Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGACGTGAAACTCCGGGGCTCAACTCCGGAACTGCGTTGGAAACTGTAAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.430516
feces0.376654
adult0.326848
child0.193483
united states of america0.184976
LOWER IN crohn's disease0.139400
control0.131572
obsolete_juvenile stage0.130719
city0.089744
LOWER IN ulcerative colitis0.087209
rural community0.083045
human adult stage0.078067
india0.073126
13-year-old human stage0.072464
infant0.071856
female0.064755
china0.063126
small village0.060000
state of california0.058366
juvenile organism0.057143
fourth decade human stage0.056338
1-year-old human stage0.055944
LOWER IN under-1-year-old human stage0.054422
israel0.049383
jiangsu province0.046512
iga positive fraction0.045113
LOWER IN iga negative fraction0.045113
heterosexual0.045113
msw0.045113
age 8-120.044776
germany0.043011
amsterdam0.042857
biopsy0.042857
kingdom of norway0.042857
6-12 year-old child stage0.041958
duodenum0.041522
state of new york0.041096
kingdom of the netherlands0.041096
age0.040268
africa0.032432
atlanta0.030769
glasgow0.030769
bangladesh0.030769
central african republic0.030534
age<17 years0.030303
LOWER IN irritable bowel syndrome0.030303
food allergy0.030303
age 4-10 years0.030303
age 3-60.030303
new delhi0.030303
oslo0.030303
age 13-140.030303
chuquisaca department0.030303
nanjing city prefecture0.029851
peru0.029851
nanchang city prefecture0.029851
toronto0.029851
14-year-old human stage0.029851
age < 3 years0.029851
age 5-13 years0.029851
obesity0.029630
state of texas0.029412
biopsy site0.029412
fifth decade human stage0.029412
kingdom of denmark0.029412
bolivia0.029412
state of michigan0.029197
state of colorado0.029197
rectum0.028777
small intestine0.028571
commonwealth of virginia0.028169
finland0.028169
LOWER IN finland0.028169
monkey0.028169
adolescent stage0.027778
belgium0.027778
commonwealth of pennsylvania0.027397
2-5 year-old child stage0.026667
united kingdom0.026490
pregnancy0.026316
LOWER IN infant0.025974
LOWER IN child0.024390
kingdom of spain0.023529
immature stage0.020202
LOWER IN spinal cord injury0.015504
jordan0.015504
lima0.015504
rem sleep behavior disorder0.015504
LOWER IN cuba0.015504
atherosclerosis0.015504
LOWER IN acute pancreatitis0.015504
LOWER IN pancreatitis0.015504
dhaka0.015504
LOWER IN neonate0.015504
LOWER IN insomnia0.015385
17-29-years-old human0.015385
sesame allergy0.015385
denver0.015385
LOWER IN iga igg negative fraction0.015385
age 9-17 years0.015385
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN crohn&#39;s disease8.000000
atlanta1.000000
LOWER IN spinal cord injury1.000000
jordan1.000000
lima1.000000
glasgow1.000000
rem sleep behavior disorder1.000000
LOWER IN cuba1.000000
atherosclerosis1.000000
bangladesh1.000000
LOWER IN acute pancreatitis1.000000
LOWER IN pancreatitis1.000000
dhaka1.000000
LOWER IN neonate1.000000
small village0.750000
central african republic0.666667
LOWER IN ulcerative colitis0.625000
iga positive fraction0.600000
LOWER IN iga negative fraction0.600000
heterosexual0.600000
msw0.600000
india0.571429
age<17 years0.500000
LOWER IN irritable bowel syndrome0.500000
LOWER IN insomnia0.500000
17-29-years-old human0.500000
food allergy0.500000
age 4-10 years0.500000
sesame allergy0.500000
denver0.500000
LOWER IN iga igg negative fraction0.500000
age 9-17 years0.500000
teenager0.500000
milk allergy0.500000
azerbaijan0.500000
age 2-5 years0.500000
third trimester0.500000
age 8-120.500000
cornell university0.500000
age 3-60.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
irritable bowel syndrome0.500000
new delhi0.500000
oslo0.500000
gaz:000521000.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
13-year-old human stage0.500000
LOWER IN little physical activity0.500000
el salvador0.500000
LOWER IN age 3-60.500000
spondyloarthritis0.500000
spondylitis0.500000
republic of congo0.500000
nouabale-ndoki national park0.500000
LOWER IN diarrhea0.500000
tunapuco0.500000
LOWER IN himalayas0.500000
sewage0.500000
chlorocebus aethiops0.500000
vervet monkey0.500000
children0.500000
bangui0.500000
LOWER IN antananarivo0.500000
LOWER IN forearm0.500000
chuquisaca department0.500000
age >940.500000
tenth decade human stage0.500000
LOWER IN soldiers0.500000
obsolete_juvenile stage0.400000
rural community0.363636
nanjing city prefecture0.333333
peru0.333333
american diet0.333333
nanchang city prefecture0.333333
madagascar0.333333
state of oklahoma0.333333
first trimester0.333333
tibet autonomous region0.333333
venezuela0.333333
amerindian0.333333
toronto0.333333
overweight body mass index status0.333333
14-year-old human stage0.333333
juvenile organism0.333333
physical activity0.333333
estonia0.333333
age < 3 years0.333333
LOWER IN colon0.333333
village0.333333
LOWER IN 65-79 year-old human stage0.333333
LOWER IN nepal0.333333
asian0.333333
mouth neoplasm0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.968750
