Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGAAAAATAAGTCTAATGTGAAAGCCCTCGGCTTAACCGAGGAACTGCATCGGAAACTGTTTTTCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG
common ontology terms
term enrichment score
TermScore
pig0.399100
sus scrofa0.390943
gallus gallus0.251903
chicken0.251903
macaca mulatta0.225989
caecum0.179730
research facility0.155349
monkey0.136602
farm0.133148
zoological garden0.132822
ileum0.131148
china0.121096
italy0.119403
captive0.111628
puerto rico0.109091
rhesus macaque0.109091
feces0.107687
united kingdom0.106952
female organism0.106762
adult0.101053
canada0.098214
indian rhesus macaque0.098160
cayo santiago0.098160
female0.095400
pregnancy0.089385
adult organism0.089385
cobb broiler chicken0.086957
age 35 days0.083333
duodenum0.081081
age 30 days0.076923
belgium0.075472
jejunum0.074074
province of ontario0.072727
broiler chicken0.072727
vagina0.071856
epidermis0.070175
state of michigan0.068966
skin0.068085
homo sapiens0.064356
united states of america0.064036
dairy0.063694
tonsil0.062696
male0.057637
river0.056497
ismailia0.051613
jinzhou city prefecture0.051613
age 8 months0.051613
cecal content0.050955
obsolete_juvenile stage0.050761
age 25-45 years0.050314
male organism0.049080
age 10-15 years0.049080
jiangxi province0.049080
LOWER IN caecum0.048780
ovis aries0.048309
state of tennessee0.047904
rectal swab0.047904
egypt0.046784
commonwealth of pennsylvania0.043716
colon0.042328
sweden0.040201
fish feed0.039604
lincoln park zoo0.039216
fermented cocoa mass0.039216
time 5 days0.039216
state of tabasco0.039216
cocoa mass0.039216
theobroma cacao0.039216
province of alberta0.039216
preweaned0.039216
age 2-4 weeks0.039216
suckling0.039216
intestinal contents0.039216
LOWER IN state of california0.039216
jiulong river0.039216
fujian province0.039216
age 1 month0.038835
papio anubis0.038462
chicago0.038462
age 1 week0.037736
depth 0.5m0.037736
age 6 weeks0.037037
hawaii0.037037
small intestine0.036364
state of oregon0.036364
city0.036145
LOWER IN wild0.036036
rumen0.035928
mexico0.035714
rectum0.033898
fresh water0.028571
age 30-500.026667
non-pregnant0.026490
red pepper sauce0.026490
chest0.026490
torso0.026490
jinhua city prefecture0.026490
jinhua pig0.026490
pregnancy trimester 20.026490
salmonellosis0.026490
Fraction of dbbact annotations with this term covered by the query
TermScore
sus scrofa0.875000
pig0.875000
age 30 days0.666667
fish feed0.666667
macaca mulatta0.666667
age 30-500.666667
dairy0.500000
cobb broiler chicken0.500000
non-pregnant0.500000
ismailia0.500000
jinzhou city prefecture0.500000
red pepper sauce0.500000
lincoln park zoo0.500000
chest0.500000
torso0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
pregnancy trimester 20.500000
fermented cocoa mass0.500000
time 5 days0.500000
state of tabasco0.500000
cocoa mass0.500000
theobroma cacao0.500000
salmonellosis0.500000
salmonella enterica subsp. enterica serovar typhimurium0.500000
province of alberta0.500000
indian rhesus macaque0.500000
cayo santiago0.500000
puerto rico0.500000
LOWER IN before hsct0.500000
hematopoietic stem cell transplant0.500000
after hcst0.500000
late pregnancy0.500000
sus scrofa domesticus0.500000
upper leg skin0.500000
inner thigh0.500000
ascending colon0.500000
early pregnancy0.500000
age 5 weeks0.500000
belgium0.500000
mustela putorius furo0.500000
ferret0.500000
preweaned0.500000
age 2-4 weeks0.500000
suckling0.500000
intestinal contents0.500000
age 60 weeks0.500000
municipality of yogyakarta0.500000
indonesia0.500000
gut content0.500000
12c0.500000
cold environment0.500000
age 12-23 years0.500000
LOWER IN induced periodontitis0.500000
tiger0.500000
panthera tigris0.500000
LOWER IN high wellfare feed0.500000
upper eyelid0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
chinstrap penguin0.500000
pygoscelis antarcticus0.500000
palm of hand0.500000
palmar part of manus0.500000
milan0.500000
age 1-3 weeks0.500000
waste water0.500000
xinxiang city prefecture0.500000
LOWER IN age 2-4 years0.500000
age 6-10 weeks0.500000
27cds diet0.500000
55cs diet0.500000
LOWER IN corn diet0.500000
LOWER IN 40mdgs diet0.500000
age 12-19 weeks0.500000
rhesus macaque0.500000
sparus aurata0.500000
seabream0.500000
open water pond0.500000
ria formosa0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
LOWER IN state of california0.500000
nida basin0.500000
herbivorous beetle0.500000
crioceris duodecimpunctata0.500000
LOWER IN dicentrarchus labrax0.500000
LOWER IN seabass0.500000
age 8 months0.500000
anterior naris0.500000
feral0.500000
age 15-20 weeks0.500000
age 140 days0.500000
duroc pig0.500000
cloud0.500000
LOWER IN alycaeus jagori0.500000
georissa0.500000
georissa similis0.500000
land snail0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.380952
research facility0.299320
pig0.258503
sus scrofa0.251701
united states of america0.224490
china0.183673
gallus gallus0.176871
chicken0.176871
adult0.163265
homo sapiens0.136054
caecum0.136054
macaca mulatta0.136054
farm0.108844
