Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGACGTGAAACTCCGGGGCTCAACTCCGGAACTGCGTTGGAAACTGTAAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.368692
feces0.325366
adult0.292683
united states of america0.187092
child0.184430
control0.128617
obsolete_juvenile stage0.118343
LOWER IN crohn's disease0.111888
LOWER IN ulcerative colitis0.096000
human adult stage0.093458
state of california0.081967
city0.078829
infant0.072539
rural community0.070796
female0.069364
13-year-old human stage0.064935
india0.063391
monkey0.060060
6-12 year-old child stage0.059172
israel0.056926
small village0.053571
china0.053232
LOWER IN under-1-year-old human stage0.051948
1-year-old human stage0.050633
juvenile organism0.050633
kingdom of denmark0.050420
fourth decade human stage0.050000
adolescent stage0.048780
jiangsu province0.045455
germany0.041237
heterosexual0.040268
msw0.040268
age 8-120.040000
edo state0.040000
fifth decade human stage0.039604
africa0.039216
iga positive fraction0.039216
LOWER IN iga negative fraction0.039216
state of texas0.038961
kingdom of norway0.038462
LOWER IN infant0.038217
biopsy0.038095
amsterdam0.037736
nigeria0.037037
state of new york0.036697
age0.036364
duodenum0.036364
kingdom of the netherlands0.035088
captive0.031496
canada0.031250
bangladesh0.027211
central african republic0.027211
state of oklahoma0.027027
age<17 years0.027027
oslo0.027027
new delhi0.027027
age 13-140.027027
age 3-60.027027
chuquisaca department0.027027
age 4-10 years0.027027
los angeles0.027027
zealand0.027027
bethesda0.027027
peru0.026846
toronto0.026667
glasgow0.026667
age < 3 years0.026667
atlanta0.026667
immature stage0.026667
nanchang city prefecture0.026667
14-year-old human stage0.026667
food allergy0.026667
calgary0.026667
biopsy site0.026316
bolivia0.026316
age 5-13 years0.026316
macaca mulatta0.026316
nanjing city prefecture0.026316
state of maryland0.026316
state of michigan0.026144
LOWER IN finland0.025974
state of colorado0.025974
mexico0.025974
rectum0.025641
small intestine0.025641
commonwealth of virginia0.025641
LOWER IN irritable bowel syndrome0.025641
LOWER IN child0.025316
united kingdom0.025157
obesity0.025157
2-5 year-old child stage0.025000
belgium0.024691
finland0.024390
commonwealth of pennsylvania0.023810
LOWER IN adult0.023669
pregnancy0.022989
rectal swab0.022727
kingdom of spain0.020619
research facility0.014134
children0.013699
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
bangladesh0.666667
central african republic0.666667
heterosexual0.600000
msw0.600000
LOWER IN crohn&#39;s disease0.533333
children0.500000
lima0.500000
shantytown0.500000
el salvador0.500000
sewage0.500000
LOWER IN effluent0.500000
LOWER IN egypt0.500000
LOWER IN india0.500000
13-year-old human stage0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
chlorocebus aethiops0.500000
tunapuco0.500000
state of oklahoma0.500000
cron diet0.500000
age<17 years0.500000
spondyloarthritis0.500000
spondylitis0.500000
oslo0.500000
denver0.500000
new delhi0.500000
jordan0.500000
azerbaijan0.500000
LOWER IN venezuela0.500000
LOWER IN amerindian0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
myanmar0.500000
karen0.500000
mild0.500000
LOWER IN severe0.500000
bangui0.500000
LOWER IN madagascar0.500000
LOWER IN antananarivo0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN pancreatitis0.500000
age >940.500000
tenth decade human stage0.500000
LOWER IN soldiers0.500000
LOWER IN young adult stage0.500000
age 8-120.500000
age 13-140.500000
LOWER IN age 3-60.500000
age 3-60.500000
atherosclerosis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
17-29-years-old human0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
LOWER IN insomnia0.500000
rem sleep behavior disorder0.500000
republic of congo0.500000
nouabale-ndoki national park0.500000
LOWER IN cuba0.500000
milk allergy0.500000
age 4-10 years0.500000
sesame allergy0.500000
gaz:000521000.500000
cornell university0.500000
age 2-5 years0.500000
LOWER IN iga igg negative fraction0.500000
age 9-17 years0.500000
teenager0.500000
age 20 months0.500000
LOWER IN neonate0.500000
LOWER IN spinal cord injury0.500000
age 4-7 years0.500000
mexican american0.500000
los angeles0.500000
LOWER IN 9-month-old human stage0.500000
edo state0.500000
zealand0.500000
bethesda0.500000
pig tailed macaque monkey0.500000
LOWER IN intensive care unit admission0.500000
LOWER IN critical illness0.500000
dhaka0.500000
urban slum0.500000
LOWER IN under-1-year-old human stage0.400000
obsolete_juvenile stage0.400000
peru0.400000
fifth decade human stage0.400000
india0.363636
LOWER IN ulcerative colitis0.352941
toronto0.333333
influent0.333333
south america0.333333
LOWER IN obsolete_juvenile stage0.333333
glasgow0.333333
age < 3 years0.333333
estonia0.333333
american diet0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.951389
feces0.930556
adult0.500000
united states of america0.368056
control0.208333
child0.159722
china0.125000
obsolete_juvenile stage0.069444
