Search result for sequence:
TACGTAGGGGGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCTTTGCAAGTCTGACGTGAAACTCCGGGGCTCAACTCCGGAACTGCGTTGGAAACTGTAAGGCTTGAGTGCCGGAGAGGTAAGCGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
homo sapiens0.461365
feces0.385557
adult0.363703
child0.213018
united states of america0.181032
obsolete_juvenile stage0.144928
control0.125130
city0.100287
LOWER IN crohn's disease0.098361
rural community0.093750
india0.082136
female0.075922
infant0.068337
small village0.067606
state of california0.066815
LOWER IN ulcerative colitis0.066667
china0.063830
jiangsu province0.058394
israel0.055944
germany0.055944
heterosexual0.050847
msw0.050847
age 8-120.050420
age 130.050420
amsterdam0.049180
biopsy0.049180
kingdom of the netherlands0.048000
kingdom of norway0.048000
duodenum0.046875
juvenile organism0.046875
age0.044776
age<17 years0.034188
food allergy0.034188
age 4-10 years0.034188
age 3-60.034188
new delhi0.034188
glasgow0.034188
oslo0.034188
age 30-400.034188
age 13-140.034188
chuquisaca department0.034188
LOWER IN infant0.033898
LOWER IN age &lt; 1 year0.033898
atlanta0.033613
nanchang city prefecture0.033613
age 30-500.033613
toronto0.033613
age < 3 years0.033613
africa0.033613
age 5-13 years0.033613
state of michigan0.033333
state of colorado0.033333
LOWER IN child0.033333
kingdom of denmark0.033333
state of new york0.033058
biopsy site0.033058
small intestine0.033058
LOWER IN finland0.033058
bolivia0.033058
commonwealth of virginia0.032520
united kingdom0.032520
rectum0.032520
commonwealth of pennsylvania0.031496
finland0.031496
belgium0.031008
pregnancy0.030534
LOWER IN adult0.030075
kingdom of spain0.027586
ulcerative colitis0.017391
jordan0.017391
LOWER IN insomnia0.017391
age 17-290.017391
sesame allergy0.017391
denver0.017391
LOWER IN egypt0.017391
milk allergy0.017391
azerbaijan0.017391
third trimester0.017391
LOWER IN inflammatory bowel disease0.017391
lima0.017391
shantytown0.017391
mild0.017391
LOWER IN severe0.017391
gangcha region0.017391
LOWER IN gannan tibetan autonomous prefecture0.017391
irritable bowel syndrome0.017391
parkinson's disease0.017391
myanmar0.017391
karen0.017391
cron diet0.017391
rem sleep behavior disorder0.017391
LOWER IN cuba0.017391
LOWER IN india0.017391
physical activity0.017391
LOWER IN little physical activity0.017391
el salvador0.017391
estonia0.017391
LOWER IN age 3-60.017391
nouabale-ndoki national park0.017391
republic of congo0.017391
Fraction of dbbact annotations with this term covered by the query
TermScore
small village0.750000
LOWER IN crohn&#39;s disease0.666667
heterosexual0.600000
msw0.600000
LOWER IN ulcerative colitis0.571429
india0.571429
age<17 years0.500000
ulcerative colitis0.500000
jordan0.500000
LOWER IN insomnia0.500000
age 17-290.500000
sesame allergy0.500000
food allergy0.500000
age 4-10 years0.500000
denver0.500000
LOWER IN egypt0.500000
milk allergy0.500000
azerbaijan0.500000
third trimester0.500000
age 8-120.500000
LOWER IN inflammatory bowel disease0.500000
age 3-60.500000
lima0.500000
shantytown0.500000
mild0.500000
LOWER IN severe0.500000
gangcha region0.500000
LOWER IN gannan tibetan autonomous prefecture0.500000
irritable bowel syndrome0.500000
new delhi0.500000
glasgow0.500000
parkinson's disease0.500000
oslo0.500000
age 30-400.500000
myanmar0.500000
karen0.500000
cron diet0.500000
age 13-140.500000
rem sleep behavior disorder0.500000
LOWER IN cuba0.500000
age 130.500000
LOWER IN india0.500000
physical activity0.500000
LOWER IN little physical activity0.500000
el salvador0.500000
estonia0.500000
LOWER IN age 3-60.500000
nouabale-ndoki national park0.500000
republic of congo0.500000
spondyloarthritis0.500000
spondylitis0.500000
atherosclerosis0.500000
poland0.500000
age 1-20.500000
LOWER IN age 0-10.500000
bangladesh0.500000
tunapuco0.500000
LOWER IN age 30-500.500000
LOWER IN age 60-790.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