feces0.937500
adult0.500000
united states of america0.351562
control0.203125
child0.148438
china0.140625
obsolete_juvenile stage0.078125
LOWER IN crohn&#39;s disease0.070312
human adult stage0.054688
city0.054688
female0.054688
LOWER IN ulcerative colitis0.046875
rural community0.046875
infant0.046875
state of california0.039062
india0.039062
13-year-old human stage0.039062
small village0.031250
israel0.031250
germany0.031250
jiangsu province0.031250
fourth decade human stage0.031250
juvenile organism0.031250
1-year-old human stage0.031250
LOWER IN under-1-year-old human stage0.031250
iga positive fraction0.023438
LOWER IN iga negative fraction0.023438
state of new york0.023438
heterosexual0.023438
msw0.023438
kingdom of the netherlands0.023438
amsterdam0.023438
biopsy0.023438
africa0.023438
age 8-120.023438
6-12 year-old child stage0.023438
duodenum0.023438
kingdom of norway0.023438
age0.023438
atlanta0.015625
age<17 years0.015625
immature stage0.015625
adolescent stage0.015625
commonwealth of virginia0.015625
LOWER IN irritable bowel syndrome0.015625
nanjing city prefecture0.015625
commonwealth of pennsylvania0.015625
state of michigan0.015625
food allergy0.015625
age 4-10 years0.015625
state of colorado0.015625
obesity0.015625
state of texas0.015625
peru0.015625
nanchang city prefecture0.015625
biopsy site0.015625
central african republic0.015625
pregnancy0.015625
LOWER IN child0.015625
belgium0.015625
age 3-60.015625
2-5 year-old child stage0.015625
fifth decade human stage0.015625
kingdom of spain0.015625
small intestine0.015625
new delhi0.015625
LOWER IN adult0.015625
toronto0.015625
glasgow0.015625
oslo0.015625
age 13-140.015625
14-year-old human stage0.015625
finland0.015625
LOWER IN infant0.015625
united kingdom0.015625
LOWER IN finland0.015625
age < 3 years0.015625
rectum0.015625
bangladesh0.015625
kingdom of denmark0.015625
monkey0.015625
bolivia0.015625
chuquisaca department0.015625
age 5-13 years0.015625
LOWER IN city0.007812
LOWER IN systemic lupus erythematosus0.007812
ulcerative colitis0.007812
LOWER IN spinal cord injury0.007812
jordan0.007812
LOWER IN insomnia0.007812
low bmi0.007812
LOWER IN body mass index0.007812
LOWER IN high bmi0.007812
17-29-years-old human0.007812
sesame allergy0.007812
south korea0.007812
denver0.007812
italy0.007812
high bmi0.007812
Exp. ID User ID Description Date Region Flag Sequences
866amnon high in control compared to ulcerative colitis ulcerative colitis in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 20
290amnon high in small village rural community compared to city in feces homo sapiens adult china 2018-02-01v4No1 / 21
297amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens united states of america child atlanta obsolete_juvenile stage age<17 years immature stage adolescent stage 2018-02-12v4No1 / 38
866amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 38
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens united states of america adult commonwealth of virginia 2018-09-03v4No1 / 39
866amnon high in control compared to irritable bowel syndrome irritable bowel syndrome in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 40
394amnoncommon feces, homo sapiens, united states of america, adult, state of california, ulcerative colitis2018-11-06v4No1 / 56
911amnon high in control compared to spinal cord injury in feces homo sapiens nanjing city prefecture china human adult stage 2022-05-21v4No1 / 56
365amnoncommon feces, homo sapiens, child, jordan, obsolete_juvenile stage2018-08-30v4No1 / 67
566amnon high in control compared to insomnia in feces homo sapiens adult china 2019-11-24v4No1 / 71
395amnoncommon feces, homo sapiens, control, united states of america, commonwealth of pennsylvania2018-11-14v4No1 / 75
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult state of new york )2020-09-09v4No1 / 75
484amnoncommon feces, homo sapiens, united states of america, adult, state of michigan, 17-29-years-old human2019-02-13v4No1 / 76
401amnoncommon feces, homo sapiens, united states of america, adult2018-11-18v4No1 / 79
695amnoncommon feces, homo sapiens, child, israel, food allergy, age 4-10 years, sesame allergy2028-03-27v4No1 / 80
643amnoncommon feces, homo sapiens, adult, south korea2020-08-30v4No1 / 81
911amnoncommon feces, homo sapiens, control, nanjing city prefecture, china, human adult stage2022-05-21v4No1 / 81
344amnoncommon in feces of heterosexuals (common feces, homo sapiens, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, control, united states of america, adult, commonwealth of virginia2018-09-03v4No1 / 82
502amnoncommon feces, homo sapiens, control, united states of america, adult2019-03-12v4No1 / 83
393amnoncommon feces, homo sapiens, united states of america, city, adult, state of colorado, heterosexual, msw2018-11-06v4No1 / 84
247amnoncommon feces, homo sapiens, italy, high bmi, obesity2017-11-21v4No1 / 85
