Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGAAAAATAAGTCTAATGTGAAAGCCCTCGGCTTAACCGAGGAACTGCATCGGAAACTGTTTTTCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG
common ontology terms
term enrichment score
TermScore
sus scrofa0.503788
pig0.503788
farm0.231214
zoological garden0.204380
tonsil0.170940
state of michigan0.166667
age 30 days0.163934
dairy0.163934
caecum0.140000
ovis aries0.123457
river0.123457
duodenum0.119403
monkey0.119403
state of tennessee0.112676
fish feed0.108108
macaca mulatta0.108108
china0.106366
papio anubis0.105263
jiulong river0.105263
fujian province0.105263
italy0.104167
united kingdom0.104167
jejunum0.100000
depth 0.5m0.100000
obsolete_juvenile stage0.099010
sweden0.096386
city0.088235
ileum0.080000
rectum0.076923
olive baboon0.072727
red pepper sauce0.072727
jinhua city prefecture0.072727
jinhua pig0.072727
macaque0.072727
gut content0.072727
cold temperature habitat0.072727
age 1-3 weeks0.072727
cecal content0.072727
adult0.072072
capsicum annuum0.070175
province of quebec0.070175
belgium0.070175
tibet autonomous region0.070175
rainbow trout0.067797
oncorhynchus mykiss0.067797
rumen0.064516
sichuan province0.063492
pregnancy0.063492
biofilm0.063492
fermented food product0.059701
united states of america0.059289
colon0.057143
fresh water0.057143
kingdom of spain0.056338
feces0.054830
fish0.054795
skin0.053333
canada0.050633
research facility0.044362
digestive system0.038095
mustela putorius furo0.037736
ferret0.037736
12c0.037736
LOWER IN induced periodontitis0.037736
age 12-23 years0.037736
temp 12c0.037736
LOWER IN warm temperature habitat0.037736
LOWER IN temp 18c0.037736
waste water0.037736
xinxiang city prefecture0.037736
intestinal contents0.037736
age 6-10 weeks0.037736
27cds diet0.037736
55cs diet0.037736
LOWER IN corn diet0.037736
LOWER IN 40mdgs diet0.037736
age 12-19 weeks0.037736
LOWER IN tibetan pig0.037736
LOWER IN tibetan swine0.037736
crioceris duodecimpunctata0.037736
herbivorous beetle0.037736
nida basin0.037736
cloud0.037736
populated place0.037736
zambia0.037736
baboon0.037736
papio0.037736
LOWER IN papio kindae0.037736
LOWER IN papio ursinus0.037736
ivy0.037736
hedera ibernica0.037736
age 30-500.037736
age 60-790.037736
LOWER IN age 3-60.037736
LOWER IN age 8-120.037736
LOWER IN mouth mucosa0.037736
forearm0.037736
chuquisaca department0.037736
age 5-13 years0.037736
epilithic0.037736
Fraction of dbbact annotations with this term covered by the query
TermScore
sus scrofa0.777778
pig0.777778
fish feed0.666667
macaca mulatta0.666667
tonsil0.666667
age 30 days0.500000
dairy0.500000
papio anubis0.500000
olive baboon0.500000
red pepper sauce0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
mustela putorius furo0.500000
ferret0.500000
macaque0.500000
gut content0.500000
cold temperature habitat0.500000
12c0.500000
LOWER IN induced periodontitis0.500000
age 12-23 years0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
age 1-3 weeks0.500000
waste water0.500000
xinxiang city prefecture0.500000
intestinal contents0.500000
age 6-10 weeks0.500000
27cds diet0.500000
55cs diet0.500000
LOWER IN corn diet0.500000
LOWER IN 40mdgs diet0.500000
age 12-19 weeks0.500000
cecal content0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
crioceris duodecimpunctata0.500000
herbivorous beetle0.500000
nida basin0.500000
cloud0.500000
jiulong river0.500000
fujian province0.500000
populated place0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
ivy0.500000
hedera ibernica0.500000
age 30-500.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN mouth mucosa0.500000
forearm0.500000
chuquisaca department0.500000
age 5-13 years0.500000
epilithic0.500000
zoological garden0.400000
jejunum0.333333
capsicum annuum0.333333
province of quebec0.333333
puerto rico0.333333
belgium0.333333
nipple0.333333
LOWER IN rumen0.333333
LOWER IN mucosa0.333333
state of nebraska0.333333
tibet autonomous region0.333333
beetle0.333333
poland0.333333
LOWER IN age 4 weeks0.333333
ruminant reticulum0.333333
omasum0.333333
depth 0.5m0.333333
dense settlement biome0.333333
LOWER IN fall0.333333
arm0.333333
state of michigan0.285714
duodenum0.250000
monkey0.250000
rainbow trout0.250000
oncorhynchus mykiss0.250000
LOWER IN ruminant reticulum0.250000
LOWER IN omasum0.250000
whole body0.250000
upstream0.250000
LOWER IN downstream0.250000
LOWER IN left colon0.250000
left colon0.250000
bolivia0.250000
farm0.227273
state of tennessee0.200000
state of minnesota0.200000
fall0.200000
LOWER IN right colon0.200000
right colon0.200000
rock0.200000
sand0.200000
Fraction of annotations for the query sequences containing the term
TermScore
sus scrofa0.372549
pig0.372549
united states of america0.294118
feces0.274510
farm0.235294
china0.215686
zoological garden0.137255
caecum0.137255
adult0.117647
state of michigan0.117647
ovis aries0.098039
age 30 days0.098039
obsolete_juvenile stage0.098039
italy0.098039
dairy0.098039
united kingdom0.098039
tonsil0.098039
river0.098039
duodenum0.078431
monkey0.078431
state of tennessee0.078431
sweden0.078431
research facility0.078431
papio anubis0.058824
jejunum0.058824
ileum0.058824
fish feed0.058824
colon0.058824
rectum0.058824
macaca mulatta0.058824
homo sapiens0.058824
city0.058824
water0.058824
fresh water0.058824
depth 0.5m0.058824
