Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGAAAAATAAGTCTAATGTGAAAGCCCTCGGCTTAACCGAGGAACTGCATCGGAAACTGTTTTTCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG
common ontology terms
term enrichment score
TermScore
sus scrofa0.553015
pig0.553015
farm0.297767
zoological garden0.217054
state of michigan0.184615
tonsil0.183486
age 30 days0.175439
dairy0.175439
caecum0.149466
ovis aries0.138889
river0.138889
duodenum0.126984
italy0.121951
state of tennessee0.119403
fish feed0.116505
papio anubis0.113208
depth 0.5m0.113208
jiulong river0.113208
fujian province0.113208
sweden0.112676
jejunum0.107143
obsolete_juvenile stage0.103093
united kingdom0.103093
china0.100897
city0.098361
monkey0.088235
ileum0.088235
rectum0.081081
olive baboon0.078431
jinhua city prefecture0.078431
jinhua pig0.078431
macaca mulatta0.078431
macaque0.078431
gut content0.078431
cold temperature habitat0.078431
age 1-3 weeks0.078431
cecal content0.078431
province of quebec0.075472
belgium0.075472
tibet autonomous region0.075472
rainbow trout0.072727
oncorhynchus mykiss0.072727
fresh water0.072289
rumen0.071429
pregnancy0.070175
biofilm0.070175
adult0.069606
united states of america0.066741
kingdom of spain0.065574
colon0.063158
feces0.062780
fish0.061538
canada0.059701
digestive system0.041237
water0.041096
mustela putorius furo0.040816
ferret0.040816
12c0.040816
temp 12c0.040816
LOWER IN warm temperature habitat0.040816
LOWER IN temp 18c0.040816
intestinal contents0.040816
age 6-10 weeks0.040816
27cds diet0.040816
55cs diet0.040816
LOWER IN corn diet0.040816
LOWER IN 40mdgs diet0.040816
age 12-19 weeks0.040816
LOWER IN tibetan pig0.040816
LOWER IN tibetan swine0.040816
beetle0.040816
poland0.040816
cloud0.040816
populated place0.040816
zambia0.040816
baboon0.040816
papio0.040816
LOWER IN papio kindae0.040816
LOWER IN papio ursinus0.040816
ivy0.040816
hedera ibernica0.040816
age 30-500.040816
age 60-790.040816
LOWER IN age 3-60.040816
LOWER IN age 8-120.040816
epilithic0.040816
nipple0.040000
LOWER IN rumen0.040000
LOWER IN mucosa0.040000
state of nebraska0.040000
whole body0.040000
LOWER IN age 4 weeks0.040000
ruminant reticulum0.040000
omasum0.040000
dense settlement biome0.040000
LOWER IN fall0.040000
LOWER IN ruminant reticulum0.039216
LOWER IN omasum0.039216
cow0.039216
state of minnesota0.039216
Fraction of dbbact annotations with this term covered by the query
TermScore
sus scrofa0.875000
pig0.875000
fish feed0.666667
tonsil0.666667
age 30 days0.500000
dairy0.500000
papio anubis0.500000
olive baboon0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
mustela putorius furo0.500000
ferret0.500000
macaca mulatta0.500000
macaque0.500000
gut content0.500000
cold temperature habitat0.500000
12c0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
age 1-3 weeks0.500000
intestinal contents0.500000
age 6-10 weeks0.500000
27cds diet0.500000
55cs diet0.500000
LOWER IN corn diet0.500000
LOWER IN 40mdgs diet0.500000
age 12-19 weeks0.500000
cecal content0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
beetle0.500000
poland0.500000
cloud0.500000
depth 0.5m0.500000
jiulong river0.500000
fujian province0.500000
populated place0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
ivy0.500000
hedera ibernica0.500000
age 30-500.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
epilithic0.500000
zoological garden0.400000
farm0.357143
jejunum0.333333
province of quebec0.333333
state of michigan0.333333
belgium0.333333
nipple0.333333
LOWER IN rumen0.333333
LOWER IN mucosa0.333333
state of nebraska0.333333
tibet autonomous region0.333333
whole body0.333333
LOWER IN age 4 weeks0.333333
ruminant reticulum0.333333
omasum0.333333
dense settlement biome0.333333
LOWER IN fall0.333333
duodenum0.250000
rainbow trout0.250000
oncorhynchus mykiss0.250000
LOWER IN ruminant reticulum0.250000
LOWER IN omasum0.250000
cow0.250000
state of minnesota0.250000
upstream0.250000
LOWER IN downstream0.250000
LOWER IN right colon0.250000
LOWER IN left colon0.250000
right colon0.250000
left colon0.250000
rock0.250000
rumen0.222222
city0.214286
ovis aries0.200000
state of tennessee0.200000
pregnancy0.200000
hospital0.200000
french republic0.200000
fall0.200000
river0.200000
LOWER IN child0.200000
biofilm0.200000
sand0.200000
sweden0.166667
plant0.166667
LOWER IN wild0.166667
wet season0.166667
LOWER IN dry season0.166667
caecum0.150000
italy0.142857
Fraction of annotations for the query sequences containing the term
TermScore
sus scrofa0.404255
pig0.404255
united states of america0.319149
feces0.297872
farm0.255319
china0.191489
zoological garden0.148936
caecum0.148936
state of michigan0.127660
ovis aries0.106383
age 30 days0.106383
obsolete_juvenile stage0.106383
italy0.106383
dairy0.106383
united kingdom0.106383
adult0.106383
tonsil0.106383
river0.106383
duodenum0.085106
state of tennessee0.085106
sweden0.085106
monkey0.063830
papio anubis0.063830
jejunum0.063830
ileum0.063830
fish feed0.063830
colon0.063830
rectum0.063830
research facility0.063830
city0.063830
water0.063830
fresh water0.063830
depth 0.5m0.063830
jiulong river0.063830
fujian province0.063830
olive baboon0.042553
jinhua city prefecture0.042553
jinhua pig0.042553
canada0.042553
province of quebec0.042553
female0.042553
pregnancy0.042553
macaca mulatta0.042553
macaque0.042553
fish0.042553