monkey0.088435
zoological garden0.088435
italy0.081633
ileum0.081633
female0.081633
captive0.081633
canada0.074830
male0.068027
united kingdom0.068027
puerto rico0.061224
female organism0.061224
rhesus macaque0.061224
skin0.054422
pregnancy0.054422
adult organism0.054422
indian rhesus macaque0.054422
cayo santiago0.054422
duodenum0.047619
age 35 days0.047619
cobb broiler chicken0.047619
age 30 days0.040816
jejunum0.040816
vagina0.040816
province of ontario0.040816
epidermis0.040816
broiler chicken0.040816
belgium0.040816
state of michigan0.040816
ovis aries0.034014
obsolete_juvenile stage0.034014
dairy0.034014
tonsil0.034014
river0.034014
age 25-45 years0.027211
ismailia0.027211
egypt0.027211
jinzhou city prefecture0.027211
state of tennessee0.027211
male organism0.027211
cecal content0.027211
sweden0.027211
age 10-15 years0.027211
rectal swab0.027211
colon0.027211
commonwealth of pennsylvania0.027211
jiangxi province0.027211
LOWER IN caecum0.027211
age 8 months0.027211
papio anubis0.020408
small intestine0.020408
lincoln park zoo0.020408
chicago0.020408
fermented cocoa mass0.020408
time 5 days0.020408
state of tabasco0.020408
mexico0.020408
cocoa mass0.020408
theobroma cacao0.020408
age 6 weeks0.020408
province of alberta0.020408
fish feed0.020408
rectum0.020408
hawaii0.020408
age 1 month0.020408
preweaned0.020408
age 2-4 weeks0.020408
suckling0.020408
intestinal contents0.020408
age 1 week0.020408
control0.020408
city0.020408
rumen0.020408
LOWER IN state of california0.020408
state of oregon0.020408
water0.020408
fresh water0.020408
depth 0.5m0.020408
jiulong river0.020408
fujian province0.020408
LOWER IN wild0.020408
olive baboon0.013605
non-pregnant0.013605
red pepper sauce0.013605
capsicum annuum0.013605
sichuan province0.013605
food (fermented)0.013605
gorilla gorilla0.013605
Exp. ID User ID Description Date Region Flag Sequences
363amnondominant ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, duodenum2018-08-29v4No1 / 3
411amnondominant feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 8
744amnondominant ileum, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 9
256amnondominant sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 10
724amnondominant non-pregnant, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 10
780amnondominant jinzhou city prefecture, china, research facility, chicken, gallus gallus, jejunum, duodenum, small intestine2021-04-28v3No1 / 10
547amnondominant red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 11
620amnondominant lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 11
717amnondominant chest, torso, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 11
424amnondominant sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 12
724amnondominant pregnancy trimester 2, pregnancy, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 12
789amnondominant in traditionally harvested cocoa pulp after fementation (dominant fermented cocoa mass, time 5 days, state of tabasco, mexico, cocoa mass, theobroma cacao)2021-06-01v3No1 / 12
399amnondominant feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 13
673amnondominant salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 13
785amnondominant state of iowa, ileum, research facility, age 9 weeks, sus scrofa, pig2021-05-16v4No1 / 13
604amnondominant caecum, chicken, gallus gallus, cecal content, china, research facility2020-04-06v3No1 / 13
313amnonhigh freq. in fishfeed (dominant sweden, fish feed)2018-04-10v4No1 / 14
770amnondominant age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 14
470amnondominant sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 15
568amnondominant gallus gallus, chicken, feces, broiler chicken, viet nam2019-12-08v3No1 / 15
655amnon high in hematopoietic stem cell transplant after hcst compared to before hsct in italy feces homo sapiens 2020-09-13v3No1 / 15
363amnondominant ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 16
816amnondominant late pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 16
666amnondominant pig, sus scrofa domesticus, italy, feces2020-09-25v3No1 / 16
717amnondominant upper leg skin, inner thigh, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 16
673amnondominant caecum, ascending colon, salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 17
816amnondominant early pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 17
724amnoncommon non-pregnant, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 17
776amnondominant caecum, broiler chicken, research facility, captive, age 5 weeks, gallus gallus, chicken, hawaii2021-04-25v3No1 / 17
700amnondominant belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v3No1 / 18
724amnoncommon pregnancy trimester 2, pregnancy, age 25-45 years, ismailia, egypt, adult, female, vagina, homo sapiens2021-01-03v3No1 / 18
744amnondominant cloaca, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 18
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