394amnoncommon feces, homo sapiens, control, united states of america, adult, state of california2018-11-06v4No1 / 86
841amnoncommon feces, homo sapiens, united states of america, adult, state of texas, human adult stage2021-11-08v4No1 / 86
62amnon high in united states of america compared to egypt in feces homo sapiens child obsolete_juvenile stage 2017-02-13v4No1 / 88
830amnon high in iga positive fraction compared to iga negative fraction iga igg negative fraction in feces homo sapiens peru age 9-17 years teenager 2021-09-10v4No1 / 88
293amnoncommon feces, homo sapiens, united states of america, adult, american diet2018-02-07v4No1 / 89
629amnoncommon feces, homo sapiens, female, adult, kingdom of the netherlands, amsterdam2020-05-31v4No1 / 89
866amnon high in control compared to crohn's disease crohn's disease in feces homo sapiens united states of america adult human adult stage 2022-02-08v4No1 / 92
303amnoncommon feces, homo sapiens, adult, germany2018-03-12v4No1 / 93
428amnoncommon feces, homo sapiens, control, adult, nanchang city prefecture, china2018-12-09v4No1 / 93
695amnoncommon feces, homo sapiens, child, israel, food allergy, milk allergy, age 4-10 years2028-03-27v4No1 / 94
400amnoncommon in feces of european american females (common feces, homo sapiens, united states of america, female, adult)2018-11-18v4No1 / 95
365amnoncommon feces, homo sapiens, child, azerbaijan, obsolete_juvenile stage2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, right colon, biopsy site, adult, biopsy2018-11-22v4No1 / 97
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, heterosexual, msw2020-05-31v4No1 / 97
804amnon high in iga positive fraction compared to iga negative fraction in feces homo sapiens child africa central african republic madagascar age 2-5 years 2021-06-18v4No1 / 100
877amnoncommon feces, homo sapiens, adult, austria, human early adulthood stage2022-03-08v4No1 / 102
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, third trimester2020-01-14v4No1 / 103
284amnoncommon feces, homo sapiens, female, adult, state of california2018-01-27v4No1 / 105
683amnoncommon feces, homo sapiens, united states of america, adult, state of california2028-03-04v4No1 / 105
438amnoncommon feces, homo sapiens, child, jiangsu province, age 8-12, china, 6-12 year-old child stage2018-12-30v4No1 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child inflammatory bowel disease crohn's disease ulcerative colitis in feces homo sapiens united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common feces, homo sapiens, control, adult, belgium)2018-11-15v4No1 / 107
409amnoncommon feces, homo sapiens, united states of america, adult2018-11-22v4No1 / 108
802amnoncommon feces, homo sapiens, united states of america, adult, state of new york, cornell university2021-06-16v4No1 / 108
289amnoncommon feces, homo sapiens, united states of america, adult, state of michigan2018-02-01v4No1 / 109
438amnoncommon feces, homo sapiens, child, jiangsu province, age 3-6, china, 2-5 year-old child stage2018-12-30v4No1 / 109
53amnoncommon feces, homo sapiens, city, lima, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, adult, state of oklahoma2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in feces homo sapiens united states of america child )2018-11-22v4No1 / 110
580amnoncommon feces, homo sapiens, female, pregnancy, adult, israel, first trimester2020-01-14v4No1 / 112
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, adult, jiangsu province, china, fourth decade human stage, fifth decade human stage2018-12-30v4No1 / 115
239amnoncommon feces, homo sapiens, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, left colon, biopsy site, adult, biopsy2018-11-22v4No1 / 118
294amnoncommon feces, homo sapiens, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, small intestine, duodenum, new delhi, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, venezuela, amerindian, hunter gatherer2018-09-06v4No1 / 121
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in feces homo sapiens toronto )2016-10-27v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to child obsolete_juvenile stage crohn's disease in feces homo sapiens glasgow )2017-02-26v4No1 / 125
607amnoncommon feces, homo sapiens, germany, parkinson's disease2020-04-19v4No1 / 125
779amnon high in control compared to crohn's disease in feces homo sapiens adult guangzhou city prefecture china 2021-04-28v4No1 / 127
607amnoncommon feces, homo sapiens, control, germany2020-04-19v4No1 / 128
330amnoncommon feces, homo sapiens, adult, kingdom of norway, oslo, fourth decade human stage2018-05-13v4No1 / 130
721amnoncommon feces, homo sapiens, obesity, adult, scotland, overweight body mass index status, gaz:000521002028-05-23v4No1 / 131
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon feces, homo sapiens, jiangsu province, age 13-14, china, 13-year-old human stage, 14-year-old human stage2018-12-30v4No1 / 134
