Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGAAAAATAAGTCTAATGTGAAAGCCCTCGGCTTAACCGAGGAACTGCATCGGAAACTGTTTTTCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG
common ontology terms
term enrichment score
TermScore
sus scrofa0.404297
pig0.404297
macaca mulatta0.370370
monkey0.214286
puerto rico0.196721
rhesus macaque0.187500
zoological garden0.179104
indian rhesus macaque0.170213
cayo santiago0.170213
caecum0.166667
farm0.152672
state of michigan0.117647
canada0.116959
dairy0.113636
tonsil0.110497
age 30 days0.107527
age 8 months0.093023
ileum0.092593
river0.092593
captive0.088235
male organism0.085106
age 10-15 years0.085106
adult organism0.085106
duodenum0.081633
state of tennessee0.081633
rectal swab0.081633
obsolete_juvenile stage0.078125
china0.077135
research facility0.076176
united kingdom0.075188
fish feed0.072727
ovis aries0.072464
lincoln park zoo0.071429
province of alberta0.071429
LOWER IN state of california0.071429
jiulong river0.071429
fujian province0.071429
belgium0.069767
papio anubis0.068966
chicago0.068966
colon0.068966
depth 0.5m0.068966
jejunum0.066667
feces0.065868
age 6 weeks0.064516
united states of america0.063868
sweden0.063492
italy0.063291
state of oregon0.062500
LOWER IN wild0.062500
city0.061856
adult0.060914
male0.057143
female0.056711
rectum0.055556
red pepper sauce0.048780
jinhua city prefecture0.048780
jinhua pig0.048780
salmonellosis0.048780
salmonella enterica subsp. enterica serovar typhimurium0.048780
gut content0.048780
cold environment0.048780
age 1-3 weeks0.048780
LOWER IN nouabale-ndoki national park0.048780
LOWER IN republic of congo0.048780
olive baboon0.047619
capsicum annuum0.047619
province of quebec0.047619
macaque0.047619
tibet autonomous region0.047619
rainbow trout0.046512
oncorhynchus mykiss0.046512
age > 1 year0.046512
pan troglodytes0.046512
chimpanzee0.046512
female organism0.045977
cecal content0.045455
gorilla gorilla0.044444
biofilm0.044444
age < 1 year0.043478
fresh water0.043478
sichuan province0.042553
food (fermented)0.042553
mouth mucosa0.042553
rumen0.041237
pregnancy0.040000
oral cavity0.040000
fish0.037736
skin0.036697
kingdom of spain0.034483
infant0.032787
digestive system0.029851
homo sapiens0.025397
ascending colon0.025000
mustela putorius furo0.025000
ferret0.025000
12c0.025000
age 12-23 years0.025000
LOWER IN induced periodontitis0.025000
LOWER IN periodontitis0.025000
Fraction of dbbact annotations with this term covered by the query
TermScore
canada0.666667
fish feed0.666667
macaca mulatta0.666667
puerto rico0.666667
sus scrofa0.642857
pig0.642857
dairy0.500000
lincoln park zoo0.500000
red pepper sauce0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
salmonellosis0.500000
salmonella enterica subsp. enterica serovar typhimurium0.500000
province of alberta0.500000
ascending colon0.500000
mustela putorius furo0.500000
ferret0.500000
indian rhesus macaque0.500000
cayo santiago0.500000
gut content0.500000
12c0.500000
cold environment0.500000
age 12-23 years0.500000
LOWER IN induced periodontitis0.500000
LOWER IN periodontitis0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
age 1-3 weeks0.500000
waste water0.500000
xinxiang city prefecture0.500000
intestinal contents0.500000
age 6-10 weeks0.500000
27cds diet0.500000
55cs diet0.500000
LOWER IN corn diet0.500000
LOWER IN 40mdgs diet0.500000
age 12-19 weeks0.500000
rhesus macaque0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
LOWER IN state of california0.500000
poland0.500000
nida basin0.500000
herbivorous beetle0.500000
crioceris duodecimpunctata0.500000
age 8 months0.500000
anterior naris0.500000
age 140 days0.500000
duroc pig0.500000
cloud0.500000
jiulong river0.500000
fujian province0.500000
populated place0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
ivy0.500000
hedera ibernica0.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN age 6 months0.500000
LOWER IN nouabale-ndoki national park0.500000
LOWER IN republic of congo0.500000
chuquisaca department0.500000
forearm0.500000
gorilla gorilla gorilla0.500000
epilithic0.500000
caecum0.444444
tonsil0.400000
belgium0.375000
age 30 days0.333333
papio anubis0.333333
olive baboon0.333333
chicago0.333333
capsicum annuum0.333333
province of quebec0.333333
colon0.333333
macaque0.333333
nipple0.333333
LOWER IN mucosa0.333333
penis0.333333
tibet autonomous region0.333333
beetle0.333333
LOWER IN nasopharynx0.333333
LOWER IN age 4 weeks0.333333
LOWER IN male0.333333
nanchang city prefecture0.333333
ruminant reticulum0.333333
omasum0.333333
depth 0.5m0.333333
dense settlement biome0.333333
age 30-500.333333
LOWER IN pan troglodytes troglodytes0.333333
age 5-13 years0.333333
arm0.333333
monkey0.300000
Fraction of annotations for the query sequences containing the term
TermScore
feces0.423077
united states of america0.371795
sus scrofa0.294872
pig0.294872
macaca mulatta0.256410
research facility0.217949
monkey0.166667
zoological garden0.153846
china0.153846
farm0.153846
adult0.115385
puerto rico0.115385
rhesus macaque0.115385
captive0.115385
caecum0.102564
indian rhesus macaque0.102564
cayo santiago0.102564
state of michigan0.076923
ovis aries0.064103
age 30 days0.064103
obsolete_juvenile stage0.064103
italy0.064103
dairy0.064103
ileum0.064103
united kingdom0.064103
canada0.064103
female0.064103
tonsil0.064103
river0.064103
duodenum0.051282
state of tennessee0.051282
male organism0.051282
sweden0.051282
age 10-15 years0.051282
adult organism0.051282
rectal swab0.051282
homo sapiens0.051282
age 8 months0.051282
papio anubis0.038462
jejunum0.038462
lincoln park zoo0.038462
chicago0.038462
age 6 weeks0.038462
male0.038462
province of alberta0.038462
fish feed0.038462
colon0.038462
rectum0.038462
belgium0.038462
city0.038462
LOWER IN state of california0.038462
state of oregon0.038462
water0.038462
fresh water0.038462
depth 0.5m0.038462
jiulong river0.038462
fujian province0.038462
LOWER IN wild0.038462
olive baboon0.025641
gorilla gorilla0.025641
red pepper sauce0.025641
capsicum annuum0.025641
sichuan province0.025641
food (fermented)0.025641
jinhua city prefecture0.025641
jinhua pig0.025641
salmonellosis0.025641
salmonella enterica subsp. enterica serovar typhimurium0.025641
province of quebec0.025641
pregnancy0.025641
macaque0.025641
control0.025641
fish0.025641
rainbow trout0.025641
oncorhynchus mykiss0.025641
digestive system0.025641
gut content0.025641
cold environment0.025641
age < 1 year0.025641
infant0.025641
mouth mucosa0.025641
oral cavity0.025641
skin0.025641
age 1-3 weeks0.025641
rumen0.025641
age > 1 year0.025641
cecal content0.025641
tibet autonomous region0.025641
female organism0.025641
pan troglodytes0.025641
chimpanzee0.025641
LOWER IN nouabale-ndoki national park0.025641
LOWER IN republic of congo0.025641