rainbow trout0.042553
oncorhynchus mykiss0.042553
digestive system0.042553
gut content0.042553
cold temperature habitat0.042553
homo sapiens0.042553
belgium0.042553
age 1-3 weeks0.042553
rumen0.042553
cecal content0.042553
tibet autonomous region0.042553
kingdom of spain0.042553
biofilm0.042553
mustela putorius furo0.021277
ferret0.021277
12c0.021277
temp 12c0.021277
LOWER IN warm temperature habitat0.021277
LOWER IN temp 18c0.021277
crohn's disease0.021277
LOWER IN control0.021277
skin0.021277
nipple0.021277
waste water0.021277
hospital0.021277
xinxiang city prefecture0.021277
LOWER IN rumen0.021277
LOWER IN ruminant reticulum0.021277
LOWER IN omasum0.021277
LOWER IN mucosa0.021277
intestinal contents0.021277
age 6-10 weeks0.021277
bos taurus0.021277
cow0.021277
state of nebraska0.021277
diet0.021277
27cds diet0.021277
55cs diet0.021277
LOWER IN corn diet0.021277
LOWER IN 40mdgs diet0.021277
age 12-19 weeks0.021277
LOWER IN tibetan pig0.021277
LOWER IN tibetan swine0.021277
state of minnesota0.021277
crioceris duodecimpunctata0.021277
herbivorous beetle0.021277
nida basin0.021277
plant0.021277
beetle0.021277
whole body0.021277
poland0.021277
LOWER IN age 4 weeks0.021277
cloud0.021277
french republic0.021277
air0.021277
Exp. ID User ID Description Date Sequences
363amnonhighfreq ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, duodenum2018-08-291 / 3
411amnonhighfreq feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-231 / 8
256amnonhighfreq sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-261 / 10
424amnonhighfreq sus scrofa, pig, jinhua city prefecture, china, jinhua pig, feces, farm2018-12-061 / 12
399amnonhighfreq feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-161 / 13
313amnonhigh freq. in fishfeed (highfreq sweden, fish feed)2018-04-101 / 14
470amnonhighfreq sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-141 / 15
363amnonhighfreq ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-291 / 16
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-161 / 20
399amnonhighfreq feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-161 / 21
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, cold temperature habitat, 12c)2018-04-101 / 31
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-041 / 41
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in cold temperature habitat temp 12c compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-101 / 55
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-151 / 68
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-101 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-041 / 72
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-041 / 80
513amnoncommon china, waste water, hospital, city, xinxiang city prefecture2019-03-251 / 86
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-291 / 94
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-291 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig united kingdom caecum )2017-11-261 / 103
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-031 / 112
261amnondiet dependent in cow rumen ( high in diet 27cds diet 55cs diet compared to corn diet 40mdgs diet in bos taurus cow rumen united states of america state of nebraska )2017-12-101 / 113
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-031 / 114
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content china tibet autonomous region farm 2018-04-101 / 136
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-241 / 141
515amnoncommon crioceris duodecimpunctata, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-181 / 157
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-041 / 189
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, fall)2017-11-221 / 267
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-231 / 292
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, rumen, ruminant reticulum, omasum2018-08-291 / 302
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-161 / 319
254amnoncommon river, china, water, fresh water, depth 0.5m, jiulong river, fujian province2017-11-231 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river china water fresh water depth 0.5m jiulong river fujian province )2017-11-231 / 356
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-231 / 364
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-261 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-261 / 387
314amnoncommon caecum, cecal content, china, tibet autonomous region, farm, sus scrofa, pig2018-04-101 / 402
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-161 / 404
424amnoncommon sus scrofa, pig, jinhua city prefecture, china, jinhua pig, feces, farm2018-12-061 / 452
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-141 / 457
128amnoncommon belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-141 / 461
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-301 / 486
256amnoncommon sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-261 / 490
254amnon high in summer wet season compared to fall winter dry season in river china water fresh water depth 0.5m jiulong river fujian province 2017-11-231 / 581
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-221 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-221 / 1181

Problems / suggestions? Please email info AT dbbact DOT org