jiulong river0.058824
fujian province0.058824
olive baboon0.039216
sichuan province0.039216
capsicum annuum0.039216
red pepper sauce0.039216
fermented food product0.039216
jinhua city prefecture0.039216
jinhua pig0.039216
canada0.039216
province of quebec0.039216
female0.039216
pregnancy0.039216
macaque0.039216
fish0.039216
rainbow trout0.039216
oncorhynchus mykiss0.039216
digestive system0.039216
gut content0.039216
cold temperature habitat0.039216
belgium0.039216
skin0.039216
age 1-3 weeks0.039216
rumen0.039216
cecal content0.039216
tibet autonomous region0.039216
kingdom of spain0.039216
biofilm0.039216
mustela putorius furo0.019608
ferret0.019608
12c0.019608
LOWER IN induced periodontitis0.019608
LOWER IN periodontitis0.019608
control0.019608
age 12-23 years0.019608
puerto rico0.019608
dentition0.019608
subgingival plaque0.019608
temp 12c0.019608
LOWER IN warm temperature habitat0.019608
LOWER IN temp 18c0.019608
crohn's disease0.019608
LOWER IN control0.019608
nipple0.019608
waste water0.019608
hospital0.019608
xinxiang city prefecture0.019608
LOWER IN rumen0.019608
LOWER IN ruminant reticulum0.019608
LOWER IN omasum0.019608
LOWER IN mucosa0.019608
intestinal contents0.019608
age 6-10 weeks0.019608
bos taurus0.019608
cow0.019608
state of nebraska0.019608
diet0.019608
27cds diet0.019608
55cs diet0.019608
LOWER IN corn diet0.019608
LOWER IN 40mdgs diet0.019608
age 12-19 weeks0.019608
LOWER IN tibetan pig0.019608
LOWER IN tibetan swine0.019608
state of minnesota0.019608
Exp. ID User ID Description Date Region Flag Sequences
363amnonhighfreq ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, duodenum2018-08-29v4No1 / 3
411amnonhighfreq feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 8
256amnonhighfreq sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 10
547amnonhighfreq sichuan province, china, capsicum annuum, red pepper sauce, fermented food product2019-08-15v4No1 / 11
424amnonhighfreq sus scrofa, pig, jinhua city prefecture, china, jinhua pig, feces, farm2018-12-06v4No1 / 12
399amnonhighfreq feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 13
313amnonhigh freq. in fishfeed (highfreq sweden, fish feed)2018-04-10v4No1 / 14
470amnonhighfreq sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 15
363amnonhighfreq ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 16
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
399amnonhighfreq feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 21
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, cold temperature habitat, 12c)2018-04-10v4No1 / 31
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in age 12-23 years adult puerto rico research facility macaca mulatta monkey dentition subgingival plaque )2019-08-01v4No1 / 33
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 41
547amnoncommon sichuan province, china, capsicum annuum, red pepper sauce, fermented food product2019-08-15v4No1 / 49
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in cold temperature habitat temp 12c compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 68
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 80
513amnoncommon china, waste water, hospital, city, xinxiang city prefecture2019-03-25v4No1 / 86
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig united kingdom caecum )2017-11-26v4No1 / 103
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
261amnondiet dependent in cow rumen ( high in diet 27cds diet 55cs diet compared to corn diet 40mdgs diet in bos taurus cow rumen united states of america state of nebraska )2017-12-10v4No1 / 113
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content china tibet autonomous region farm 2018-04-10v4No1 / 136
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
515amnoncommon crioceris duodecimpunctata, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-18v4No1 / 157
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 189
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, fall)2017-11-22v4No1 / 267
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, rumen, ruminant reticulum, omasum2018-08-29v4No1 / 302
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
254amnoncommon river, china, water, fresh water, depth 0.5m, jiulong river, fujian province2017-11-23v4No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river china water fresh water depth 0.5m jiulong river fujian province )2017-11-23v4No1 / 356
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
314amnoncommon caecum, cecal content, china, tibet autonomous region, farm, sus scrofa, pig2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
424amnoncommon sus scrofa, pig, jinhua city prefecture, china, jinhua pig, feces, farm2018-12-06v4No1 / 452
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
128amnoncommon belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 461
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
256amnoncommon sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-26v4No1 / 490
254amnon high in summer wet season compared to fall winter dry season in river china water fresh water depth 0.5m jiulong river fujian province 2017-11-23v4No1 / 581
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181

Problems / suggestions? Please email info AT dbbact DOT org