521amnonhigh freq. in pre-weaned pigs (dominant pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 20
666amnondominant canis lupus familiaris, dog, italy, feces2020-09-25v3No1 / 20
805amnon high in nicotine dependence cigarette smoking smoker compared to non-smoker in sputum city of london united kingdom adult homo sapiens 2021-06-18v3No1 / 20
818amnondominant ileum, intestinal contents, digesta, female organism, research facility, china, age 60 weeks, hen, gallus gallus, chicken2021-07-10v3No1 / 20
399amnondominant feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 21
744amnondominant caecum, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 21
568amnondominant gallus gallus, chicken, feces, broiler chicken, thailand2019-12-08v3No1 / 23
717amnon high in female organism female compared to male organism male in inner thigh upper leg skin adult province of ontario canada epidermis skin homo sapiens 2028-05-22v3No1 / 23
738amnondominant caecum, age 1 week, united kingdom, chicken, gallus gallus2021-01-30v3No1 / 23
723amnondominant municipality of yogyakarta, vagina, adult, female, indonesia, homo sapiens2021-01-02v3No1 / 24
673amnoncommon control, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 25
707amnondominant guangzhou city prefecture, age 30-50, adult, female, china, homo sapiens, feces2028-04-11v3No1 / 25
785amnoncommon state of iowa, ileum, research facility, age 9 weeks, sus scrofa, pig2021-05-16v4No1 / 26
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 31
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 33
789amnoncommon in traditionally harvested cocoa pulp after fementation (common fermented cocoa mass, time 5 days, state of tabasco, mexico, cocoa mass, theobroma cacao)2021-06-01v3No1 / 35
744amnoncommon ileum, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 38
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 41
666amnoncommon tiger, panthera tigris, italy, feces2020-09-25v3No1 / 43
738amnon high in standard feed compared to high wellfare feed in caecum age 1 week united kingdom chicken gallus gallus 2021-01-30v3No1 / 43
789amnonlow in unfemented compared to fermented cocoa mass ( high in time 5 days fermented cocoa mass compared to time 0 in state of tabasco mexico cocoa mass theobroma cacao )2021-06-01v3No1 / 43
818amnoncommon ileum, intestinal contents, digesta, female organism, research facility, china, age 60 weeks, hen, gallus gallus, chicken2021-07-10v3No1 / 45
717amnoncommon upper eyelid, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 47
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 49
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
717amnoncommon chest, torso, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 56
812amnoncommon zoological garden, feces, china, captive, chinstrap penguin, pygoscelis antarcticus2021-06-22v3No1 / 56
717amnoncommon palm of hand, palmar part of manus, adult, province of ontario, canada, epidermis, skin, homo sapiens2028-05-22v3No1 / 57
770amnoncommon age < 1 year, infant, mouth mucosa, oral cavity, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 59
700amnon high in colon compared to caecum in control age 2 months belgium research facility sus scrofa pig 2028-04-01v3No1 / 59
726amnoncommon tongue, dermal layer of tongue, adult, milan, italy, homo sapiens2021-01-03v3No1 / 63
738amnoncommon caecum, age 1 week, united kingdom, chicken, gallus gallus2021-01-30v3No1 / 64
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 68
770amnoncommon age 10-15 years, adult organism, mouth mucosa, oral cavity, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 68
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 80
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 86
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to age 2-4 years child in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 103
770amnoncommon male organism, penis, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 110
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
261amnondiet dependent in cow rumen ( high in diet 27cds diet 55cs diet compared to corn diet 40mdgs diet in bos taurus cow rumen united states of america state of nebraska )2017-12-10v4No1 / 113
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
744amnoncommon cloaca, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 114
671amnoncommon age 6 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 117
744amnon high in ileum compared to caecum in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 121
782amnon high in gill compared to skin in sparus aurata seabream open water pond ria formosa portuguese republic fish farm 2021-05-06v4No1 / 132
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 136
671amnon high in state of oregon compared to state of california in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 140
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
744amnoncommon caecum, research facility, age 35 days, cobb broiler chicken, male, gallus gallus, chicken2021-02-21v3No1 / 141
