Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGAAAAATAAGTCTAATGTGAAAGCCCTCGGCTTAACCGAGGAACTGCATCGGAAACTGTTTTTCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG
common ontology terms
term enrichment score
TermScore
pig0.371768
sus scrofa0.364020
gallus gallus0.267459
chicken0.250000
macaca mulatta0.238095
caecum0.173639
research facility0.156066
monkey0.144796
farm0.140547
ileum0.137931
china0.133217
zoological garden0.123957
italy0.119157
feces0.109163
puerto rico0.100559
rhesus macaque0.100559
captive0.097959
female organism0.096670
adult0.096396
cayo santiago0.090395
indian rhesus macaque0.090395
adult organism0.088670
broiler chicken0.087751
female0.087546
united kingdom0.082988
pregnancy0.081772
canada0.081181
cobb broiler chicken0.080000
age 35 days0.076923
duodenum0.073171
united states of america0.071693
age 30 days0.070588
belgium0.069364
homo sapiens0.067684
jejunum0.065934
vagina0.065574
epidermis0.064865
skin0.063576
state of michigan0.062827
province of ontario0.060914
dairy0.058480
tonsil0.056022
male0.052493
river0.052356
obsolete_juvenile stage0.047393
ismailia0.047337
jinzhou city prefecture0.047337
age 10-15 years0.047337
hen0.047337
age 8 months0.047337
age 25-45 years0.046243
cecal content0.045714
ovis aries0.044248
state of tennessee0.044199
male organism0.044199
rectal swab0.044199
city0.043716
egypt0.043243
jiangxi province0.043243
commonwealth of pennsylvania0.039801
LOWER IN caecum0.039409
colon0.038647
biofilm0.037559
fish feed0.036254
age 1 month0.036254
lincoln park zoo0.035928
cocoa mass0.035928
theobroma cacao0.035928
state of tabasco0.035928
time 5 days0.035928
fermented cocoa mass0.035928
age 20 months0.035928
suckling0.035928
preweaned0.035928
age 2-4 weeks0.035928
jiulong river0.035928
intestinal contents0.035608
sweden0.035556
papio anubis0.035294
chicago0.035294
province of alberta0.035294
fujian province0.035294
depth (soil) 50cm0.034682
state of washington0.034091
hawaii0.034091
age 1 week0.034091
small intestine0.033520
age 6 weeks0.033520
state of oregon0.033520
juvenile organism0.032967
rumen0.032609
mexico0.031915
rectum0.030928
LOWER IN wild0.030000
infant0.029126
LOWER IN state of california0.024793
milan0.024390
non-pregnant0.024242
red pepper sauce0.024242
torso0.024242
Fraction of dbbact annotations with this term covered by the query
TermScore
sus scrofa0.875000
pig0.875000
macaca mulatta0.714286
age 30 days0.666667
fish feed0.666667
age 1 month0.666667
milan0.666667
dairy0.500000
cobb broiler chicken0.500000
ismailia0.500000
non-pregnant0.500000
jinzhou city prefecture0.500000
red pepper sauce0.500000
lincoln park zoo0.500000
torso0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
pregnancy trimester 20.500000
cocoa mass0.500000
theobroma cacao0.500000
state of tabasco0.500000
time 5 days0.500000
fermented cocoa mass0.500000
salmonella enterica subsp. enterica serovar typhimurium0.500000
age 10-15 years0.500000
cayo santiago0.500000
puerto rico0.500000
indian rhesus macaque0.500000
age 20 months0.500000
after hcst0.500000
hematopoietic stem cell transplant0.500000
LOWER IN before hsct0.500000
late pregnancy0.500000
sus scrofa domesticus0.500000
upper leg skin0.500000
inner thigh0.500000
hen0.500000
jinghong-10.500000
age 42 weeks0.500000
early pregnancy0.500000
belgium0.500000
mustela putorius furo0.500000
ferret0.500000
suckling0.500000
preweaned0.500000
age 2-4 weeks0.500000
age 60 weeks0.500000
indonesia0.500000
municipality of yogyakarta0.500000
fifth decade human stage0.500000
gut content0.500000
12c0.500000
cold environment0.500000
LOWER IN induced periodontitis0.500000
age 12-23 years0.500000
panthera tigris0.500000
tiger0.500000
LOWER IN high wellfare feed0.500000
upper eyelid0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
pygoscelis antarcticus0.500000
chinstrap penguin0.500000
palmar part of manus0.500000
palm of hand0.500000
age 1-3 weeks0.500000
xinxiang city prefecture0.500000
milk powder0.500000
skimmed milk powder0.500000
age > 1 year0.500000
age 6-10 weeks0.500000
27cds diet0.500000
55cs diet0.500000
LOWER IN corn diet0.500000
LOWER IN 40mdgs diet0.500000
age 12-19 weeks0.500000
age 6 months0.500000
rhesus macaque0.500000
sparus aurata0.500000
ria formosa0.500000
open water pond0.500000
seabream0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
nida basin0.500000
herbivorous beetle0.500000
crioceris duodecimpunctata0.500000
LOWER IN dicentrarchus labrax0.500000
LOWER IN seabass0.500000
