Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGAAAAATAAGTCTAATGTGAAAGCCCTCGGCTTAACCGAGGAACTGCATCGGAAACTGTTTTTCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG
common ontology terms
term enrichment score
TermScore
pig0.394952
sus scrofa0.386856
gallus gallus0.268585
chicken0.249486
macaca mulatta0.223464
caecum0.176384
research facility0.153221
ileum0.150268
farm0.149024
monkey0.135182
zoological garden0.131479
china0.128167
italy0.116505
captive0.110599
puerto rico0.107784
rhesus macaque0.107784
feces0.105981
united kingdom0.105820
female organism0.105510
adult0.099379
cayo santiago0.096970
indian rhesus macaque0.096970
canada0.095791
broiler chicken0.095427
female0.094648
pregnancy0.088398
adult organism0.088398
cobb broiler chicken0.085890
age 35 days0.082353
duodenum0.080153
age 30 days0.075949
belgium0.074534
jejunum0.073171
vagina0.071006
province of ontario0.069364
epidermis0.069364
state of michigan0.068182
skin0.067511
homo sapiens0.063777
united states of america0.063239
dairy0.062893
tonsil0.061920
male0.057307
river0.055866
ismailia0.050955
jinzhou city prefecture0.050955
age 10-15 years0.050955
age 8 months0.050955
cecal content0.050314
obsolete_juvenile stage0.050251
age 25-45 years0.049689
male organism0.048485
jiangxi province0.048485
LOWER IN caecum0.048193
ovis aries0.047847
state of tennessee0.047337
rectal swab0.047337
egypt0.046243
commonwealth of pennsylvania0.043243
colon0.041885
sweden0.039801
biofilm0.039801
fish feed0.039088
age 1 month0.039088
lincoln park zoo0.038710
cocoa mass0.038710
theobroma cacao0.038710
state of tabasco0.038710
time 5 days0.038710
fermented cocoa mass0.038710
province of alberta0.038710
suckling0.038710
preweaned0.038710
age 2-4 weeks0.038710
intestinal contents0.038710
LOWER IN state of california0.038710
fujian province0.038710
jiulong river0.038710
papio anubis0.037975
chicago0.037975
age 1 week0.037267
depth (soil) 50cm0.037267
age 6 weeks0.036585
hawaii0.036585
small intestine0.035928
state of oregon0.035928
city0.035714
LOWER IN wild0.035608
rumen0.035503
mexico0.035294
rectum0.033520
fresh water0.028302
non-pregnant0.026144
red pepper sauce0.026144
chest0.026144
torso0.026144
jinhua city prefecture0.026144
jinhua pig0.026144
pregnancy trimester 20.026144
salmonella enterica subsp. enterica serovar typhimurium0.026144
Fraction of dbbact annotations with this term covered by the query
TermScore
sus scrofa0.875000
pig0.875000
age 30 days0.666667
fish feed0.666667
macaca mulatta0.666667
age 1 month0.666667
dairy0.500000
cobb broiler chicken0.500000
ismailia0.500000
non-pregnant0.500000
jinzhou city prefecture0.500000
red pepper sauce0.500000
lincoln park zoo0.500000
chest0.500000
torso0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
pregnancy trimester 20.500000
cocoa mass0.500000
theobroma cacao0.500000
state of tabasco0.500000
time 5 days0.500000
fermented cocoa mass0.500000
salmonella enterica subsp. enterica serovar typhimurium0.500000
salmonellosis0.500000
province of alberta0.500000
age 10-15 years0.500000
cayo santiago0.500000
puerto rico0.500000
indian rhesus macaque0.500000
after hcst0.500000
hematopoietic stem cell transplant0.500000
LOWER IN before hsct0.500000
late pregnancy0.500000
sus scrofa domesticus0.500000
upper leg skin0.500000
inner thigh0.500000
ascending colon0.500000
early pregnancy0.500000
age 5 weeks0.500000
belgium0.500000
mustela putorius furo0.500000
ferret0.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
intestinal contents0.500000
age 60 weeks0.500000
indonesia0.500000
municipality of yogyakarta0.500000
fifth decade human stage0.500000
gut content0.500000
12c0.500000
cold environment0.500000
LOWER IN induced periodontitis0.500000
age 12-23 years0.500000
panthera tigris0.500000
tiger0.500000
LOWER IN high wellfare feed0.500000
upper eyelid0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
pygoscelis antarcticus0.500000
chinstrap penguin0.500000
palmar part of manus0.500000
palm of hand0.500000
milan0.500000
age 1-3 weeks0.500000
waste water0.500000
xinxiang city prefecture0.500000
LOWER IN 2-5 year-old child stage0.500000
age > 1 year0.500000
age 6-10 weeks0.500000
27cds diet0.500000
55cs diet0.500000
LOWER IN corn diet0.500000
LOWER IN 40mdgs diet0.500000
age 12-19 weeks0.500000
age 6 months0.500000
rhesus macaque0.500000
sparus aurata0.500000
ria formosa0.500000
open water pond0.500000
seabream0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
LOWER IN state of california0.500000
nida basin0.500000
herbivorous beetle0.500000
crioceris duodecimpunctata0.500000
LOWER IN dicentrarchus labrax0.500000
LOWER IN seabass0.500000
age 8 months0.500000
anterior naris0.500000
age 15-20 weeks0.500000
feral0.500000
duroc pig0.500000
age 140 days0.500000
cloud0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.375839
research facility0.295302
pig0.255034
sus scrofa0.248322
united states of america0.221477
china0.194631
gallus gallus0.187919
chicken0.174497
adult0.161074
homo sapiens0.134228
caecum0.134228
macaca mulatta0.134228
farm0.120805
ileum0.093960
zoological garden0.087248
monkey0.087248
italy0.080537
female0.080537
captive0.080537
canada0.073826
male0.067114
united kingdom0.067114
puerto rico0.060403
female organism0.060403
rhesus macaque0.060403
skin0.053691
pregnancy0.053691
broiler chicken0.053691
adult organism0.053691