LOWER IN nepal0.500000
LOWER IN himalayas0.500000
LOWER IN amerindian0.500000
LOWER IN hunter gatherer0.500000
LOWER IN venezuela0.500000
sewage0.500000
LOWER IN effluent0.500000
chlorocebus aethiops0.500000
vervet monkey0.500000
sigmoid colon0.500000
children0.500000
age one year0.500000
LOWER IN age one month0.500000
central african republic0.500000
LOWER IN madagascar0.500000
bangui0.500000
LOWER IN antananarivo0.500000
chuquisaca department0.500000
LOWER IN arm0.500000
LOWER IN forearm0.500000
age 60-790.500000
age >940.500000
LOWER IN age 19-240.500000
LOWER IN soldiers0.500000
rural community0.400000
obsolete_juvenile stage0.400000
LOWER IN infant0.400000
LOWER IN age &lt; 1 year0.400000
atlanta0.333333
amsterdam0.333333
american diet0.333333
nanchang city prefecture0.333333
biopsy0.333333
state of oklahoma0.333333
first trimester0.333333
tibet autonomous region0.333333
age 30-500.333333
amerindian0.333333
venezuela0.333333
Fraction of annotations for the query sequences containing the term
TermScore
homo sapiens0.973451
feces0.929204
adult0.486726
united states of america0.336283
control0.176991
child0.159292
china0.132743
obsolete_juvenile stage0.088496
city0.061947
female0.061947
rural community0.053097
LOWER IN crohn&#39;s disease0.053097
state of california0.044248
india0.044248
infant0.044248
small village0.035398
LOWER IN ulcerative colitis0.035398
israel0.035398
germany0.035398
jiangsu province0.035398
heterosexual0.026549
msw0.026549
amsterdam0.026549
kingdom of the netherlands0.026549
biopsy0.026549
age 8-120.026549
duodenum0.026549
kingdom of norway0.026549
age 130.026549
juvenile organism0.026549
age0.026549
age<17 years0.017699
atlanta0.017699
commonwealth of virginia0.017699
state of new york0.017699
commonwealth of pennsylvania0.017699
state of michigan0.017699
food allergy0.017699
age 4-10 years0.017699
state of colorado0.017699
nanchang city prefecture0.017699
biopsy site0.017699
pregnancy0.017699
LOWER IN child0.017699
belgium0.017699
age 3-60.017699
age 30-500.017699
kingdom of spain0.017699
new delhi0.017699
small intestine0.017699
toronto0.017699
LOWER IN adult0.017699
glasgow0.017699
oslo0.017699
age 30-400.017699
age 13-140.017699
finland0.017699
LOWER IN infant0.017699
united kingdom0.017699
age < 3 years0.017699
LOWER IN finland0.017699
LOWER IN age &lt; 1 year0.017699
rectum0.017699
kingdom of denmark0.017699
africa0.017699
age 5-13 years0.017699
bolivia0.017699
chuquisaca department0.017699
LOWER IN city0.008850
LOWER IN systemic lupus erythematosus0.008850
ulcerative colitis0.008850
jordan0.008850
LOWER IN insomnia0.008850
LOWER IN body mass index0.008850
LOWER IN high bmi0.008850
low bmi0.008850
age 17-290.008850
sesame allergy0.008850
south korea0.008850
denver0.008850
italy0.008850
high bmi0.008850
obesity0.008850
LOWER IN egypt0.008850
american diet0.008850
milk allergy0.008850
azerbaijan0.008850
right colon0.008850
third trimester0.008850
LOWER IN inflammatory bowel disease0.008850
lima0.008850
shantytown0.008850
state of oklahoma0.008850
mild0.008850
LOWER IN severe0.008850
first trimester0.008850
tibetan plateau0.008850
tibet autonomous region0.008850
gangcha region0.008850
LOWER IN gannan tibetan autonomous prefecture0.008850
Exp. ID User ID Description Date Region Flag Sequences
290amnon high in rural community small village compared to city in homo sapiens feces adult china 2018-02-01v4No1 / 20
297amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens feces obsolete_juvenile stage age<17 years united states of america atlanta child 2018-02-12v4No1 / 37
368amnon high in control compared to systemic lupus erythematosus in feces homo sapiens commonwealth of virginia united states of america adult 2018-09-03v4No1 / 38
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, ulcerative colitis2018-11-06v4No1 / 55
365amnoncommon homo sapiens, feces, jordan, child, obsolete_juvenile stage2018-08-30v4No1 / 66