607amnoncommon feces, homo sapiens, germany, rem sleep behavior disorder2020-04-19v4No1 / 134
197amnoncommon feces, homo sapiens, juvenile organism, finland, obsolete_juvenile stage, 13-year-old human stage2017-09-12v4No1 / 136
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
294amnoncommon in non-IBS healthy controls (common feces, homo sapiens, control, adult, kingdom of spain)2018-02-09v4No1 / 137
10amnoncommon feces, homo sapiens, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens juvenile organism obsolete_juvenile stage 13-year-old human stage 2017-09-12v4No1 / 138
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 140
629amnoncommon feces, homo sapiens, adult, kingdom of the netherlands, amsterdam, homosexual, msm2020-05-31v4No1 / 141
132amnoncommon feces, homo sapiens, united states of america2017-04-16v4No1 / 145
330amnon high in adult fourth decade human stage compared to infant age 1 year in feces homo sapiens kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon feces, homo sapiens, adult, glasgow2017-02-26v4No1 / 147
53amnoncommon feces, homo sapiens, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon feces, homo sapiens, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 157
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
297amnoncommon feces, homo sapiens, united states of america, child, atlanta, obsolete_juvenile stage, age<17 years, immature stage, adolescent stage2018-02-12v4No1 / 162
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 6-12 year-old child stage 13-year-old human stage 14-year-old human stage compared to age 3-6 2-5 year-old child stage in feces homo sapiens china )2018-12-30v4No1 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, juvenile organism, obsolete_juvenile stage, india, 13-year-old human stage2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years 2-year-old human stage 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces homo sapiens united states of america 2018-11-16v4No1 / 180
319amnoncommon feces, homo sapiens, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, adult, french republic, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
620amnoncommon feces, homo sapiens, rural community, village, republic of congo, nouabale-ndoki national park2020-05-06v4No1 / 197
120amnoncommon feces, homo sapiens, brazil2017-04-12v4No1 / 208
455amnoncommon feces, homo sapiens, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, homo sapiens, adult, china2019-11-24v4No1 / 221
310amnoncommon feces, homo sapiens, female, rectum, adult, poland2018-04-07v4No1 / 227
398amnon high in control compared to crohn's disease in feces homo sapiens belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant india )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in feces homo sapiens adult bangladesh )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, adult, peru, small village, tunapuco, rural community2018-01-22v4No1 / 263
438amnon high in child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage compared to adult 65-79 year-old human stage fourth decade human stage fifth decade human stage in feces homo sapiens china 2018-12-30v4No1 / 279
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in feces homo sapiens adult 2019-01-28v4No1 / 295
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 306
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
299amnon high in mouth neoplasm cancer compared to control in homo sapiens saliva adult china 2018-02-27v4No1 / 319
467amnoncommon feces, homo sapiens, metabolic syndrome, adult, kingdom of denmark2019-01-14v4No1 / 328
891amnon high in 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant bangladesh dhaka infant stage urban slum 2022-04-03v4No1 / 363
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon feces, homo sapiens, child, egypt, obsolete_juvenile stage2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in city wastewater treatment plant south america )2017-01-21v4No1 / 440
274amnoncommon feces, chlorocebus aethiops, ethiopia, monkey, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant under-1-year-old human stage in feces homo sapiens india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in homo sapiens united states of america rectum caecum colon sigmoid colon terminal ileum biopsy children )2016-11-14v4No1 / 459
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age 1-year-old human stage compared to 1-month-old human stage in feces homo sapiens infant kingdom of denmark 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564
517amnon high in feces compared to arm skin forearm in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 752
876amnon high in juvenile organism age 20 months compared to age 1 week neonate in feces united states of america research facility macaca mulatta state of washington monkey 2022-03-06v4No1 / 1065

Problems / suggestions? Please email info AT dbbact DOT org