sigmoid colon brushing0.500000
age 8 months0.500000
anterior naris0.500000
age 15-20 weeks0.500000
feral0.500000
respirable suspended particulate matter0.500000
pm100.500000
duroc pig0.500000
cloud0.500000
georissa0.500000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.378882
research facility0.304348
pig0.236025
united states of america0.229814
sus scrofa0.229814
china0.211180
gallus gallus0.186335
chicken0.173913
adult0.155280
macaca mulatta0.142857
homo sapiens0.136646
caecum0.136646
farm0.111801
monkey0.099379
ileum0.086957
italy0.080745
zoological garden0.080745
female0.074534
captive0.074534
canada0.068323
male0.062112
united kingdom0.062112
adult organism0.055901
puerto rico0.055901
female organism0.055901
rhesus macaque0.055901
skin0.049689
pregnancy0.049689
broiler chicken0.049689
cayo santiago0.049689
indian rhesus macaque0.049689
duodenum0.043478
cobb broiler chicken0.043478
age 35 days0.043478
age 30 days0.037267
jejunum0.037267
vagina0.037267
province of ontario0.037267
epidermis0.037267
belgium0.037267
state of michigan0.037267
dairy0.031056
ovis aries0.031056
obsolete_juvenile stage0.031056
tonsil0.031056
river0.031056
egypt0.024845
ismailia0.024845
age 25-45 years0.024845
jinzhou city prefecture0.024845
state of tennessee0.024845
male organism0.024845
cecal content0.024845
sweden0.024845
age 10-15 years0.024845
rectal swab0.024845
colon0.024845
commonwealth of pennsylvania0.024845
hen0.024845
jiangxi province0.024845
LOWER IN caecum0.024845
city0.024845
age 8 months0.024845
biofilm0.024845
papio anubis0.018634
small intestine0.018634
chicago0.018634
lincoln park zoo0.018634
mexico0.018634
cocoa mass0.018634
theobroma cacao0.018634
state of tabasco0.018634
time 5 days0.018634
fermented cocoa mass0.018634
age 6 weeks0.018634
province of alberta0.018634
fish feed0.018634
juvenile organism0.018634
state of washington0.018634
age 20 months0.018634
rectum0.018634
hawaii0.018634
age 1 month0.018634
suckling0.018634
preweaned0.018634
age 2-4 weeks0.018634
intestinal contents0.018634
age 1 week0.018634
control0.018634
infant0.018634
rumen0.018634
state of oregon0.018634
LOWER IN state of california0.018634
water0.018634
fresh water0.018634
fujian province0.018634
depth (soil) 50cm0.018634
jiulong river0.018634
LOWER IN wild0.018634
olive baboon0.012422
Exp. ID User ID Description Date Region Flag Sequences
363amnondominant dairy, duodenum, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 3
411amnondominant feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 8
744amnondominant research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 9
256amnondominant duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 10
724amnondominant homo sapiens, female, vagina, adult, egypt, ismailia, age 25-45 years, non-pregnant2021-01-03v3No1 / 10
780amnondominant research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 10
547amnondominant capsicum annuum, sichuan province, red pepper sauce, food (fermented), china2019-08-15v4No1 / 11
620amnondominant feces, united states of america, zoological garden, gorilla gorilla, chicago, lincoln park zoo2020-05-06v4No1 / 11
717amnondominant homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 11
424amnondominant feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 12
724amnondominant homo sapiens, female, pregnancy, vagina, adult, egypt, ismailia, age 25-45 years, pregnancy trimester 22021-01-03v3No1 / 12
789amnondominant in traditionally harvested cocoa pulp after fementation (dominant mexico, cocoa mass, theobroma cacao, state of tabasco, time 5 days, fermented cocoa mass)2021-06-01v3No1 / 12
840amnondominant farm, ileum, gallus gallus, broiler chicken, china2021-11-08v3No1 / 12
399amnondominant feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 13
673amnondominant research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 13
785amnondominant research facility, ileum, sus scrofa, state of iowa, pig, age 9 weeks2021-05-16v4No1 / 13
604amnondominant research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 13
313amnonhigh freq. in fishfeed (dominant sweden, fish feed)2018-04-10v4No1 / 14
770amnondominant feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 14
876amnondominant feces, united states of america, research facility, juvenile organism, macaca mulatta, state of washington, monkey, age 20 months2022-03-06v4No1 / 14
470amnondominant feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 15
