Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGACGTGAAACTCCGGGGCTCAACTCCGGAACTGCGTTGGAAACTGTAAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.435955
feces0.373363
adult0.340509
child0.202247
united states of america0.175896
obsolete_juvenile stage0.143885
control0.121704
city0.099573
LOWER IN crohn's disease0.096774
rural community0.093023
india0.081466
female0.072239
infant0.067114
small village0.067039
LOWER IN ulcerative colitis0.066116
state of california0.065646
china0.060976
jiangsu province0.057971
israel0.055556
germany0.054795
heterosexual0.050420
msw0.050420
age 8-120.050000
age 130.050000
biopsy0.048193
amsterdam0.047619
kingdom of norway0.047619
duodenum0.046512
juvenile organism0.046512
kingdom of the netherlands0.045455
age0.044444
age<17 years0.033898
food allergy0.033898
age 4-10 years0.033898
age 3-60.033898
new delhi0.033898
glasgow0.033898
oslo0.033898
age 30-400.033898
age 13-140.033898
chuquisaca department0.033898
obesity0.033613
LOWER IN age &lt; 1 year0.033613
atlanta0.033333
nanchang city prefecture0.033333
age 30-500.033333
toronto0.033333
LOWER IN infant0.033333
age < 3 years0.033333
africa0.033333
age 5-13 years0.033333
kingdom of denmark0.033058
state of michigan0.032787
state of colorado0.032787
biopsy site0.032787
LOWER IN finland0.032787
bolivia0.032787
commonwealth of virginia0.032258
state of new york0.032258
LOWER IN child0.032258
small intestine0.032258
rectum0.032258
united kingdom0.032000
commonwealth of pennsylvania0.031250
finland0.031250
belgium0.030769
pregnancy0.029412
LOWER IN adult0.029197
kingdom of spain0.026316
ulcerative colitis0.017241
jordan0.017241
LOWER IN insomnia0.017241
age 17-290.017241
sesame allergy0.017241
denver0.017241
LOWER IN egypt0.017241
milk allergy0.017241
azerbaijan0.017241
third trimester0.017241
LOWER IN inflammatory bowel disease0.017241
lima0.017241
shantytown0.017241
mild0.017241
LOWER IN severe0.017241
gangcha region0.017241
LOWER IN gannan tibetan autonomous prefecture0.017241
irritable bowel syndrome0.017241
parkinson's disease0.017241
myanmar0.017241
karen0.017241
cron diet0.017241
rem sleep behavior disorder0.017241
LOWER IN cuba0.017241
LOWER IN india0.017241
overweight body mass index status0.017241
gaz:000521000.017241
physical activity0.017241
LOWER IN little physical activity0.017241
el salvador0.017241
estonia0.017241
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
LOWER IN crohn&#39;s disease0.600000
heterosexual0.600000
msw0.600000
LOWER IN ulcerative colitis0.571429
india0.571429
age<17 years0.500000
ulcerative colitis0.500000
jordan0.500000
LOWER IN insomnia0.500000
age 17-290.500000
sesame allergy0.500000
food allergy0.500000
age 4-10 years0.500000
denver0.500000
LOWER IN egypt0.500000
milk allergy0.500000
azerbaijan0.500000
third trimester0.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
irritable bowel syndrome0.500000
new delhi0.500000
glasgow0.500000
parkinson's disease0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
rem sleep behavior disorder0.500000
LOWER IN cuba0.500000
age 130.500000
LOWER IN india0.500000
overweight body mass index status0.500000
gaz:000521000.500000
physical activity0.500000
LOWER IN little physical activity0.500000
el salvador0.500000
estonia0.500000
LOWER IN age 3-60.500000
nouabale-ndoki national park0.500000
republic of congo0.500000
spondyloarthritis0.500000
spondylitis0.500000
atherosclerosis0.500000
poland0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sewage0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
vervet monkey0.500000
children0.500000
age one year0.500000
LOWER IN age one month0.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
age 60-790.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
rural community0.400000
obsolete_juvenile stage0.400000
obesity0.400000
LOWER IN age &lt; 1 year0.400000
atlanta0.333333
american diet0.333333
nanchang city prefecture0.333333
state of oklahoma0.333333
first trimester0.333333
tibet autonomous region0.333333
age 30-500.333333
amerindian0.333333
venezuela0.333333
toronto0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.973684
feces0.929825
adult0.491228
united states of america0.333333
control0.175439
child0.157895
china0.131579
obsolete_juvenile stage0.087719
city0.061404
female0.061404
rural community0.052632
LOWER IN crohn&#39;s disease0.052632
state of california0.043860
india0.043860
infant0.043860
small village0.035088
LOWER IN ulcerative colitis0.035088
israel0.035088
germany0.035088
jiangsu province0.035088
heterosexual0.026316
msw0.026316
amsterdam0.026316
kingdom of the netherlands0.026316
biopsy0.026316
age 8-120.026316
duodenum0.026316
kingdom of norway0.026316
age 130.026316
juvenile organism0.026316
age0.026316
age<17 years0.017544
atlanta0.017544
commonwealth of virginia0.017544
state of new york0.017544
commonwealth of pennsylvania0.017544
state of michigan0.017544
food allergy0.017544
age 4-10 years0.017544
state of colorado0.017544
obesity0.017544
nanchang city prefecture0.017544
biopsy site0.017544
pregnancy0.017544
LOWER IN child0.017544
belgium0.017544
age 3-60.017544
age 30-500.017544
kingdom of spain0.017544
new delhi0.017544
small intestine0.017544
toronto0.017544
LOWER IN adult0.017544
glasgow0.017544
oslo0.017544
age 30-400.017544
age 13-140.017544
finland0.017544
LOWER IN infant0.017544
united kingdom0.017544
age < 3 years0.017544
LOWER IN finland0.017544
LOWER IN age &lt; 1 year0.017544
rectum0.017544
kingdom of denmark0.017544
africa0.017544
age 5-13 years0.017544
bolivia0.017544
chuquisaca department0.017544
LOWER IN city0.008772
LOWER IN systemic lupus erythematosus0.008772
ulcerative colitis0.008772
jordan0.008772
LOWER IN insomnia0.008772
LOWER IN body mass index0.008772
LOWER IN high bmi0.008772
low bmi0.008772
age 17-290.008772
sesame allergy0.008772
south korea0.008772
denver0.008772
italy0.008772
high bmi0.008772
LOWER IN egypt0.008772
american diet0.008772
milk allergy0.008772
azerbaijan0.008772
right colon0.008772
third trimester0.008772
LOWER IN inflammatory bowel disease0.008772
lima0.008772
shantytown0.008772
state of oklahoma0.008772
mild0.008772
LOWER IN severe0.008772
first trimester0.008772
tibetan plateau0.008772
tibet autonomous region0.008772
gangcha region0.008772
LOWER IN gannan tibetan autonomous prefecture0.008772
Exp. ID User ID Description Date Region Flag Sequences
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 13
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 30
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 31
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 48
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 59
566amnon high in control compared to insomnia in homo sapiens feces china adult 2019-11-24v4No1 / 63