human adult stage0.069444
LOWER IN crohn&#39;s disease0.062500
female0.062500
state of california0.055556
LOWER IN ulcerative colitis0.055556
infant0.048611
city0.048611
rural community0.041667
india0.034722
13-year-old human stage0.034722
monkey0.034722
6-12 year-old child stage0.034722
israel0.034722
1-year-old human stage0.027778
LOWER IN under-1-year-old human stage0.027778
small village0.027778
juvenile organism0.027778
kingdom of denmark0.027778
adolescent stage0.027778
germany0.027778
fourth decade human stage0.027778
jiangsu province0.027778
biopsy0.020833
age0.020833
kingdom of norway0.020833
duodenum0.020833
state of texas0.020833
LOWER IN infant0.020833
heterosexual0.020833
msw0.020833
africa0.020833
fifth decade human stage0.020833
age 8-120.020833
canada0.020833
kingdom of the netherlands0.020833
amsterdam0.020833
state of new york0.020833
iga positive fraction0.020833
LOWER IN iga negative fraction0.020833
research facility0.020833
captive0.020833
nigeria0.020833
edo state0.020833
toronto0.013889
LOWER IN adult0.013889
rectum0.013889
LOWER IN child0.013889
glasgow0.013889
bangladesh0.013889
united kingdom0.013889
finland0.013889
LOWER IN finland0.013889
age < 3 years0.013889
obesity0.013889
peru0.013889
state of oklahoma0.013889
state of michigan0.013889
kingdom of spain0.013889
atlanta0.013889
age<17 years0.013889
immature stage0.013889
oslo0.013889
state of colorado0.013889
small intestine0.013889
new delhi0.013889
commonwealth of virginia0.013889
commonwealth of pennsylvania0.013889
belgium0.013889
biopsy site0.013889
central african republic0.013889
nanchang city prefecture0.013889
age 13-140.013889
14-year-old human stage0.013889
age 3-60.013889
2-5 year-old child stage0.013889
bolivia0.013889
chuquisaca department0.013889
age 5-13 years0.013889
pregnancy0.013889
mexico0.013889
food allergy0.013889
age 4-10 years0.013889
LOWER IN irritable bowel syndrome0.013889
macaca mulatta0.013889
nanjing city prefecture0.013889
los angeles0.013889
zealand0.013889
state of maryland0.013889
bethesda0.013889
calgary0.013889
rectal swab0.013889
caecum0.006944
Number of experiments associating the term to the sequence
TermScore
feces83.000000
homo sapiens83.000000
adult48.000000
united states of america37.000000
control20.000000
child12.000000
LOWER IN crohn&#39;s disease8.000000
china7.000000
female6.000000
LOWER IN ulcerative colitis6.000000
infant5.000000
city5.000000
state of california5.000000
human adult stage5.000000
1-year-old human stage4.000000
LOWER IN under-1-year-old human stage4.000000
india4.000000
obsolete_juvenile stage4.000000
monkey4.000000
rural community4.000000
age3.000000
small village3.000000
kingdom of denmark3.000000
state of texas3.000000
LOWER IN infant3.000000
heterosexual3.000000
msw3.000000
israel3.000000
iga positive fraction3.000000
LOWER IN iga negative fraction3.000000
LOWER IN adult2.000000
rectum2.000000
biopsy2.000000
LOWER IN child2.000000
bangladesh2.000000
united kingdom2.000000
kingdom of norway2.000000
juvenile organism2.000000
13-year-old human stage2.000000
obesity2.000000
duodenum2.000000
peru2.000000
state of oklahoma2.000000
state of michigan2.000000
adolescent stage2.000000
germany2.000000
fourth decade human stage2.000000
state of colorado2.000000
central african republic2.000000
africa2.000000
fifth decade human stage2.000000
6-12 year-old child stage2.000000
canada2.000000
mexico2.000000
state of new york2.000000
research facility2.000000
macaca mulatta2.000000
captive2.000000
toronto1.000000
caecum1.000000
children1.000000
lima1.000000
shantytown1.000000
el salvador1.000000
sewage1.000000
influent1.000000
LOWER IN effluent1.000000
south america1.000000
LOWER IN egypt1.000000
LOWER IN obsolete_juvenile stage1.000000
glasgow1.000000
finland1.000000
LOWER IN india1.000000
LOWER IN finland1.000000
age < 3 years1.000000
estonia1.000000
physical activity1.000000
LOWER IN little physical activity1.000000
chlorocebus aethiops1.000000
tunapuco1.000000
cron diet1.000000
american diet1.000000
kingdom of spain1.000000
atlanta1.000000
age<17 years1.000000
immature stage1.000000
spondyloarthritis1.000000
spondylitis1.000000
oslo1.000000
denver1.000000
small intestine1.000000
new delhi1.000000
jordan1.000000
azerbaijan1.000000
commonwealth of virginia1.000000
LOWER IN venezuela1.000000
LOWER IN amerindian1.000000
gangcha region1.000000
LOWER IN gannan tibetan autonomous prefecture1.000000
commonwealth of pennsylvania1.000000
belgium1.000000
myanmar1.000000
karen1.000000
biopsy site1.000000
mild1.000000
LOWER IN severe1.000000
bangui1.000000
LOWER IN madagascar1.000000
LOWER IN antananarivo1.000000
LOWER IN acute pancreatitis1.000000
LOWER IN pancreatitis1.000000
nanchang city prefecture1.000000
age >941.000000
tenth decade human stage1.000000
LOWER IN soldiers1.000000
LOWER IN young adult stage1.000000
age 8-121.000000
age 13-141.000000
14-year-old human stage1.000000
LOWER IN age 3-61.000000
age 3-61.000000