cayo santiago0.053691
indian rhesus macaque0.053691
duodenum0.046980
cobb broiler chicken0.046980
age 35 days0.046980
age 30 days0.040268
jejunum0.040268
vagina0.040268
province of ontario0.040268
epidermis0.040268
belgium0.040268
state of michigan0.040268
dairy0.033557
ovis aries0.033557
obsolete_juvenile stage0.033557
tonsil0.033557
river0.033557
egypt0.026846
ismailia0.026846
age 25-45 years0.026846
jinzhou city prefecture0.026846
state of tennessee0.026846
male organism0.026846
cecal content0.026846
sweden0.026846
age 10-15 years0.026846
rectal swab0.026846
colon0.026846
commonwealth of pennsylvania0.026846
jiangxi province0.026846
LOWER IN caecum0.026846
age 8 months0.026846
biofilm0.026846
papio anubis0.020134
small intestine0.020134
chicago0.020134
lincoln park zoo0.020134
mexico0.020134
cocoa mass0.020134
theobroma cacao0.020134
state of tabasco0.020134
time 5 days0.020134
fermented cocoa mass0.020134
age 6 weeks0.020134
province of alberta0.020134
fish feed0.020134
rectum0.020134
hawaii0.020134
age 1 month0.020134
suckling0.020134
preweaned0.020134
age 2-4 weeks0.020134
intestinal contents0.020134
age 1 week0.020134
control0.020134
city0.020134
rumen0.020134
state of oregon0.020134
LOWER IN state of california0.020134
water0.020134
fresh water0.020134
fujian province0.020134
depth (soil) 50cm0.020134
jiulong river0.020134
LOWER IN wild0.020134
olive baboon0.013423
non-pregnant0.013423
capsicum annuum0.013423
sichuan province0.013423
red pepper sauce0.013423
food (fermented)0.013423
Exp. ID User ID Description Date Region Flag Sequences
363amnondominant dairy, duodenum, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 3
411amnondominant feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 8
744amnondominant research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 9
256amnondominant duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 10
724amnondominant homo sapiens, female, vagina, adult, egypt, ismailia, age 25-45 years, non-pregnant2021-01-03v3No1 / 10
780amnondominant research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 10
547amnondominant capsicum annuum, sichuan province, red pepper sauce, food (fermented), china2019-08-15v4No1 / 11
620amnondominant feces, united states of america, zoological garden, gorilla gorilla, chicago, lincoln park zoo2020-05-06v4No1 / 11
717amnondominant homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 11
424amnondominant feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 12
724amnondominant homo sapiens, female, pregnancy, vagina, adult, egypt, ismailia, age 25-45 years, pregnancy trimester 22021-01-03v3No1 / 12
789amnondominant in traditionally harvested cocoa pulp after fementation (dominant mexico, cocoa mass, theobroma cacao, state of tabasco, time 5 days, fermented cocoa mass)2021-06-01v3No1 / 12
840amnondominant farm, ileum, gallus gallus, broiler chicken, china2021-11-08v3No1 / 12
399amnondominant feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 13
673amnondominant research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 13
785amnondominant research facility, ileum, sus scrofa, state of iowa, pig, age 9 weeks2021-05-16v4No1 / 13
604amnondominant research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 13
313amnonhigh freq. in fishfeed (dominant sweden, fish feed)2018-04-10v4No1 / 14
770amnondominant feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 14
470amnondominant feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 15
568amnondominant feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 15
655amnon high in after hcst hematopoietic stem cell transplant compared to before hsct in feces homo sapiens italy 2020-09-13v3No1 / 15
363amnondominant dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 16
816amnondominant feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, late pregnancy2021-07-04v4No1 / 16
666amnondominant feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 16
717amnondominant homo sapiens, skin, adult, canada, province of ontario, upper leg skin, epidermis, inner thigh2028-05-22v3No1 / 16
673amnondominant research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 17
816amnondominant feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, early pregnancy2021-07-04v4No1 / 17
724amnoncommon homo sapiens, female, vagina, adult, egypt, ismailia, age 25-45 years, non-pregnant2021-01-03v3No1 / 17
776amnondominant research facility, caecum, gallus gallus, hawaii, chicken, captive, broiler chicken, age 5 weeks2021-04-25v3No1 / 17
700amnondominant feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 18
724amnoncommon homo sapiens, female, pregnancy, vagina, adult, egypt, ismailia, age 25-45 years, pregnancy trimester 22021-01-03v3No1 / 18
744amnondominant research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 18
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
521amnonhigh freq. in pre-weaned pigs (dominant feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 20
666amnondominant feces, canis lupus familiaris, italy, dog2020-09-25v3No1 / 20
805amnon high in nicotine dependence smoker cigarette smoking compared to non-smoker in homo sapiens sputum adult united kingdom city of london 2021-06-18v3No1 / 20
818amnondominant research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 20