566amnon high in control compared to insomnia in homo sapiens feces china adult 2019-11-24v4No1 / 70
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in state of new york united states of america homo sapiens adult feces )2020-09-09v4No1 / 74
395amnoncommon homo sapiens, feces, united states of america, commonwealth of pennsylvania, control2018-11-14v4No1 / 74
484amnoncommon feces, united states of america, adult, state of michigan, age 17-29, homo sapiens2019-02-13v4No1 / 75
401amnoncommon homo sapiens, feces, united states of america, adult2018-11-18v4No1 / 78
695amnoncommon sesame allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 80
643amnoncommon adult, south korea, feces, homo sapiens2020-08-30v4No1 / 80
344amnoncommon in feces of heterosexuals (common homo sapiens, feces, united states of america, state of colorado, denver, heterosexual, msw)2018-05-31v4No1 / 81
368amnoncommon feces, homo sapiens, commonwealth of virginia, united states of america, adult, control2018-09-03v4No1 / 81
502amnoncommon homo sapiens, feces, adult, united states of america, control2019-03-12v4No1 / 82
393amnoncommon homo sapiens, feces, united states of america, adult, state of colorado, city, msw, heterosexual2018-11-06v4No1 / 83
247amnoncommon homo sapiens, italy, feces, high bmi, obesity2017-11-21v4No1 / 84
394amnoncommon homo sapiens, feces, adult, united states of america, state of california, control2018-11-06v4No1 / 85
62amnon high in united states of america compared to egypt in homo sapiens feces obsolete_juvenile stage child 2017-02-13v4No1 / 87
629amnoncommon female, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 88
293amnoncommon homo sapiens, feces, adult, united states of america, american diet2018-02-07v4No1 / 88
303amnoncommon homo sapiens, feces, germany, adult2018-03-12v4No1 / 92
428amnoncommon homo sapiens, adult, feces, nanchang city prefecture, control, china2018-12-09v4No1 / 92
695amnoncommon milk allergy, food allergy, age 4-10 years, child, israel, feces, homo sapiens2028-03-27v4No1 / 94
400amnoncommon in feces of european american females (common homo sapiens, feces, united states of america, adult, female)2018-11-18v4No1 / 94
629amnoncommon msw, heterosexual, amsterdam, kingdom of the netherlands, adult, feces, homo sapiens2020-05-31v4No1 / 96
365amnoncommon homo sapiens, feces, child, obsolete_juvenile stage, azerbaijan2018-08-30v4No1 / 96
409amnoncommon homo sapiens, united states of america, adult, biopsy, biopsy site, right colon2018-11-22v4No1 / 96
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, third trimester2020-01-14v4No1 / 102
284amnoncommon homo sapiens, adult, female, feces, state of california2018-01-27v4No1 / 104
683amnoncommon state of california, united states of america, adult, feces, homo sapiens2028-03-04v4No1 / 105
438amnoncommon homo sapiens, feces, jiangsu province, child, age 8-12, china2018-12-30v4No1 / 105
395amnonlower in kids with ibd compared to healthy donors ( high in control compared to child ulcerative colitis inflammatory bowel disease crohn's disease in homo sapiens feces united states of america commonwealth of pennsylvania )2018-11-13v4No1 / 106
398amnoncommon in feces of healthy adults from belgium (common homo sapiens, feces, belgium, adult, control)2018-11-15v4No1 / 106
409amnoncommon homo sapiens, united states of america, feces, adult2018-11-22v4No1 / 107
289amnoncommon homo sapiens, feces, adult, united states of america, state of michigan2018-02-01v4No1 / 108
438amnoncommon homo sapiens, feces, jiangsu province, child, age 3-6, china2018-12-30v4No1 / 108
53amnoncommon homo sapiens, feces, lima, city, shantytown2017-01-21v4No1 / 109
276amnoncommon feces, homo sapiens, united states of america, city, state of oklahoma, adult2018-01-22v4No1 / 109
410amnonlower in severe treatment naive ulcerative colitis patients compared to mild ( high in mild compared to severe ulcerative colitis in homo sapiens child united states of america feces )2018-11-22v4No1 / 109
