67
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-141 / 75
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-131 / 76
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-181 / 79
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-311 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-031 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-121 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-061 / 84
247amnoncommon homo sapiens, italy, feces, obesity, high bmi2017-11-211 / 85
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-061 / 86
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-131 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-071 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-121 / 93
428amnoncommon homo sapiens, adult, feces, china, nanchang city prefecture, control2018-12-091 / 93
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-181 / 95
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-301 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-221 / 97
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-271 / 105
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 8-122018-12-301 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-131 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-151 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-221 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-011 / 109
438amnoncommon homo sapiens, feces, china, jiangsu province, child, age 3-62018-12-301 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-211 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-221 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to ulcerative colitis severe in homo sapiens child united states of america feces )2018-11-221 / 110
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-031 / 114
438amnoncommon feces, homo sapiens, china, jiangsu province, age 30-50, adult2018-12-301 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-081 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-221 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-091 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, india, new delhi, duodenum, small intestine)2018-07-301 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-061 / 121
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-271 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to crohn's disease obsolete_juvenile stage child in glasgow feces homo sapiens )2017-02-261 / 125
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-131 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-181 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-071 / 134
438amnoncommon homo sapiens, feces, china, jiangsu province, age 13-142018-12-301 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-121 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-091 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-271 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-121 / 138
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-041 / 140
132amnoncommon homo sapiens, feces, united states of america2017-04-161 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-131 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-261 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-211 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-131 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-131 / 157
290amnoncommon homo sapiens, feces, china, adult, city2018-02-011 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-121 / 162
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-301 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-071 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-121 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-131 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-161 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-181 / 183
312amnoncommon feces, homo sapiens, french republic, adult, spondylitis, spondyloarthritis2018-04-091 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-121 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-101 / 216
290amnoncommon homo sapiens, feces, china, adult, small village, rural community2018-02-011 / 218
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-071 / 227
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-151 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces india infant )2016-12-191 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-131 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-221 / 263
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-301 / 279
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces china nanchang city prefecture 2018-12-091 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-281 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-131 / 306
299amnon high in cancer mouth neoplasm compared to control in saliva adult homo sapiens china 2018-02-271 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-141 / 328
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-131 / 373
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-261 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-161 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-081 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-061 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-131 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-211 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-161 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-241 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-141 / 459
352amnon high in small intestine duodenum compared to feces in homo sapiens india new delhi 2018-07-301 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-141 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-081 / 564
517amnon high in feces compared to forearm arm skin in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-291 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-301 / 617
517amnon high in feces compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-291 / 752

Problems / suggestions? Please email info AT dbbact DOT org