399amnondominant feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 21
744amnondominant research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 21
568amnondominant feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 23
717amnon high in female female organism compared to male male organism in homo sapiens skin adult canada province of ontario upper leg skin epidermis inner thigh 2028-05-22v3No1 / 23
738amnondominant caecum, gallus gallus, age 1 week, chicken, united kingdom2021-01-30v3No1 / 23
723amnondominant homo sapiens, female, vagina, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 24
673amnoncommon control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v4No1 / 25
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 25
785amnoncommon research facility, ileum, sus scrofa, state of iowa, pig, age 9 weeks2021-05-16v4No1 / 26
313amnoncommon in rainbow trout gut content grown in 12C water (common digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, gut content, 12c, cold environment)2018-04-10v4No1 / 31
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in research facility dentition adult macaca mulatta puerto rico subgingival plaque monkey age 12-23 years )2019-08-01v4No1 / 33
789amnoncommon in traditionally harvested cocoa pulp after fementation (common mexico, cocoa mass, theobroma cacao, state of tabasco, time 5 days, fermented cocoa mass)2021-06-01v3No1 / 35
744amnoncommon research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 38
389amnoncommon united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 41
666amnoncommon feces, italy, panthera tigris, tiger2020-09-25v3No1 / 43
738amnon high in standard feed compared to high wellfare feed in caecum gallus gallus age 1 week chicken united kingdom 2021-01-30v3No1 / 43
789amnonlow in unfemented compared to fermented cocoa mass ( high in time 5 days fermented cocoa mass compared to time 0 in mexico cocoa mass theobroma cacao state of tabasco )2021-06-01v3No1 / 43
818amnoncommon research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 45
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, upper eyelid, epidermis2028-05-22v3No1 / 47
547amnoncommon capsicum annuum, sichuan province, red pepper sauce, food (fermented), china2019-08-15v4No1 / 49
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout gut content )2018-04-10v4No1 / 55
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 56
812amnoncommon feces, zoological garden, captive, china, pygoscelis antarcticus, chinstrap penguin2021-06-22v3No1 / 56
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, palmar part of manus, epidermis, palm of hand2028-05-22v3No1 / 57
770amnoncommon oral cavity, mouth mucosa, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 59
700amnon high in colon compared to caecum in control research facility sus scrofa belgium pig age 2 months 2028-04-01v3No1 / 59
726amnoncommon homo sapiens, tongue, adult, italy, dermal layer of tongue, milan2021-01-03v3No1 / 63
738amnoncommon caecum, gallus gallus, age 1 week, chicken, united kingdom2021-01-30v3No1 / 64
840amnoncommon farm, ileum, gallus gallus, broiler chicken, china2021-11-08v3No1 / 67
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
770amnoncommon oral cavity, mouth mucosa, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 68
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
389amnoncommon united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 72
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v4No1 / 80
513amnoncommon city, waste water, hospital, xinxiang city prefecture, china2019-03-25v4No1 / 86
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to child 2-5 year-old child stage in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
363amnoncommon dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 94
363amnon high in rectum caecum colon compared to ruminant reticulum omasum rumen in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in caecum sus scrofa pig united kingdom )2017-11-26v4No1 / 103
770amnoncommon macaca mulatta, age > 1 year, penis, male organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 110
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 112
261amnondiet dependent in cow rumen ( high in diet 27cds diet 55cs diet compared to corn diet 40mdgs diet in united states of america rumen bos taurus state of nebraska cow )2017-12-10v4No1 / 113
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 114
744amnoncommon research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 114
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, age 6 months, captive, rhesus macaque2020-09-27v4No1 / 117
744amnon high in ileum compared to caecum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 121
782amnon high in gill compared to skin in fish farm portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 132
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in farm caecum tibet autonomous region cecal content china 2018-04-10v4No1 / 136
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 140
255amnoncommon in fish feed (common united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 141
744amnoncommon research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 141
780amnon high in small intestine duodenum jejunum compared to caecum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 153