568amnondominant feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 15
655amnon high in after hcst hematopoietic stem cell transplant compared to before hsct in feces homo sapiens italy 2020-09-13v3No1 / 15
363amnondominant dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 16
816amnondominant feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, late pregnancy2021-07-04v4No1 / 16
666amnondominant feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 16
717amnondominant homo sapiens, skin, adult, canada, province of ontario, upper leg skin, epidermis, inner thigh2028-05-22v3No1 / 16
904amnondominant research facility, caecum, gallus gallus, chicken, china, hen, jinghong-1, age 42 weeks2022-05-18v3No1 / 16
673amnondominant research facility, caecum, sus scrofa, male, canada, pig, age 6 weeks, ascending colon, male organism, salmonella enterica subsp. enterica serovar typhimurium, salmonellosis, province of alberta2020-09-28v4No1 / 17
816amnondominant feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, early pregnancy2021-07-04v4No1 / 17
724amnoncommon homo sapiens, female, vagina, adult, egypt, ismailia, age 25-45 years, non-pregnant2021-01-03v3No1 / 17
776amnondominant research facility, caecum, gallus gallus, hawaii, chicken, captive, broiler chicken, age 5 weeks2021-04-25v3No1 / 17
700amnondominant feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 18
724amnoncommon homo sapiens, female, pregnancy, vagina, adult, egypt, ismailia, age 25-45 years, pregnancy trimester 22021-01-03v3No1 / 18
744amnondominant research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 18
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
521amnonhigh freq. in pre-weaned pigs (dominant feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 20
666amnondominant feces, canis lupus familiaris, italy, dog2020-09-25v3No1 / 20
805amnon high in nicotine dependence smoker cigarette smoking compared to non-smoker in homo sapiens sputum adult united kingdom city of london 2021-06-18v3No1 / 20
818amnondominant research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 20
399amnondominant feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 21
744amnondominant research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 21
568amnondominant feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 23
717amnon high in female female organism compared to male male organism in homo sapiens skin adult canada province of ontario upper leg skin epidermis inner thigh 2028-05-22v3No1 / 23
738amnondominant caecum, gallus gallus, age 1 week, chicken, united kingdom2021-01-30v3No1 / 23
723amnondominant homo sapiens, female, vagina, adult, indonesia, municipality of yogyakarta2021-01-02v3No1 / 24
673amnoncommon control, research facility, ileum, sus scrofa, male, canada, pig, age 6 weeks, male organism, province of alberta2020-09-28v4No1 / 25
707amnondominant feces, homo sapiens, female, adult, guangzhou city prefecture, china, fourth decade human stage, fifth decade human stage2028-04-11v3No1 / 25
785amnoncommon research facility, ileum, sus scrofa, state of iowa, pig, age 9 weeks2021-05-16v4No1 / 26
313amnoncommon in rainbow trout gut content grown in 12C water (common digestive system, research facility, oncorhynchus mykiss, sweden, fish, rainbow trout, gut content, 12c, cold environment)2018-04-10v4No1 / 31
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in research facility dentition adult macaca mulatta puerto rico subgingival plaque monkey age 12-23 years )2019-08-01v4No1 / 33
789amnoncommon in traditionally harvested cocoa pulp after fementation (common mexico, cocoa mass, theobroma cacao, state of tabasco, time 5 days, fermented cocoa mass)2021-06-01v3No1 / 35
744amnoncommon research facility, ileum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 38
389amnoncommon united states of america, farm, tonsil, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 41
666amnoncommon feces, italy, panthera tigris, tiger2020-09-25v3No1 / 43
738amnon high in standard feed compared to high wellfare feed in caecum gallus gallus age 1 week chicken united kingdom 2021-01-30v3No1 / 43
789amnonlow in unfemented compared to fermented cocoa mass ( high in time 5 days fermented cocoa mass compared to time 0 in mexico cocoa mass theobroma cacao state of tabasco )2021-06-01v3No1 / 43
818amnoncommon research facility, ileum, gallus gallus, digesta, chicken, intestinal contents, female organism, china, hen, age 60 weeks2021-07-10v3No1 / 45
