Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGACGTGAAACTCCGGGGCTCAACTCCGGAACTGCGTTGGAAACTGTAAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.481315
feces0.395037
adult0.384655
child0.201258
united states of america0.180730
obsolete_juvenile stage0.149254
control0.124824
city0.104322
LOWER IN crohn's disease0.101695
rural community0.096774
india0.084926
female0.082063
infant0.071090
small village0.069971
LOWER IN ulcerative colitis0.068966
china0.067873
jiangsu province0.060150
germany0.058394
heterosexual0.052632
msw0.052632
age 8-120.052174
age 130.052174
amsterdam0.050847
biopsy0.050847
kingdom of the netherlands0.049587
kingdom of norway0.049587
duodenum0.048387
juvenile organism0.048387
age0.046154
state of california0.043636
age<17 years0.035398
nanchang city prefecture0.035398
age 3-60.035398
age 30-500.035398
new delhi0.035398
glasgow0.035398
oslo0.035398
age 30-400.035398
age 13-140.035398
chuquisaca department0.035398
LOWER IN infant0.035088
LOWER IN age &lt; 1 year0.035088
atlanta0.034783
toronto0.034783
age < 3 years0.034783
africa0.034783
age 5-13 years0.034783
state of michigan0.034483
state of colorado0.034483
LOWER IN child0.034483
kingdom of denmark0.034483
state of new york0.034188
biopsy site0.034188
small intestine0.034188
LOWER IN finland0.034188
bolivia0.034188
united kingdom0.033898
commonwealth of virginia0.033613
rectum0.033613
commonwealth of pennsylvania0.033058
belgium0.032520
finland0.032520
pregnancy0.031496
LOWER IN adult0.031496
kingdom of spain0.029630
israel0.029197
ulcerative colitis0.018018
jordan0.018018
LOWER IN insomnia0.018018
age 17-290.018018
denver0.018018
obesity0.018018
LOWER IN egypt0.018018
azerbaijan0.018018
third trimester0.018018
LOWER IN inflammatory bowel disease0.018018
lima0.018018
shantytown0.018018
mild0.018018
LOWER IN severe0.018018
gangcha region0.018018
LOWER IN gannan tibetan autonomous prefecture0.018018
irritable bowel syndrome0.018018
parkinson's disease0.018018
myanmar0.018018
karen0.018018
cron diet0.018018
rem sleep behavior disorder0.018018
LOWER IN cuba0.018018
LOWER IN india0.018018
physical activity0.018018
LOWER IN little physical activity0.018018
el salvador0.018018
estonia0.018018
LOWER IN age 3-60.018018
LOWER IN colon0.018018
nouabale-ndoki national park0.018018
republic of congo0.018018
spondyloarthritis0.018018
spondylitis0.018018
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
LOWER IN crohn&#39;s disease0.666667
heterosexual0.600000
msw0.600000
LOWER IN ulcerative colitis0.571429
india0.571429
age<17 years0.500000
ulcerative colitis0.500000
jordan0.500000
LOWER IN insomnia0.500000
age 17-290.500000
denver0.500000
obesity0.500000
LOWER IN egypt0.500000
nanchang city prefecture0.500000
azerbaijan0.500000
third trimester0.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
new delhi0.500000
glasgow0.500000
parkinson's disease0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
rem sleep behavior disorder0.500000
LOWER IN cuba0.500000
age 130.500000
LOWER IN india0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
el salvador0.500000
estonia0.500000
LOWER IN age 3-60.500000
LOWER IN colon0.500000
nouabale-ndoki national park0.500000
republic of congo0.500000
spondyloarthritis0.500000
spondylitis0.500000
atherosclerosis0.500000
poland0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
vervet monkey0.500000
sigmoid colon0.500000
colon0.500000
children0.500000
age one year0.500000
LOWER IN age one month0.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
age 60-790.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
rural community0.400000
obsolete_juvenile stage0.400000
LOWER IN infant0.400000
LOWER IN age &lt; 1 year0.400000
atlanta0.333333
LOWER IN systemic lupus erythematosus0.333333
amsterdam0.333333
american diet0.333333
biopsy0.333333
state of oklahoma0.333333
first trimester0.333333
tibet autonomous region0.333333
amerindian0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.972477
feces0.926606
adult0.486239
united states of america0.330275
control0.174312
child0.146789
china0.137615
obsolete_juvenile stage0.091743
city0.064220
female0.064220
rural community0.055046
LOWER IN crohn&#39;s disease0.055046
india0.045872
infant0.045872
small village0.036697
LOWER IN ulcerative colitis0.036697
germany0.036697
jiangsu province0.036697
state of california0.027523
heterosexual0.027523
msw0.027523
amsterdam0.027523
kingdom of the netherlands0.027523
biopsy0.027523
age 8-120.027523
duodenum0.027523
kingdom of norway0.027523
age 130.027523
juvenile organism0.027523
age0.027523
age<17 years0.018349
atlanta0.018349
commonwealth of virginia0.018349
state of new york0.018349
commonwealth of pennsylvania0.018349
state of michigan0.018349
state of colorado0.018349
nanchang city prefecture0.018349
biopsy site0.018349
israel0.018349
pregnancy0.018349
LOWER IN child0.018349
belgium0.018349
age 3-60.018349
age 30-500.018349
kingdom of spain0.018349
new delhi0.018349
small intestine0.018349
toronto0.018349
LOWER IN adult0.018349
glasgow0.018349
oslo0.018349
age 30-400.018349
age 13-140.018349
finland0.018349
LOWER IN infant0.018349
united kingdom0.018349
age < 3 years0.018349
LOWER IN finland0.018349
LOWER IN age &lt; 1 year0.018349
rectum0.018349
kingdom of denmark0.018349
africa0.018349
age 5-13 years0.018349
bolivia0.018349
chuquisaca department0.018349
LOWER IN city0.009174
LOWER IN systemic lupus erythematosus0.009174
ulcerative colitis0.009174
jordan0.009174
LOWER IN insomnia0.009174
LOWER IN body mass index0.009174
LOWER IN high bmi0.009174
low bmi0.009174
age 17-290.009174
south korea0.009174
denver0.009174
italy0.009174
high bmi0.009174
obesity0.009174
LOWER IN egypt0.009174
american diet0.009174
azerbaijan0.009174
right colon0.009174
third trimester0.009174
LOWER IN inflammatory bowel disease0.009174
lima0.009174
shantytown0.009174
state of oklahoma0.009174
mild0.009174
LOWER IN severe0.009174
first trimester0.009174
tibetan plateau0.009174
tibet autonomous region0.009174
gangcha region0.009174
LOWER IN gannan tibetan autonomous prefecture0.009174
left colon0.009174
irritable bowel syndrome0.009174
hunter gatherer0.009174
amerindian0.009174
Exp. ID User ID Description Date Region Flag Sequences