2-5 year-old child stage1.000000
jiangsu province1.000000
atherosclerosis1.000000
LOWER IN nepal1.000000
LOWER IN himalayas1.000000
17-29-years-old human1.000000
bolivia1.000000
chuquisaca department1.000000
age 5-13 years1.000000
LOWER IN arm1.000000
LOWER IN forearm1.000000
LOWER IN insomnia1.000000
pregnancy1.000000
rem sleep behavior disorder1.000000
republic of congo1.000000
nouabale-ndoki national park1.000000
kingdom of the netherlands1.000000
amsterdam1.000000
LOWER IN cuba1.000000
food allergy1.000000
milk allergy1.000000
age 4-10 years1.000000
sesame allergy1.000000
gaz:000521001.000000
cornell university1.000000
age 2-5 years1.000000
LOWER IN iga igg negative fraction1.000000
age 9-17 years1.000000
teenager1.000000
LOWER IN irritable bowel syndrome1.000000
age 20 months1.000000
LOWER IN neonate1.000000
LOWER IN spinal cord injury1.000000
nanjing city prefecture1.000000
age 4-7 years1.000000
mexican american1.000000
los angeles1.000000
LOWER IN 9-month-old human stage1.000000
nigeria1.000000
edo state1.000000
zealand1.000000
state of maryland1.000000
bethesda1.000000
pig tailed macaque monkey1.000000
LOWER IN intensive care unit admission1.000000
LOWER IN critical illness1.000000
calgary1.000000
rectal swab1.000000
dhaka1.000000
urban slum1.000000
Exp. ID User ID Description Date Region Sequences Status Flag
866amnon high in control compared to ulcerative colitis ulcerative colitis in feces homo sapiens united states of america adult human adult stage 2022-02-08v41 / 20approvedNo
290amnon high in small village rural community compared to city in feces homo sapiens adult china 2018-02-01v41 / 21approvedNo
1017amnon high in control compared to disease intensive care unit admission critical illness in homo sapiens adult canada calgary rectal swab human adult stage 2023-04-02v41 / 35approvedNo
297amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v41 / 38approvedNo
866amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens united states of america adult human adult stage 2022-02-08v41 / 38approvedNo
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v41 / 39approvedNo
866amnon high in control compared to irritable bowel syndrome irritable bowel syndrome in feces homo sapiens united states of america adult human adult stage 2022-02-08v41 / 40approvedNo
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v41 / 56approvedNo
911amnon high in control compared to spinal cord injury in feces homo sapiens nanjing city prefecture china human adult stage 2022-05-21v41 / 56approvedNo
1050amnoncommon feces, homo sapiens, united states of america, adult, state of wisconsin, human adult stage2023-08-31v41 / 59pendingNo
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v41 / 67approvedNo
566amnon high in control compared to insomnia in feces homo sapiens adult china 2019-11-24v41 / 71approvedNo
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v41 / 75approvedNo
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult state of new york )2020-09-09v41 / 75approvedNo
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v41 / 76approvedNo
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v41 / 79approvedNo
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v41 / 80approvedNo
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v41 / 81approvedNo
911amnoncommon feces, homo sapiens, control, nanjing city prefecture, china, human adult stage2022-05-21v41 / 81approvedNo
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v41 / 82approvedNo
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v41 / 82approvedNo
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v41 / 83approvedNo
959amnoncommon feces, homo sapiens, control, united states of america, child, state of california, los angeles, 6-12 year-old child stage, adolescent stage2022-12-19v41 / 83approvedNo
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v41 / 84approvedNo
961amnoncommon feces, homo sapiens, child, kingdom of denmark, zealand, 4-year-old human stage2022-12-20v41 / 84approvedNo
972amnoncommon feces, homo sapiens, united states of america, adult, state of california2022-12-24v41 / 84approvedNo
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v41 / 85approvedNo
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v41 / 86approvedNo
841amnoncommon feces, homo sapiens, united states of america, adult, state of texas, human adult stage2021-11-08v41 / 86approvedNo
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v41 / 88approvedNo
830amnon high in iga positive fraction compared to iga negative fraction iga igg negative fraction in feces homo sapiens peru age 9-17 years teenager 2021-09-10v41 / 88approvedNo
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v41 / 89approvedNo
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v41 / 89approvedNo
958amnoncommon feces, homo sapiens, united states of america, adult, state of texas, mexico, mexican american2022-12-19v41 / 91approvedNo