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
700amnoncommon feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 164
770amnoncommon vagina, macaca mulatta, age > 1 year, female organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 169
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 170
782amnon high in sparus aurata seabream compared to dicentrarchus labrax seabass in fish farm gill portuguese republic ria formosa open water pond 2021-05-06v4No1 / 174
671amnon high in age 8 months compared to female adult in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 182
604amnoncommon research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 185
567amnon high in pair of nares anterior naris compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
389amnon high in age 1-3 weeks compared to age 4 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 189
776amnoncommon caecum, gallus gallus, hawaii, chicken, wild, age 15-20 weeks, feral2021-04-25v3No1 / 191
738amnoncommon caecum, gallus gallus, chicken, age 30 days, united kingdom2021-01-30v3No1 / 202
666amnoncommon feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 223
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 232
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
688amnon high in female female organism compared to male male organism in feces research facility sus scrofa nanchang city prefecture pig china duroc pig age 140 days 2028-03-09v4No1 / 239
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 252
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn, cloud)2017-11-22v4No1 / 267
568amnoncommon feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 272
770amnoncommon feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 280
696amnon high in georissa georissa similis compared to alycaeus jagori in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 282
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
411amnoncommon feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 292
780amnoncommon research facility, caecum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 294
363amnoncommon dairy, ruminant reticulum, omasum, rumen, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 302
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 304
666amnoncommon feces, sus scrofa, italy, wild boar2020-09-25v3No1 / 305
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, early pregnancy2021-07-04v4No1 / 313
399amnoncommon feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 319
568amnoncommon feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 320
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, late pregnancy2021-07-04v4No1 / 340
776amnoncommon research facility, caecum, gallus gallus, hawaii, chicken, captive, broiler chicken, age 5 weeks2021-04-25v3No1 / 343
254amnoncommon river, water, fresh water, fujian province, depth (soil) 50cm, jiulong river, china2017-11-23v4No1 / 347
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth (soil) 50cm jiulong river china )2017-11-23v4No1 / 356
671amnoncommon feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 356
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chicago, chimpanzee, lincoln park zoo2020-05-06v4No1 / 358
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in feces papio zambia monkey baboon 2018-11-23v4No1 / 364
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, chicago, lincoln park zoo2020-05-06v4No1 / 384
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
770amnoncommon feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 396
314amnoncommon farm, caecum, sus scrofa, tibet autonomous region, pig, cecal content, china2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 404
424amnoncommon feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 452
470amnoncommon feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 457
128amnoncommon city, dense settlement biome, leaf, belgium, ivy, hedera hibernica2017-04-14v4No1 / 461
787amnoncommon in high grain diet induced subacute acidosis (common research facility, rumen, ruminal fluid, acidosis, capra hircus, china, shanxi province, goat, dairy goat, subacute rumen acidosis)2021-05-23v3No1 / 463
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486
256amnoncommon caecum, left colon, right colon, sus scrofa, pig, united kingdom2017-11-26v4No1 / 490
671amnon high in state of oregon compared to state of california in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 534
696amnon high in georissa georissa similis compared to opisthostoma concinnum plectostoma concinnum in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 576
254amnon high in summer wet season compared to winter autumn dry season in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 581
671amnon high in age 8 months compared to age 6 months 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park in feces chimpanzee 2020-05-06v4No1 / 964
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to wild republic of congo nouabale-ndoki national park in feces gorilla gorilla gorilla 2020-05-06v4No1 / 1019
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic, biofilm)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain, biofilm)2017-11-22v4No1 / 1181

Problems / suggestions? Please email info AT dbbact DOT org