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in state of new york united states of america homo sapiens adult feces )2020-09-09v4No1 / 67
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 67
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 68
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 71
695amnoncommon sesame allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 73
643amnoncommon adult, south korea, feces, homo sapiens2020-08-30v4No1 / 73
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 74
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 74
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 75
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 76
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 77
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 78
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 80
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 81
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 81
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 85
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 85
695amnoncommon milk allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 87
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 87
629amnoncommon msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 89
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 89
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 89
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 95
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 97
683amnoncommon state of california, united states of america, adult, feces, homo sapiens2028-03-04v4No1 / 98
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 98
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 99
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 99
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 100
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 101
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 101
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 102
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 102
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 102
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 104
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 106
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 107
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 109
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 110
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 112
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 113
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 113
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 117
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 117
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 117
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 120
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 122
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 124
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 126
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 126
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 126
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 128
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 128
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 129
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 130
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 130
721amnoncommon obesity, overweight body mass index status, adult, scotland, gaz:00052100, feces, homo sapiens2028-05-23v4No1 / 131
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 132
629amnoncommon amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 133
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 137
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 137
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 142
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 147
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 149
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 149
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 154
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 154
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 160
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 161
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 162
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 165
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 172
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 175
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 189
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 189
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 200
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 208
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 210
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 213
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 219
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 240
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 245
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 255
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 255
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 271
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 280
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 287
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to metronidazole neomycin vancomycin antibiotic in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 294
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 298
650amnon high in asian compared to caucasian european in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 309
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 311
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 320
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 365
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 379
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 382
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 408
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 409
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 414
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 432
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 438
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 449
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 451
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 537
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 549
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 556
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 598
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 609
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 744

Problems / suggestions? Please email info AT dbbact DOT org