Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGACGTGAAACTCCGGGGCTCAACTCCGGAACTGCGTTGGAAACTGTAAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.516590
adult0.415356
feces0.413937
child0.235294
united states of america0.187633
obsolete_juvenile stage0.165289
control0.134483
city0.116861
LOWER IN crohn's disease0.114286
india0.096618
rural community0.092879
china0.084034
infant0.079365
small village0.078947
LOWER IN ulcerative colitis0.077670
jiangsu province0.071429
age 8-120.058824
age 130.058824
biopsy0.057971
female0.057143
kingdom of norway0.055556
juvenile organism0.055556
duodenum0.054795
age0.052174
state of california0.048193
heterosexual0.040404
msw0.040404
age<17 years0.040000
commonwealth of pennsylvania0.040000
nanchang city prefecture0.040000
age 3-60.040000
age 30-500.040000
new delhi0.040000
toronto0.040000
glasgow0.040000
oslo0.040000
age 30-400.040000
age 13-140.040000
LOWER IN age < 1 year0.040000
africa0.040000
chuquisaca department0.040000
LOWER IN infant0.039604
atlanta0.039216
LOWER IN child0.039216
age < 3 years0.039216
kingdom of denmark0.039216
age 5-13 years0.039216
state of michigan0.038835
state of colorado0.038835
biopsy site0.038462
small intestine0.038462
LOWER IN finland0.038462
bolivia0.038462
united kingdom0.038095
rectum0.038095
commonwealth of virginia0.037736
belgium0.036364
finland0.036364
LOWER IN adult0.035398
kingdom of spain0.034483
jordan0.020408
LOWER IN insomnia0.020408
age 17-290.020408
denver0.020408
LOWER IN egypt0.020408
azerbaijan0.020408
LOWER IN inflammatory bowel disease0.020408
lima0.020408
shantytown0.020408
mild0.020408
LOWER IN severe0.020408
gangcha region0.020408
LOWER IN gannan tibetan autonomous prefecture0.020408
irritable bowel syndrome0.020408
myanmar0.020408
thailand0.020408
karen0.020408
cron diet0.020408
LOWER IN india0.020408
physical activity0.020408
LOWER IN little physical activity0.020408
el salvador0.020408
estonia0.020408
LOWER IN age 3-60.020408
age 1-3 years0.020408
spondyloarthritis0.020408
spondylitis0.020408
canada0.020408
atherosclerosis0.020408
age 1-20.020408
LOWER IN age 0-10.020408
bangladesh0.020408
tunapuco0.020408
LOWER IN age 30-500.020408
LOWER IN age 60-790.020408
LOWER IN pancreatitis0.020408
LOWER IN acute pancreatitis0.020408
LOWER IN nepal0.020408
LOWER IN himalayas0.020408
LOWER IN amerindian0.020408
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
LOWER IN crohn's disease0.666667
heterosexual0.666667
msw0.666667
india0.666667
LOWER IN ulcerative colitis0.571429
age<17 years0.500000
jordan0.500000
LOWER IN insomnia0.500000
commonwealth of pennsylvania0.500000
age 17-290.500000
denver0.500000
LOWER IN egypt0.500000
nanchang city prefecture0.500000
azerbaijan0.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
age 30-500.500000
irritable bowel syndrome0.500000
new delhi0.500000
toronto0.500000
glasgow0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
thailand0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
age 130.500000
LOWER IN india0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
el salvador0.500000
estonia0.500000
LOWER IN age 3-60.500000
age 1-3 years0.500000
LOWER IN age < 1 year0.500000
spondyloarthritis0.500000
spondylitis0.500000
canada0.500000
atherosclerosis0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
africa0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sewage0.500000
influent0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
vervet monkey0.500000
sigmoid colon0.500000
children0.500000
age one year0.500000
LOWER IN age one month0.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
age 60-790.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
LOWER IN mouth mucosa0.500000
rural community0.428571
obsolete_juvenile stage0.400000
child0.400000
biopsy0.400000
LOWER IN infant0.400000
adult0.379747
homo sapiens0.352201
atlanta0.333333
LOWER IN systemic lupus erythematosus0.333333
american diet0.333333
LOWER IN child0.333333
state of oklahoma0.333333
tibet autonomous region0.333333
amerindian0.333333
venezuela0.333333
LOWER IN obsolete_juvenile stage0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.968750
feces0.916667
adult0.458333
united states of america0.343750
control0.187500
child0.166667
china0.156250
obsolete_juvenile stage0.104167
city0.072917
LOWER IN crohn's disease0.062500
rural community0.052083
india0.052083
infant0.052083
small village0.041667
LOWER IN ulcerative colitis0.041667
female0.041667
jiangsu province0.041667
state of california0.031250
biopsy0.031250
age 8-120.031250
duodenum0.031250
kingdom of norway0.031250
age 130.031250
juvenile organism0.031250
age0.031250
age<17 years0.020833
atlanta0.020833
commonwealth of virginia0.020833
commonwealth of pennsylvania0.020833
state of michigan0.020833
state of colorado0.020833
heterosexual0.020833
msw0.020833
nanchang city prefecture0.020833
biopsy site0.020833
LOWER IN child0.020833
belgium0.020833
age 3-60.020833
age 30-500.020833
kingdom of spain0.020833
new delhi0.020833
small intestine0.020833
toronto0.020833
LOWER IN adult0.020833
glasgow0.020833
oslo0.020833
age 30-400.020833
age 13-140.020833
finland0.020833
LOWER IN infant0.020833
united kingdom0.020833
age < 3 years0.020833
LOWER IN finland0.020833
LOWER IN age < 1 year0.020833
rectum0.020833
kingdom of denmark0.020833
africa0.020833
age 5-13 years0.020833
bolivia0.020833
chuquisaca department0.020833
LOWER IN city0.010417
LOWER IN systemic lupus erythematosus0.010417
ulcerative colitis0.010417
jordan0.010417
LOWER IN insomnia0.010417
age 17-290.010417
denver0.010417
italy0.010417
high bmi0.010417
obesity0.010417