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, upper eyelid, epidermis2028-05-22v3No1 / 47
547amnoncommon capsicum annuum, sichuan province, red pepper sauce, food (fermented), china2019-08-15v4No1 / 49
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in digestive system research facility oncorhynchus mykiss sweden fish rainbow trout gut content )2018-04-10v4No1 / 55
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, chest, epidermis, torso2028-05-22v3No1 / 56
812amnoncommon feces, zoological garden, captive, china, pygoscelis antarcticus, chinstrap penguin2021-06-22v3No1 / 56
717amnoncommon homo sapiens, skin, adult, canada, province of ontario, palmar part of manus, epidermis, palm of hand2028-05-22v3No1 / 57
770amnoncommon oral cavity, mouth mucosa, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 59
700amnon high in colon compared to caecum in control research facility sus scrofa belgium pig age 2 months 2028-04-01v3No1 / 59
726amnoncommon homo sapiens, tongue, adult, italy, dermal layer of tongue, milan2021-01-03v3No1 / 63
738amnoncommon caecum, gallus gallus, age 1 week, chicken, united kingdom2021-01-30v3No1 / 64
840amnoncommon farm, ileum, gallus gallus, broiler chicken, china2021-11-08v3No1 / 67
398amnon high in crohn's disease compared to control in feces homo sapiens belgium 2018-11-15v4No1 / 68
770amnoncommon oral cavity, mouth mucosa, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 68
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
389amnoncommon united states of america, farm, nipple, skin, adult, sus scrofa, state of michigan, pig2018-11-04v4No1 / 72
389amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 1-3 weeks2018-11-04v4No1 / 80
513amnoncommon city, waste water, hospital, xinxiang city prefecture, china2019-03-25v4No1 / 86
723amnonlower in children age 2-4 years compared to mothers ( high in adult compared to child 2-5 year-old child stage in feces homo sapiens indonesia municipality of yogyakarta )2021-01-02v3No1 / 87
904amnoncommon research facility, caecum, gallus gallus, chicken, china, hen, jinghong-1, age 42 weeks2022-05-18v3No1 / 89
363amnoncommon dairy, rectum, caecum, colon, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 94
363amnon high in rectum caecum colon compared to ruminant reticulum omasum rumen in dairy ovis aries italy obsolete_juvenile stage age 30 days 2018-08-29v4No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in caecum sus scrofa pig united kingdom )2017-11-26v4No1 / 103
888amnoncommon milk, ireland, cow milk based food product, milk powder, skimmed milk powder2022-03-30v3No1 / 105
770amnoncommon macaca mulatta, age > 1 year, penis, male organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 110
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 6-10 weeks2018-11-03v4No1 / 112
261amnondiet dependent in cow rumen ( high in diet 27cds diet 55cs diet compared to corn diet 40mdgs diet in united states of america rumen bos taurus state of nebraska cow )2017-12-10v4No1 / 113
388amnoncommon united states of america, farm, tonsil, sus scrofa, state of michigan, pig, age 12-19 weeks2018-11-03v4No1 / 114
744amnoncommon research facility, cloaca, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 114
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, age 6 months, captive, rhesus macaque2020-09-27v4No1 / 117
744amnon high in ileum compared to caecum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 121
782amnon high in gill compared to skin in fish farm portuguese republic sparus aurata ria formosa open water pond seabream 2021-05-06v4No1 / 132
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in farm caecum tibet autonomous region cecal content china 2018-04-10v4No1 / 136
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta age 1 month monkey captive rhesus macaque 2020-09-27v4No1 / 140
255amnoncommon in fish feed (common united states of america, research facility, state of minnesota, fish feed)2017-11-24v4No1 / 141
744amnoncommon research facility, caecum, gallus gallus, male, chicken, cobb broiler chicken, age 35 days2021-02-21v3No1 / 141
780amnon high in small intestine duodenum jejunum compared to caecum in research facility gallus gallus chicken china jinzhou city prefecture 2021-04-28v3No1 / 153
515amnoncommon poland, whole body, plant, beetle, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