580amnoncommon homo sapiens, feces, israel, adult, female, pregnancy, first trimester2020-01-14v4No1 / 111
380amnon high in gangcha region compared to gannan tibetan autonomous prefecture in feces homo sapiens adult tibetan plateau tibet autonomous region 2018-10-03v4No1 / 113
438amnoncommon feces, homo sapiens, jiangsu province, age 30-50, adult, china2018-12-30v4No1 / 114
239amnoncommon homo sapiens, feces, united states of america2017-11-08v4No1 / 116
409amnoncommon homo sapiens, united states of america, adult, left colon, biopsy, biopsy site2018-11-22v4No1 / 117
294amnoncommon homo sapiens, feces, adult, kingdom of spain, irritable bowel syndrome2018-02-09v4No1 / 119
352amnoncommon in duodenal biopsies (common homo sapiens, new delhi, duodenum, small intestine, india)2018-07-30v4No1 / 120
371amnoncommon feces, homo sapiens, hunter gatherer, amerindian, venezuela2018-09-06v4No1 / 120
10amnonnegatively correlated with age (6-35) ( high in child compared to adult in homo sapiens feces toronto )2016-10-27v4No1 / 124
73amnonhigh in healthy adult controls compared to children with Crohn's disease ( high in control adult compared to obsolete_juvenile stage child crohn's disease in glasgow feces homo sapiens )2017-02-26v4No1 / 124
607amnoncommon germany, homo sapiens, feces, parkinson's disease2020-04-19v4No1 / 124
607amnoncommon germany, homo sapiens, feces, control2020-04-19v4No1 / 127
330amnoncommon homo sapiens, feces, kingdom of norway, oslo, adult, age 30-402018-05-13v4No1 / 129
400amnoncommon in karen (burma) females from thailand (common feces, homo sapiens, female, adult, myanmar, thailand, karen)2018-11-18v4No1 / 131
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 133
438amnoncommon homo sapiens, feces, jiangsu province, age 13-14, china2018-12-30v4No1 / 133
607amnoncommon germany, homo sapiens, feces, rem sleep behavior disorder2020-04-19v4No1 / 133
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 135
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, finland2017-09-12v4No1 / 135
294amnoncommon in non-IBS healthy controls (common homo sapiens, feces, adult, kingdom of spain, control)2018-02-09v4No1 / 136
10amnoncommon homo sapiens, feces, toronto2016-10-27v4No1 / 137
197amnon high in finland compared to india in feces homo sapiens obsolete_juvenile stage age 13 juvenile organism 2017-09-12v4No1 / 137
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 139
629amnoncommon amsterdam, kingdom of the netherlands, adult, homosexual, msm, feces, homo sapiens2020-05-31v4No1 / 140
132amnoncommon homo sapiens, feces, united states of america2017-04-16v4No1 / 144
330amnon high in adult age 30-40 compared to infant age 1 year in homo sapiens feces kingdom of norway oslo 2018-05-13v4No1 / 144
73amnoncommon homo sapiens, feces, adult, glasgow2017-02-26v4No1 / 149
53amnoncommon homo sapiens, feces, city, el salvador, small village2017-01-21v4No1 / 154
122amnoncommon homo sapiens, feces, united kingdom2017-04-13v4No1 / 156
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 156
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 161
297amnoncommon homo sapiens, feces, obsolete_juvenile stage, age<17 years, united states of america, atlanta, child2018-02-12v4No1 / 161
438amnonlower in kindergarten compared to primary and middle school kids ( high in age 8-12 age 13-14 compared to age 3-6 in homo sapiens feces china )2018-12-30v4No1 / 167
194amnon high in feces compared to colon ileum in homo sapiens kingdom of norway 2017-09-07v4No1 / 168
197amnoncommon feces, homo sapiens, obsolete_juvenile stage, age 13, juvenile organism, india2017-09-12v4No1 / 169
241amnonlower in babies age <1 year compared to age 1-3 years ( high in age age 1-3 years compared to age < 1 year in homo sapiens feces infant )2017-11-13v4No1 / 172
