Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGAAAAATAAGTCTAATGTGAAAGCCCTCGGCTTAACCGAGGAACTGCATCGGAAACTGTTTTTCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG
common ontology terms
term enrichment score
TermScore
sus scrofa0.456954
pig0.456954
macaca mulatta0.266667
monkey0.238532
zoological garden0.210526
rhesus macaque0.204545
caecum0.200000
farm0.171920
state of michigan0.131868
canada0.129032
age 30 days0.125000
dairy0.125000
tonsil0.121212
captive0.112500
age 8 months0.102564
ileum0.102564
river0.100000
china0.089267
duodenum0.088889
state of tennessee0.088889
united kingdom0.086957
research facility0.085284
ovis aries0.083333
obsolete_juvenile stage0.083333
fish feed0.080537
lincoln park zoo0.078947
province of alberta0.078947
colon0.078947
LOWER IN state of california0.078947
jiulong river0.078947
fujian province0.078947
belgium0.077922
papio anubis0.075949
chicago0.075949
depth 0.5m0.075949
italy0.074074
jejunum0.073171
male organism0.073171
adult0.071146
age 6 weeks0.070588
LOWER IN wild0.070588
sweden0.070175
united states of america0.068286
state of oregon0.068182
city0.067416
female0.065934
feces0.065283
male0.061856
rectum0.060000
red pepper sauce0.054054
jinhua city prefecture0.054054
jinhua pig0.054054
salmonellosis0.054054
salmonella enterica subsp. enterica serovar typhimurium0.054054
gut content0.054054
cold environment0.054054
age 1-3 weeks0.054054
LOWER IN nouabale-ndoki national park0.054054
LOWER IN republic of congo0.054054
biofilm0.054054
olive baboon0.052632
capsicum annuum0.052632
province of quebec0.052632
macaque0.052632
tibet autonomous region0.052632
rainbow trout0.051282
oncorhynchus mykiss0.051282
pan troglodytes0.051282
chimpanzee0.051282
gorilla gorilla0.050000
cecal content0.050000
sichuan province0.047619
rumen0.047619
fresh water0.047244
food (fermented)0.046512
pregnancy0.045455
fish0.040816
skin0.040404
kingdom of spain0.040000
digestive system0.031746
homo sapiens0.028470
ascending colon0.027778
mustela putorius furo0.027778
ferret0.027778
12c0.027778
age 12-23 years0.027778
LOWER IN induced periodontitis0.027778
temp 12c0.027778
LOWER IN warm temperature habitat0.027778
LOWER IN temp 18c0.027778
waste water0.027778
xinxiang city prefecture0.027778
intestinal contents0.027778
age 6-10 weeks0.027778
27cds diet0.027778
55cs diet0.027778
LOWER IN corn diet0.027778
LOWER IN 40mdgs diet0.027778
age 12-19 weeks0.027778
LOWER IN tibetan pig0.027778
Fraction of dbbact annotations with this term covered by the query
TermScore
caecum0.800000
sus scrofa0.750000
pig0.750000
canada0.666667
fish feed0.666667
macaca mulatta0.600000
age 30 days0.500000
dairy0.500000
lincoln park zoo0.500000
red pepper sauce0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
salmonellosis0.500000
salmonella enterica subsp. enterica serovar typhimurium0.500000
province of alberta0.500000
colon0.500000
ascending colon0.500000
mustela putorius furo0.500000
ferret0.500000
gut content0.500000
12c0.500000
cold environment0.500000
age 12-23 years0.500000
LOWER IN induced periodontitis0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
age 1-3 weeks0.500000
waste water0.500000
xinxiang city prefecture0.500000
intestinal contents0.500000
age 6-10 weeks0.500000
27cds diet0.500000
55cs diet0.500000
LOWER IN corn diet0.500000
LOWER IN 40mdgs diet0.500000
age 12-19 weeks0.500000
rhesus macaque0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
LOWER IN state of california0.500000
poland0.500000
nida basin0.500000
herbivorous beetle0.500000
crioceris duodecimpunctata0.500000
age 8 months0.500000
anterior naris0.500000
LOWER IN male organism0.500000
female organism0.500000
age 140 days0.500000
duroc pig0.500000
cloud0.500000
jiulong river0.500000
fujian province0.500000
populated place0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
LOWER IN caecum0.500000
ivy0.500000
hedera ibernica0.500000
age 30-500.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 6 months0.500000
LOWER IN nouabale-ndoki national park0.500000
LOWER IN republic of congo0.500000
LOWER IN pan troglodytes troglodytes0.500000
chuquisaca department0.500000
forearm0.500000
gorilla gorilla gorilla0.500000
biofilm0.500000
epilithic0.500000
belgium0.428571
tonsil0.400000
monkey0.333333
papio anubis0.333333
olive baboon0.333333
chicago0.333333
capsicum annuum0.333333
province of quebec0.333333
macaque0.333333
puerto rico0.333333
nipple0.333333
LOWER IN rumen0.333333
LOWER IN mucosa0.333333
tibet autonomous region0.333333
age 1 month0.333333
beetle0.333333
LOWER IN nasopharynx0.333333
LOWER IN age 4 weeks0.333333
LOWER IN male0.333333
nanchang city prefecture0.333333
ruminant reticulum0.333333
omasum0.333333
depth 0.5m0.333333
dense settlement biome0.333333
Fraction of annotations for the query sequences containing the term
TermScore
feces0.414286
united states of america0.414286
sus scrofa0.328571
pig0.328571
research facility0.242857
monkey0.185714
zoological garden0.171429
china0.171429
farm0.171429
macaca mulatta0.171429
adult0.128571
rhesus macaque0.128571
captive0.128571
caecum0.114286
state of michigan0.085714
ovis aries0.071429
age 30 days0.071429
obsolete_juvenile stage0.071429
italy0.071429
dairy0.071429
ileum0.071429
united kingdom0.071429
canada0.071429
female0.071429
tonsil0.071429
river0.071429
duodenum0.057143
state of tennessee0.057143
sweden0.057143
homo sapiens0.057143
age 8 months0.057143
papio anubis0.042857
jejunum0.042857
lincoln park zoo0.042857
chicago0.042857
age 6 weeks0.042857
male0.042857
male organism0.042857
province of alberta0.042857
fish feed0.042857
colon0.042857
rectum0.042857
belgium0.042857
city0.042857
LOWER IN state of california0.042857
state of oregon0.042857
water0.042857
fresh water0.042857
depth 0.5m0.042857
jiulong river0.042857
fujian province0.042857
LOWER IN wild0.042857
olive baboon0.028571
gorilla gorilla0.028571
red pepper sauce0.028571
capsicum annuum0.028571
sichuan province0.028571
food (fermented)0.028571
jinhua city prefecture0.028571
jinhua pig0.028571
salmonellosis0.028571