700amnoncommon feces, research facility, sus scrofa, belgium, age 1 month, pig2028-04-01v3No1 / 164
770amnoncommon vagina, macaca mulatta, age > 1 year, female organism, cayo santiago, puerto rico, indian rhesus macaque2021-04-19v4No1 / 169
521amnoncommon in pre-weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, suckling, preweaned, age 2-4 weeks, china)2019-07-02v3No1 / 169
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, 3-month-old human stage2020-09-27v4No1 / 170
782amnon high in sparus aurata seabream compared to dicentrarchus labrax seabass in fish farm gill portuguese republic ria formosa open water pond 2021-05-06v4No1 / 174
851amnon high in colonic mucosa sigmoid colon sigmoid colon brushing compared to feces in homo sapiens adult italy milan 2021-12-16v3No1 / 174
671amnon high in age 8 months compared to female adult in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 182
604amnoncommon research facility, caecum, gallus gallus, chicken, cecal content, china2020-04-06v3No1 / 185
567amnon high in pair of nares anterior naris compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
389amnon high in age 1-3 weeks compared to age 4 weeks in united states of america farm tonsil sus scrofa state of michigan pig 2018-11-04v4No1 / 189
776amnoncommon caecum, gallus gallus, hawaii, chicken, wild, age 15-20 weeks, feral2021-04-25v3No1 / 191
738amnoncommon caecum, gallus gallus, chicken, age 30 days, united kingdom2021-01-30v3No1 / 202
878amnoncommon city, air, respirable suspended particulate matter, china, municipality of beijing, pm102022-03-11v3No1 / 203
666amnoncommon feces, italy, pig, sus scrofa domesticus2020-09-25v3No1 / 223
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 232
780amnoncommon research facility, small intestine, duodenum, jejunum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 232
688amnon high in female female organism compared to male male organism in feces research facility sus scrofa nanchang city prefecture pig china duroc pig age 140 days 2028-03-09v4No1 / 239
671amnoncommon feces, united states of america, research facility, macaca mulatta, monkey, captive, rhesus macaque, age 8 months2020-09-27v4No1 / 252
253amnoncommon in clouds in puy de dome mountain in france (common air, french republic, autumn, cloud)2017-11-22v4No1 / 267
568amnoncommon feces, gallus gallus, chicken, broiler chicken, viet nam2019-12-08v3No1 / 272
770amnoncommon feces, infant, macaca mulatta, age < 1 year, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 280
696amnon high in georissa georissa similis compared to alycaeus jagori in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 282
521amnonhigh freq. in weaned pigs (common feces, farm, sus scrofa, jiangxi province, pig, weaned, corn and soybean diet, age 4-7 weeks, china)2019-07-02v3No1 / 288
411amnoncommon feces, united states of america, zoological garden, papio anubis, monkey, olive baboon2018-11-23v4No1 / 292
780amnoncommon research facility, caecum, gallus gallus, chicken, china, jinzhou city prefecture2021-04-28v3No1 / 294
363amnoncommon dairy, ruminant reticulum, omasum, rumen, ovis aries, italy, obsolete_juvenile stage, age 30 days2018-08-29v4No1 / 302
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 304
666amnoncommon feces, sus scrofa, italy, wild boar2020-09-25v3No1 / 305
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, early pregnancy2021-07-04v4No1 / 313
399amnoncommon feces, united states of america, state of tennessee, zoological garden, sus scrofa, pig2018-11-16v4No1 / 319
568amnoncommon feces, gallus gallus, thailand, chicken, broiler chicken2019-12-08v3No1 / 320
855sheryoHigher in soil depth of 175cm compared to soil depth of 75cm in fertilized soil in china ( high in depth 175cm compared to depth 75cm in soil fertilized soil agricultural field china luancheng county )2021-12-27v3No1 / 334
816amnoncommon feces, united states of america, pregnancy, research facility, sus scrofa, commonwealth of pennsylvania, pig, female organism, adult organism, late pregnancy2021-07-04v4No1 / 340
776amnoncommon research facility, caecum, gallus gallus, hawaii, chicken, captive, broiler chicken, age 5 weeks2021-04-25v3No1 / 343
254amnoncommon river, water, fresh water, fujian province, depth (soil) 50cm, jiulong river, china2017-11-23v4No1 / 347
