Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGACGTGAAACTCCGGGGCTCAACTCCGGAACTGCGTTGGAAACTGTAAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.494162
feces0.398809
adult0.380978
child0.216216
united states of america0.175707
obsolete_juvenile stage0.157480
control0.130745
city0.110063
LOWER IN crohn's disease0.108108
rural community0.103896
india0.090293
female0.076190
infant0.074813
small village0.074534
LOWER IN ulcerative colitis0.073394
china0.071942
germany0.063492
jiangsu province0.063492
age 8-120.055556
age 130.055556
biopsy0.054054
kingdom of norway0.052632
juvenile organism0.052632
duodenum0.051948
age0.049587
state of california0.045977
age<17 years0.037736
heterosexual0.037736
msw0.037736
nanchang city prefecture0.037736
age 3-60.037736
age 30-500.037736
new delhi0.037736
toronto0.037736
glasgow0.037736
oslo0.037736
age 30-400.037736
age 13-140.037736
chuquisaca department0.037736
LOWER IN infant0.037383
LOWER IN age < 1 year0.037383
atlanta0.037037
age < 3 years0.037037
africa0.037037
age 5-13 years0.037037
state of michigan0.036697
state of colorado0.036697
LOWER IN child0.036697
kingdom of denmark0.036697
biopsy site0.036364
small intestine0.036364
LOWER IN finland0.036364
bolivia0.036364
united kingdom0.036036
commonwealth of virginia0.035714
commonwealth of pennsylvania0.035714
rectum0.035714
belgium0.034483
finland0.034483
pregnancy0.033898
LOWER IN adult0.033333
kingdom of spain0.031746
israel0.031250
jordan0.019231
LOWER IN insomnia0.019231
age 17-290.019231
denver0.019231
LOWER IN egypt0.019231
azerbaijan0.019231
third trimester0.019231
LOWER IN inflammatory bowel disease0.019231
lima0.019231
shantytown0.019231
mild0.019231
LOWER IN severe0.019231
gangcha region0.019231
LOWER IN gannan tibetan autonomous prefecture0.019231
irritable bowel syndrome0.019231
parkinson's disease0.019231
myanmar0.019231
karen0.019231
cron diet0.019231
rem sleep behavior disorder0.019231
LOWER IN india0.019231
physical activity0.019231
LOWER IN little physical activity0.019231
el salvador0.019231
estonia0.019231
LOWER IN age 3-60.019231
village0.019231
nouabale-ndoki national park0.019231
republic of congo0.019231
spondyloarthritis0.019231
spondylitis0.019231
atherosclerosis0.019231
poland0.019231
age 1-20.019231
LOWER IN age 0-10.019231
bangladesh0.019231
tunapuco0.019231
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
LOWER IN crohn's disease0.666667
LOWER IN ulcerative colitis0.571429
india0.571429
age<17 years0.500000
jordan0.500000
LOWER IN insomnia0.500000
age 17-290.500000
denver0.500000
heterosexual0.500000
msw0.500000
LOWER IN egypt0.500000
nanchang city prefecture0.500000
azerbaijan0.500000
third trimester0.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
new delhi0.500000
toronto0.500000
glasgow0.500000
parkinson's disease0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
rem sleep behavior disorder0.500000
age 130.500000
LOWER IN india0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
el salvador0.500000
estonia0.500000
LOWER IN age 3-60.500000
village0.500000
nouabale-ndoki national park0.500000
republic of congo0.500000
spondyloarthritis0.500000
spondylitis0.500000
atherosclerosis0.500000
poland0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
vervet monkey0.500000
sigmoid colon0.500000
children0.500000
age one year0.500000
LOWER IN age one month0.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
age 60-790.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
rural community0.444444
obsolete_juvenile stage0.400000
LOWER IN infant0.400000
LOWER IN age < 1 year0.400000
child0.347826
atlanta0.333333
LOWER IN systemic lupus erythematosus0.333333
american diet0.333333
biopsy0.333333
state of oklahoma0.333333
first trimester0.333333
tibet autonomous region0.333333
amerindian0.333333
venezuela0.333333
LOWER IN obsolete_juvenile stage0.333333
thailand0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.970588
feces0.921569
adult0.450980
united states of america0.323529
control0.186275
child0.156863
china0.147059
obsolete_juvenile stage0.098039
city0.068627
rural community0.058824
LOWER IN crohn's disease0.058824
female0.058824
india0.049020
infant0.049020
small village0.039216
LOWER IN ulcerative colitis0.039216
germany0.039216
jiangsu province0.039216
state of california0.029412
biopsy0.029412
age 8-120.029412
duodenum0.029412
kingdom of norway0.029412
age 130.029412
juvenile organism0.029412
age0.029412
age<17 years0.019608
atlanta0.019608
commonwealth of virginia0.019608
commonwealth of pennsylvania0.019608
state of michigan0.019608
state of colorado0.019608
heterosexual0.019608
msw0.019608
nanchang city prefecture0.019608
biopsy site0.019608
israel0.019608
pregnancy0.019608
LOWER IN child0.019608
belgium0.019608
age 3-60.019608
age 30-500.019608
kingdom of spain0.019608
new delhi0.019608
small intestine0.019608
toronto0.019608
LOWER IN adult0.019608
glasgow0.019608
oslo0.019608
age 30-400.019608
age 13-140.019608
finland0.019608
LOWER IN infant0.019608
united kingdom0.019608
age < 3 years0.019608
LOWER IN finland0.019608
LOWER IN age < 1 year0.019608
rectum0.019608
kingdom of denmark0.019608
africa0.019608
age 5-13 years0.019608
bolivia0.019608
chuquisaca department0.019608
LOWER IN city0.009804
LOWER IN systemic lupus erythematosus0.009804
ulcerative colitis0.009804
jordan0.009804
LOWER IN insomnia0.009804
age 17-290.009804
denver0.009804
italy0.009804
high bmi0.009804
obesity0.009804
LOWER IN egypt0.009804
american diet0.009804
azerbaijan0.009804
right colon0.009804
third trimester0.009804
LOWER IN inflammatory bowel disease0.009804
lima0.009804
shantytown0.009804
state of oklahoma0.009804
mild0.009804
LOWER IN severe0.009804
first trimester0.009804
tibetan plateau0.009804
tibet autonomous region0.009804
gangcha region0.009804
LOWER IN gannan tibetan autonomous prefecture0.009804
left colon0.009804
irritable bowel syndrome0.009804
hunter gatherer0.009804
amerindian0.009804
venezuela0.009804
LOWER IN obsolete_juvenile stage0.009804
parkinson's disease0.009804
myanmar0.009804
thailand0.009804
karen0.009804
cron diet0.009804
Exp. ID User ID Description Date Region Flag Sequences
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 38
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
566amnon high in control compared to insomnia in homo sapiens feces china adult 2019-11-24v4No1 / 71
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 103
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 112
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 125
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 128
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 197
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org