salmonella enterica subsp. enterica serovar typhimurium0.028571
province of quebec0.028571
pregnancy0.028571
macaque0.028571
control0.028571
fish0.028571
rainbow trout0.028571
oncorhynchus mykiss0.028571
digestive system0.028571
gut content0.028571
cold environment0.028571
skin0.028571
age 1-3 weeks0.028571
rumen0.028571
cecal content0.028571
tibet autonomous region0.028571
pan troglodytes0.028571
chimpanzee0.028571
LOWER IN nouabale-ndoki national park0.028571
LOWER IN republic of congo0.028571
kingdom of spain0.028571
biofilm0.028571
ascending colon0.014286
mustela putorius furo0.014286
ferret0.014286
12c0.014286
subgingival plaque0.014286
dentition0.014286
puerto rico0.014286
age 12-23 years0.014286
LOWER IN induced periodontitis0.014286
LOWER IN periodontitis0.014286
temp 12c0.014286
LOWER IN warm temperature habitat0.014286
LOWER IN temp 18c0.014286
LOWER IN control0.014286
crohn's disease0.014286
nipple0.014286
waste water0.014286
Exp. ID User ID Description Date Region Flag Sequences
363amnondominant ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, duodenum2018-08-29v4No1 / 2
411amnondominant feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 7
256amnondominant sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 9
620amnondominant lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 10
547amnondominant red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 10
424amnondominant sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 11
399amnondominant feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 12
673amnondominant salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 13
313amnonhigh freq. in fishfeed (dominant sweden, fish feed)2018-04-10v4No1 / 13
470amnondominant sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 14
363amnondominant ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 15
673amnondominant ascending colon, caecum, salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 17
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 19
399amnondominant feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 20
673amnoncommon control, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 25
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 30
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 32
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 40
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 48
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 54
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 67
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 70
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 79
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 85
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 93
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 100
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 102
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 111
261amnondiet dependent in cow rumen ( high in diet 27cds diet 55cs diet compared to corn diet 40mdgs diet in bos taurus cow rumen united states of america state of nebraska )2017-12-10v4No1 / 112
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 113
671amnoncommon age 6 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 117
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 135
671amnon high in state of oregon compared to state of california in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 140
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 140
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 156
671amnoncommon age 3 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 170
671amnon high in age 8 months compared to female adult in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 182
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 185
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 188
671amnon high in state of oregon compared to state of california in age 8 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 232
688amnon high in female female organism compared to male organism male in nanchang city prefecture feces age 140 days research facility duroc pig china pig sus scrofa 2028-03-09v4No1 / 239
671amnoncommon age 8 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 252
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 266
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 291
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, rumen, ruminant reticulum, omasum2018-08-29v4No1 / 301
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 318
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 346
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 355
671amnoncommon female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 356
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 357
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 363
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 379
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 383
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 386
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 401
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 403
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 451
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 456
128amnoncommon belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 460
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 485
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 489
671amnon high in state of oregon compared to state of california in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 534
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 580
671amnon high in age 8 months compared to age 6 months age 3 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 963
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1013
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1018
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1080
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1180

Problems / suggestions? Please email info AT dbbact DOT org