521amnonhigher in pre-weaned pigs compared to weaned older timepoints ( high in suckling preweaned age 2-4 weeks compared to weaned corn and soybean diet age 4-7 weeks in feces farm sus scrofa jiangxi province pig china )2019-07-02v3No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in populated place city upstream compared to downstream in river water fresh water fujian province depth (soil) 50cm jiulong river china )2017-11-23v4No1 / 356
671amnoncommon feces, united states of america, female, research facility, adult, macaca mulatta, monkey, captive, rhesus macaque2020-09-27v4No1 / 356
620amnoncommon feces, united states of america, zoological garden, pan troglodytes, chicago, chimpanzee, lincoln park zoo2020-05-06v4No1 / 358
891amnon high in 1-year-old human stage compared to under-1-year-old human stage in feces homo sapiens infant bangladesh dhaka infant stage urban slum 2022-04-03v4No1 / 363
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in feces papio zambia monkey baboon 2018-11-23v4No1 / 364
876amnoncommon feces, united states of america, research facility, juvenile organism, macaca mulatta, state of washington, monkey, age 20 months2022-03-06v4No1 / 364
902amnon high in colitis antibiotic colitis antibiotics induced colitis compared to control in feces united states of america equus caballus horse adult organism 2022-05-02v4No1 / 364
256amnoncommon duodenum, jejunum, ileum, sus scrofa, pig, united kingdom2017-11-26v4No1 / 380
620amnoncommon feces, united states of america, zoological garden, gorilla gorilla, chicago, lincoln park zoo2020-05-06v4No1 / 384
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum left colon right colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
770amnoncommon feces, macaca mulatta, age 10-15 years, adult organism, cayo santiago, puerto rico, rectal swab, indian rhesus macaque2021-04-19v4No1 / 396
314amnoncommon farm, caecum, sus scrofa, tibet autonomous region, pig, cecal content, china2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, state of tennessee, zoological garden, macaca mulatta, macaque2018-11-16v4No1 / 404
855sheryoHigher in soil depth of 350cm compared to soil depth of 800cm in fertilized soil in china ( high in depth 350cm compared to depth 800cm in soil fertilized soil agricultural field china luancheng county )2021-12-27v3No1 / 418
424amnoncommon feces, farm, sus scrofa, jinhua city prefecture, pig, jinhua pig, china2018-12-06v4No1 / 452
470amnoncommon feces, female, pregnancy, farm, adult, sus scrofa, canada, province of quebec, pig2019-01-14v4No1 / 457
128amnoncommon city, dense settlement biome, leaf, belgium, ivy, hedera hibernica2017-04-14v4No1 / 461
787amnoncommon in high grain diet induced subacute acidosis (common research facility, rumen, ruminal fluid, acidosis, capra hircus, china, shanxi province, goat, dairy goat, subacute rumen acidosis)2021-05-23v3No1 / 463
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486
256amnoncommon caecum, left colon, right colon, sus scrofa, pig, united kingdom2017-11-26v4No1 / 490
671amnon high in state of oregon compared to state of california in feces united states of america female research facility adult macaca mulatta monkey captive rhesus macaque 2020-09-27v4No1 / 534
696amnon high in georissa georissa similis compared to opisthostoma concinnum plectostoma concinnum in stomach gastrointestinal system malaysia state of sabah land snail 2028-03-28v3No1 / 576
254amnon high in summer wet season compared to winter autumn dry season in river water fresh water fujian province depth (soil) 50cm jiulong river china 2017-11-23v4No1 / 581
671amnon high in age 8 months compared to age 6 months 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park in feces chimpanzee 2020-05-06v4No1 / 964
517amnon high in arm skin forearm compared to mouth mucosa mouth in homo sapiens child bolivia chuquisaca department rural community age 5-13 years 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to wild republic of congo nouabale-ndoki national park in feces gorilla gorilla gorilla 2020-05-06v4No1 / 1019
876amnon high in juvenile organism age 20 months compared to age 1 week neonate in feces united states of america research facility macaca mulatta state of washington monkey 2022-03-06v4No1 / 1065
252amnoncommon in river rock biofilm (common river, rock, biofilm, kingdom of spain, epilithic, biofilm)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, sand, kingdom of spain, biofilm)2017-11-22v4No1 / 1181

Problems / suggestions? Please email info AT dbbact DOT org