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 20
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 37
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 38
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 55
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 66
566amnon high in control compared to insomnia in homo sapiens feces china adult 2019-11-24v4No1 / 70
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in state of new york united states of america homo sapiens adult feces )2020-09-09v4No1 / 74
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 74
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 75
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 78
643amnoncommon adult, south korea, feces, homo sapiens2020-08-30v4No1 / 80
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 81
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 81
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 82
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 83
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 84
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 85
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 87
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 88
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 92
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 92
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 94
629amnoncommon msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 96
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 96
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 102
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 104
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 105
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 106
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 106
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 107
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 108
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 108
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 109
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 109
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 111
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 113
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 114
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 116
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 117
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 119
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 120
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 120
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 124
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 124
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 127
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 129
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 131
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 133
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 133
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 133
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 135
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 136
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 137
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 137
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 139
629amnoncommon amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 140
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 144
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 144
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 149
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 154
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 156
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 156
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 161
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 161
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 167
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 168
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 169
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 172
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 179
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 182
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 196
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 196
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 207
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 215
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 217
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 220
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 226
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 247
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 252
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 262
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 262
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 278
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 287
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 294
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 305
650amnon high in asian compared to caucasian european in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 316
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 318
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 327
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 372
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 386
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 389
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 415
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 421
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 439
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 445
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 456
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 458
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 544
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 556
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 563
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 605
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 616
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 751

Problems / suggestions? Please email info AT dbbact DOT org