780amnon high in jejunum duodenum small intestine compared to caecum in jinzhou city prefecture china research facility chicken gallus gallus 2021-04-28v3No1 / 153
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
700amnoncommon belgium, age 1 month, research facility, sus scrofa, pig, feces2028-04-01v3No1 / 164
770amnoncommon vagina, female organism, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 169
521amnoncommon in pre-weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, preweaned, age 2-4 weeks, suckling, china)2019-07-02v3No1 / 169
671amnoncommon age 3 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 170
782amnon high in sparus aurata seabream compared to dicentrarchus labrax seabass in gill open water pond ria formosa portuguese republic fish farm 2021-05-06v4No1 / 174
671amnon high in age 8 months compared to female adult in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 182
604amnoncommon caecum, chicken, gallus gallus, cecal content, china, research facility2020-04-06v3No1 / 185
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 189
776amnoncommon caecum, wild, feral, age 15-20 weeks, gallus gallus, chicken, hawaii2021-04-25v3No1 / 191
738amnoncommon caecum, age 30 days, united kingdom, chicken, gallus gallus2021-01-30v3No1 / 202
666amnoncommon pig, sus scrofa domesticus, italy, feces2020-09-25v3No1 / 223
671amnon high in state of oregon compared to state of california in age 8 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 232
780amnoncommon jinzhou city prefecture, china, research facility, chicken, gallus gallus, jejunum, duodenum, small intestine2021-04-28v3No1 / 232
688amnon high in female female organism compared to male organism male in nanchang city prefecture feces age 140 days research facility duroc pig china pig sus scrofa 2028-03-09v4No1 / 239
671amnoncommon age 8 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 252
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
568amnoncommon gallus gallus, chicken, feces, broiler chicken, viet nam2019-12-08v3No1 / 272
770amnoncommon age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 280
696amnon high in georissa georissa similis compared to alycaeus jagori in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 282
521amnonhigh freq. in weaned pigs (common pig, sus scrofa, feces, farm, jiangxi province, weaned, age 4-7 weeks, corn and soybean diet, china)2019-07-02v3No1 / 288
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
780amnoncommon caecum, jinzhou city prefecture, china, research facility, chicken, gallus gallus2021-04-28v3No1 / 294
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, rumen, ruminant reticulum, omasum2018-08-29v4No1 / 302
770amnon high in age 10-15 years adult organism compared to age < 1 year infant in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 304
666amnoncommon wild boar, sus scrofa, italy, feces2020-09-25v3No1 / 305
816amnoncommon early pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 313
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
568amnoncommon gallus gallus, chicken, feces, broiler chicken, thailand2019-12-08v3No1 / 320
816amnoncommon late pregnancy, commonwealth of pennsylvania, pregnancy, feces, adult organism, research facility, united states of america, female organism, sus scrofa, pig2021-07-04v4No1 / 340
776amnoncommon caecum, broiler chicken, research facility, captive, age 5 weeks, gallus gallus, chicken, hawaii2021-04-25v3No1 / 343
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in pig sus scrofa feces farm jiangxi province china )2019-07-02v3No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
671amnoncommon female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 356
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 358
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 384
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
770amnoncommon age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 396
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
128amnoncommon hedera hibernica, belgium, ivy, leaf, city, dense settlement biome2017-04-14v4No1 / 461
787amnoncommon in high grain diet induced subacute acidosis (common acidosis, subacute rumen acidosis, capra hircus, goat, china, research facility, ruminal fluid, rumen, shanxi province, dairy goat)2021-05-23v3No1 / 463
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
671amnon high in state of oregon compared to state of california in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 534
696amnon high in georissa georissa similis compared to plectostoma concinnum opisthostoma concinnum in land snail stomach gastrointestinal system malaysia state of sabah 2028-03-28v3No1 / 576
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
671amnon high in age 8 months compared to age 6 months age 3 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181

Problems / suggestions? Please email info AT dbbact DOT org