kingdom of spain0.025641
biofilm0.025641
ascending colon0.012821
mustela putorius furo0.012821
ferret0.012821
12c0.012821
subgingival plaque0.012821
Exp. ID User ID Description Date Region Flag Sequences
363amnondominant ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, duodenum2018-08-29v4No1 / -5
411amnondominant feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 0
256amnondominant sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 2
620amnondominant lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 3
547amnondominant red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 3
424amnondominant sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 4
399amnondominant feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 5
673amnondominant salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 6
313amnonhigh freq. in fishfeed (dominant sweden, fish feed)2018-04-10v4No1 / 6
470amnondominant sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 7
363amnondominant ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 8
673amnondominant ascending colon, caecum, salmonellosis, salmonella enterica subsp. enterica serovar typhimurium, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 10
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 12
399amnondominant feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 13
770amnondominant age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 14
673amnoncommon control, ileum, research facility, age 6 weeks, male, male organism, province of alberta, canada, pig, sus scrofa2020-09-28v4No1 / 18
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 23
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 25
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 33
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 41
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 47
770amnoncommon age < 1 year, infant, mouth mucosa, oral cavity, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 59
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 60
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 63
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 64
770amnoncommon age 10-15 years, adult organism, mouth mucosa, oral cavity, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 68
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 72
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 78
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 86
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 93
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 95
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 104
261amnondiet dependent in cow rumen ( high in diet 27cds diet 55cs diet compared to corn diet 40mdgs diet in bos taurus cow rumen united states of america state of nebraska )2017-12-10v4No1 / 105
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 106
770amnoncommon male organism, penis, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 110
671amnoncommon age 6 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 110
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 128
671amnon high in state of oregon compared to state of california in age 1 month united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 133
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 133
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 149
671amnoncommon age 3 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 163
770amnoncommon vagina, female organism, age > 1 year, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 169
671amnon high in age 8 months compared to female adult in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 175
567amnon high in anterior naris pair of nares compared to nasopharynx in homo sapiens adult belgium 2019-12-05v4No1 / 178
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 181
671amnon high in state of oregon compared to state of california in age 8 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 225
688amnon high in female female organism compared to male organism male in nanchang city prefecture feces age 140 days research facility duroc pig china pig sus scrofa 2028-03-09v4No1 / 232
671amnoncommon age 8 months, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 245
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 259
770amnoncommon age < 1 year, infant, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 280
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 284
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, rumen, ruminant reticulum, omasum2018-08-29v4No1 / 294
770amnon high in age 10-15 years adult organism compared to age < 1 year infant in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 304
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 311
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 339
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 348
671amnoncommon female, adult, united states of america, monkey, rhesus macaque, macaca mulatta, research facility, captive, feces2020-09-27v4No1 / 349
620amnoncommon lincoln park zoo, chicago, united states of america, pan troglodytes, chimpanzee, zoological garden, feces2020-05-06v4No1 / 350
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 356
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 372
620amnoncommon lincoln park zoo, united states of america, chicago, zoological garden, feces, gorilla gorilla2020-05-06v4No1 / 376
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 379
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 394
770amnoncommon age 10-15 years, adult organism, rectal swab, feces, indian rhesus macaque, macaca mulatta, cayo santiago, puerto rico2021-04-19v4No1 / 396
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 396
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 444
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 449
128amnoncommon belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 453
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 478
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 482
671amnon high in state of oregon compared to state of california in female adult united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 527
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 573
671amnon high in age 8 months compared to age 6 months age 3 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 948
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 956
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1006
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1011
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1073
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1173

Problems / suggestions? Please email info AT dbbact DOT org