866amnon high in control compared to crohn's disease crohn's disease in feces homo sapiens united states of america adult human adult stage 2022-02-08v41 / 92approvedNo
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v41 / 93approvedNo
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v41 / 93approvedNo
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v41 / 94approvedNo
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v41 / 95approvedNo
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v41 / 97approvedNo
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v41 / 97approvedNo
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v41 / 97approvedNo
1055amnoncommon feces, homo sapiens, adult, israel, fifth decade human stage2023-09-25v41 / 99pendingNo
804amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v41 / 100approvedNo
961amnoncommon feces, homo sapiens, child, kingdom of denmark, zealand, 6-year-old human stage2022-12-20v41 / 101approvedNo
1017amnoncommon homo sapiens, control, adult, canada, calgary, rectal swab, human adult stage2023-04-02v41 / 101approvedNo
877amnoncommon feces, homo sapiens, adult, austria, human early adulthood stage2022-03-08v41 / 102approvedNo
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester pregnancy stage2020-01-14v41 / 103approvedNo
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v41 / 105approvedNo
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v41 / 105approvedNo
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v41 / 106approvedNo
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v41 / 107approvedNo
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v41 / 107approvedNo
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v41 / 108approvedNo
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v41 / 108approvedNo
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v41 / 109approvedNo
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v41 / 109approvedNo
960amnoncommon feces, homo sapiens, female, adult, nigeria, edo state2022-12-20v41 / 109approvedNo
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v41 / 110approvedNo
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v41 / 110approvedNo
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v41 / 110approvedNo
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester pregnancy stage2020-01-14v41 / 112approvedNo
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v41 / 114approvedNo
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v41 / 115approvedNo
239amnoncommon feces, homo sapiens, united states of america2017-11-08v41 / 117approvedNo
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v41 / 118approvedNo
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v41 / 120approvedNo
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v41 / 121approvedNo
371amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v41 / 121approvedNo
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in feces homo sapiens toronto )2016-10-27v41 / 125approvedNo
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v41 / 125approvedNo
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v41 / 125approvedNo
779amnon high in control compared to crohn's disease in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v41 / 127approvedNo
607amnoncommon feces, homo sapiens, control, germany2020-04-19v41 / 128approvedNo
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v41 / 130approvedNo
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v41 / 131approvedNo
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v41 / 132approvedNo
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v41 / 134approvedNo
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v41 / 134approvedNo
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v41 / 134approvedNo
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v41 / 136approvedNo
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v41 / 136approvedNo
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v41 / 137approvedNo
10amnoncommon feces, homo sapiens, toronto2016-10-27v41 / 138approvedNo
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v41 / 138approvedNo
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in feces homo sapiens united states of america )2017-12-04v41 / 140approvedNo
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v41 / 141approvedNo
132amnoncommon feces, homo sapiens, united states of america2017-04-16v41 / 145approvedNo
330amnon high in adult fourth decade human stage compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v41 / 145approvedNo
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v41 / 147approvedNo
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v41 / 155approvedNo
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v41 / 157approvedNo
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v41 / 157approvedNo
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v41 / 162approvedNo
