Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGAAAAATAAGTCTAATGTGAAAGCCCTCGGCTTAACCGAGGAACTGCATCGGAAACTGTTTTTCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG
common ontology terms
term enrichment score
TermScore
sus scrofa0.466667
pig0.466667
zoological garden0.247423
caecum0.211055
farm0.193237
tonsil0.155039
state of michigan0.153846
age 30 days0.149254
dairy0.149254
river0.114943
monkey0.109589
ovis aries0.108696
duodenum0.106667
state of tennessee0.103896
united kingdom0.098039
fish feed0.097561
lincoln park zoo0.095238
macaca mulatta0.095238
jiulong river0.095238
fujian province0.095238
belgium0.093750
obsolete_juvenile stage0.093458
papio anubis0.090909
jejunum0.090909
chicago0.090909
depth 0.5m0.090909
italy0.089286
china0.087533
LOWER IN wild0.083333
sweden0.082474
city0.080000
adult0.072091
ileum0.071429
rectum0.068966
red pepper sauce0.065574
jinhua city prefecture0.065574
jinhua pig0.065574
gut content0.065574
cold environment0.065574
age 1-3 weeks0.065574
LOWER IN nouabale-ndoki national park0.065574
LOWER IN republic of congo0.065574
united states of america0.063651
olive baboon0.063492
capsicum annuum0.063492
canada0.063492
province of quebec0.063492
macaque0.063492
tibet autonomous region0.063492
rainbow trout0.061538
oncorhynchus mykiss0.061538
pan troglodytes0.061538
chimpanzee0.061538
gorilla gorilla0.059701
cecal content0.059701
sichuan province0.057971
rumen0.057971
biofilm0.057971
feces0.056225
food (fermented)0.054795
pregnancy0.054795
colon0.052632
fresh water0.052632
fish0.048193
kingdom of spain0.048193
skin0.047619
research facility0.039801
digestive system0.035398
mustela putorius furo0.033898
ferret0.033898
12c0.033898
age 12-23 years0.033898
LOWER IN induced periodontitis0.033898
temp 12c0.033898
LOWER IN warm temperature habitat0.033898
LOWER IN temp 18c0.033898
waste water0.033898
xinxiang city prefecture0.033898
intestinal contents0.033898
age 6-10 weeks0.033898
27cds diet0.033898
55cs diet0.033898
LOWER IN corn diet0.033898
LOWER IN 40mdgs diet0.033898
age 12-19 weeks0.033898
LOWER IN tibetan pig0.033898
LOWER IN tibetan swine0.033898
poland0.033898
nida basin0.033898
herbivorous beetle0.033898
crioceris duodecimpunctata0.033898
anterior naris0.033898
cloud0.033898
populated place0.033898
zambia0.033898
baboon0.033898
papio0.033898
LOWER IN papio kindae0.033898
LOWER IN papio ursinus0.033898
ivy0.033898
Fraction of dbbact annotations with this term covered by the query
TermScore
sus scrofa0.777778
pig0.777778
caecum0.750000
fish feed0.666667
tonsil0.666667
age 30 days0.500000
dairy0.500000
lincoln park zoo0.500000
red pepper sauce0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
mustela putorius furo0.500000
ferret0.500000
macaca mulatta0.500000
gut content0.500000
12c0.500000
cold environment0.500000
age 12-23 years0.500000
LOWER IN induced periodontitis0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
age 1-3 weeks0.500000
waste water0.500000
xinxiang city prefecture0.500000
intestinal contents0.500000
age 6-10 weeks0.500000
27cds diet0.500000
55cs diet0.500000
LOWER IN corn diet0.500000
LOWER IN 40mdgs diet0.500000
age 12-19 weeks0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
poland0.500000
nida basin0.500000
herbivorous beetle0.500000
crioceris duodecimpunctata0.500000
anterior naris0.500000
cloud0.500000
jiulong river0.500000
fujian province0.500000
populated place0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
ivy0.500000
hedera ibernica0.500000
age 30-500.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN nouabale-ndoki national park0.500000
LOWER IN republic of congo0.500000
LOWER IN pan troglodytes troglodytes0.500000
chuquisaca department0.500000
forearm0.500000
gorilla gorilla gorilla0.500000
epilithic0.500000
belgium0.428571
papio anubis0.333333
olive baboon0.333333
jejunum0.333333
chicago0.333333
capsicum annuum0.333333
canada0.333333
province of quebec0.333333
macaque0.333333
puerto rico0.333333
nipple0.333333
LOWER IN rumen0.333333
LOWER IN mucosa0.333333
state of nebraska0.333333
tibet autonomous region0.333333
beetle0.333333
LOWER IN nasopharynx0.333333
LOWER IN age 4 weeks0.333333
ruminant reticulum0.333333
omasum0.333333
depth 0.5m0.333333
dense settlement biome0.333333
age 5-13 years0.333333
arm0.333333
LOWER IN mouth mucosa0.333333
zoological garden0.300000
state of michigan0.285714
monkey0.250000
rainbow trout0.250000
oncorhynchus mykiss0.250000
LOWER IN ruminant reticulum0.250000
LOWER IN omasum0.250000
upstream0.250000
LOWER IN downstream0.250000
pan troglodytes0.250000
chimpanzee0.250000