LOWER IN egypt0.010417
american diet0.010417
germany0.010417
azerbaijan0.010417
right colon0.010417
LOWER IN inflammatory bowel disease0.010417
lima0.010417
shantytown0.010417
state of oklahoma0.010417
mild0.010417
LOWER IN severe0.010417
tibetan plateau0.010417
tibet autonomous region0.010417
gangcha region0.010417
LOWER IN gannan tibetan autonomous prefecture0.010417
left colon0.010417
irritable bowel syndrome0.010417
hunter gatherer0.010417
amerindian0.010417
venezuela0.010417
LOWER IN obsolete_juvenile stage0.010417
myanmar0.010417
thailand0.010417
karen0.010417
cron diet0.010417
caloric restriction diet0.010417
LOWER IN india0.010417
physical activity0.010417
LOWER IN little physical activity0.010417
LOWER IN age 1 year0.010417
Exp. ID User ID Description Date Region Flag Sequences
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 21
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 38
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 39
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 56
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 67
566amnon high in control compared to insomnia in adult china feces homo sapiens 2019-11-24v4No1 / 71
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 75
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 76
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 79
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 82
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 82
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 83
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 84
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 85
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 86
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 89
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 93
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 93
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 95
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 97
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 97
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 106
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 107
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 107
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 108
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 109
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 109
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 110
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 110
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 110
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 114
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 115
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 117
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 118
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 120
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 121
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 121
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 125
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 125
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 130
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 132
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 134
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 136
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 137
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 138
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 138
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 145
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 145
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 150
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 155
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 157
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 162
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 168
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 169
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 170
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 173
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 180
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 183
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 197
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 208
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 216
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
566amnoncommon adult, homo sapiens, china, feces2019-11-24v4No1 / 221
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 227
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 248
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 253
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 263
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 263
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 279
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 295
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 319
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 328
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 422
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 440
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 446
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 457
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 459
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 545
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 557
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 606
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 752

Problems / suggestions? Please email info AT dbbact DOT org