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v41 / 162approvedNo
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage compared to age 3-6 2-5 year-old child stage in feces homo sapiens china )2018-12-30v41 / 168approvedNo
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v41 / 169approvedNo
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, india, 13-year-old human stage2017-09-12v41 / 170approvedNo
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years 2-year-old human stage 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant )2017-11-13v41 / 173approvedNo
399amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v41 / 180approvedNo
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v41 / 183approvedNo
959amnon high in control compared to ulcerative colitis ulcerative colitis in feces homo sapiens united states of america child state of california los angeles 6-12 year-old child stage adolescent stage 2022-12-19v41 / 194approvedNo
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v41 / 197approvedNo
620amnoncommon feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v41 / 197approvedNo
120amnoncommon feces, homo sapiens, brazil2017-04-12v41 / 208approvedNo
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v41 / 216approvedNo
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v41 / 218approvedNo
566amnoncommon feces, homo sapiens, adult, china2019-11-24v41 / 221approvedNo
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v41 / 227approvedNo
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v41 / 248approvedNo
45amnonlower in young babies compared to 2 year olds in india ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant india )2016-12-19v41 / 253approvedNo
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v41 / 263approvedNo
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v41 / 263approvedNo
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v41 / 279approvedNo
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v41 / 288approvedNo
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v41 / 295approvedNo
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v41 / 301approvedNo
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v41 / 306approvedNo
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v41 / 317approvedNo
1006amnoncommon feces, united states of america, research facility, macaca mulatta, state of maryland, monkey, captive, bethesda, rhesus macaque2023-01-09v41 / 318approvedNo
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v41 / 319approvedNo
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v41 / 328approvedNo
891amnon high in 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant bangladesh dhaka infant stage urban slum 2022-04-03v41 / 363approvedNo
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v41 / 373approvedNo
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v41 / 387approvedNo
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v41 / 390approvedNo
960amnon high in 18-month-old human stage compared to 9-month-old human stage in feces homo sapiens infant nigeria edo state 2022-12-20v41 / 407approvedNo
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v41 / 416approvedNo
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v41 / 417approvedNo
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v41 / 422approvedNo
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v41 / 440approvedNo
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v41 / 446approvedNo
935amnoncommon feces, united states of america, papio anubis, state of oklahoma, monkey, captive, olive baboon, female organism, age 4-7 years2022-09-18v41 / 452approvedNo
339amnon high in adult compared to infant under-1-year-old human stage in feces homo sapiens india 2018-05-24v41 / 457approvedNo
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v41 / 459approvedNo
1006amnoncommon feces, united states of america, research facility, state of maryland, monkey, captive, macaca nemestrina, bethesda, pig tailed macaque monkey2023-01-08v41 / 514approvedNo
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v41 / 545approvedNo
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v41 / 557approvedNo
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v41 / 564approvedNo
517amnon high in feces compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v41 / 606approvedNo
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v41 / 617approvedNo
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v41 / 752approvedNo
876amnon high in juvenile organism age 20 months compared to age 1 week neonate in feces united states of america research facility macaca mulatta state of washington monkey 2022-03-06v41 / 1065approvedNo
960amnon high in female adult compared to infant 18-month-old human stage in feces homo sapiens nigeria edo state 2022-12-20v41 / 1392approvedNo

Problems / suggestions? Please visit the dbBact forum