LOWER IN left colon0.250000
left colon0.250000
bolivia0.250000
Fraction of annotations for the query sequences containing the term
TermScore
united states of america0.350877
feces0.333333
sus scrofa0.333333
pig0.333333
zoological garden0.210526
farm0.210526
china0.192982
adult0.122807
caecum0.122807
state of michigan0.105263
ovis aries0.087719
age 30 days0.087719
obsolete_juvenile stage0.087719
italy0.087719
dairy0.087719
united kingdom0.087719
tonsil0.087719
river0.087719
duodenum0.070175
monkey0.070175
state of tennessee0.070175
sweden0.070175
research facility0.070175
homo sapiens0.070175
papio anubis0.052632
jejunum0.052632
ileum0.052632
lincoln park zoo0.052632
chicago0.052632
fish feed0.052632
colon0.052632
rectum0.052632
macaca mulatta0.052632
belgium0.052632
city0.052632
water0.052632
fresh water0.052632
depth 0.5m0.052632
jiulong river0.052632
fujian province0.052632
LOWER IN wild0.052632
olive baboon0.035088
gorilla gorilla0.035088
red pepper sauce0.035088
capsicum annuum0.035088
sichuan province0.035088
food (fermented)0.035088
jinhua city prefecture0.035088
jinhua pig0.035088
canada0.035088
province of quebec0.035088
female0.035088
pregnancy0.035088
macaque0.035088
fish0.035088
rainbow trout0.035088
oncorhynchus mykiss0.035088
digestive system0.035088
gut content0.035088
cold environment0.035088
skin0.035088
age 1-3 weeks0.035088
rumen0.035088
cecal content0.035088
tibet autonomous region0.035088
pan troglodytes0.035088
chimpanzee0.035088
LOWER IN nouabale-ndoki national park0.035088
LOWER IN republic of congo0.035088
kingdom of spain0.035088
biofilm0.035088
mustela putorius furo0.017544
ferret0.017544
12c0.017544
subgingival plaque0.017544
dentition0.017544
puerto rico0.017544
age 12-23 years0.017544
control0.017544
LOWER IN induced periodontitis0.017544
LOWER IN periodontitis0.017544
temp 12c0.017544
LOWER IN warm temperature habitat0.017544
LOWER IN temp 18c0.017544
LOWER IN control0.017544
crohn's disease0.017544
nipple0.017544
waste water0.017544
hospital0.017544
xinxiang city prefecture0.017544
LOWER IN rumen0.017544
LOWER IN ruminant reticulum0.017544
LOWER IN omasum0.017544
LOWER IN mucosa0.017544
intestinal contents0.017544
age 6-10 weeks0.017544
bos taurus0.017544
cow0.017544
state of nebraska0.017544
diet0.017544
Exp. ID User ID Description Date Region Flag Sequences
363amnondominant ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, duodenum2018-08-29v4No1 / 3
411amnondominant feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 8
256amnondominant sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 10
620amnondominant lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 11
547amnondominant red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 11
424amnondominant sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 12
399amnondominant feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 13
313amnonhigh freq. in fishfeed (dominant sweden, fish feed)2018-04-10v4No1 / 14
470amnondominant sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 15
363amnondominant ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 16
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
399amnondominant feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 21
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 31
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 33
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 41
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 49
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 68
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 80
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 86
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 103
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
261amnondiet dependent in cow rumen ( high in diet 27cds diet 55cs diet compared to corn diet 40mdgs diet in bos taurus cow rumen united states of america state of nebraska )2017-12-10v4No1 / 113
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 136
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 186
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 189
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, rumen, ruminant reticulum, omasum2018-08-29v4No1 / 302
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 358
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 384
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
128amnoncommon belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 461
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181

Problems / suggestions? Please email info AT dbbact DOT org