399amnon high in control compared to ulcerative colitis in feces united states of america homo sapiens 2018-11-16v4No1 / 179
319amnoncommon homo sapiens, feces, united states of america, state of texas2018-04-18v4No1 / 182
620amnoncommon village, rural community, homo sapiens, nouabale-ndoki national park, republic of congo, feces2020-05-06v4No1 / 196
312amnoncommon feces, homo sapiens, french republic, adult, spondyloarthritis, spondylitis2018-04-09v4No1 / 196
120amnoncommon homo sapiens, feces, brazil2017-04-12v4No1 / 207
455amnoncommon homo sapiens, feces, adult, canada, atherosclerosis2019-01-10v4No1 / 215
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 217
566amnoncommon feces, china, homo sapiens, adult2019-11-24v4No1 / 220
310amnoncommon homo sapiens, feces, female, adult, poland, rectum2018-04-07v4No1 / 226
398amnon high in control compared to crohn's disease in homo sapiens feces belgium 2018-11-15v4No1 / 247
45amnonlower in young babies compared to 2 year olds in india ( high in age age 1-2 compared to age 0-1 in homo sapiens feces infant india )2016-12-19v4No1 / 252
121amnonlow in diarrhea compared to recovery period ( high in control compared to diarrhea in homo sapiens feces bangladesh adult )2017-04-13v4No1 / 262
276amnoncommon feces, homo sapiens, peru, small village, tunapuco, rural community, adult2018-01-22v4No1 / 262
438amnon high in age 3-6 age 8-12 child compared to adult age 30-50 age 60-79 in homo sapiens feces china 2018-12-30v4No1 / 278
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 287
477amnon high in united states of america compared to nepal himalayas rural community in homo sapiens feces adult 2019-01-28v4No1 / 294
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to metronidazole neomycin vancomycin antibiotic in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 301
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 305
650amnon high in asian compared to caucasian european in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 316
299amnon high in mouth neoplasm cancer compared to control in saliva adult homo sapiens china 2018-02-27v4No1 / 318
467amnoncommon homo sapiens, feces, kingdom of denmark, metabolic syndrome, adult2019-01-14v4No1 / 327
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 372
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 386
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 389
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 415
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 416
62amnoncommon homo sapiens, feces, obsolete_juvenile stage, child, egypt2017-02-13v4No1 / 421
53amnonlower in wastewater plant effluent compared to influent and sewer in south america ( high in sewage influent compared to effluent in south america wastewater treatment plant city )2017-01-21v4No1 / 439
274amnoncommon monkey, ethiopia, feces, chlorocebus aethiops, vervet monkey2018-01-16v4No1 / 445
339amnon high in adult compared to infant age < 1 year in homo sapiens feces india 2018-05-24v4No1 / 456
19amnonhigher in controls compared to CD in biopsies ( high in control compared to crohn's disease in rectum terminal ileum sigmoid colon caecum colon biopsy children homo sapiens united states of america )2016-11-14v4No1 / 458
352amnon high in small intestine duodenum compared to feces in homo sapiens new delhi india 2018-07-30v4No1 / 544
273amnon high in age age one year compared to age one month in feces homo sapiens kingdom of denmark infant 2018-01-14v4No1 / 556
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 563
517amnon high in feces compared to skin arm forearm in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 605
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age 30-50 age 60-79 age >94 compared to age 19-24 soldiers in homo sapiens feces china )2018-12-30v4No1 / 616
517amnon high in feces compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 751

Problems / suggestions? Please email info AT dbbact DOT org