Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGAAAAATAAGTCTAATGTGAAAGCCCTCGGCTTAACCGAGGAACTGCATCGGAAACTGTTTTTCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG
common ontology terms
term enrichment score
TermScore
sus scrofa0.497196
pig0.497196
farm0.223881
zoological garden0.175000
tonsil0.168067
state of michigan0.164384
age 30 days0.161290
dairy0.161290
caecum0.135484
ovis aries0.121951
river0.121951
monkey0.117647
duodenum0.114286
state of tennessee0.111111
fish feed0.106195
macaca mulatta0.106195
china0.104019
jiulong river0.103448
fujian province0.103448
united kingdom0.103093
belgium0.101695
papio anubis0.098361
jejunum0.098361
depth 0.5m0.098361
obsolete_juvenile stage0.098039
italy0.098039
sweden0.095238
city0.086957
adult0.086101
ileum0.078947
rectum0.075949
red pepper sauce0.071429
jinhua city prefecture0.071429
jinhua pig0.071429
canada0.071429
macaque0.071429
gut content0.071429
cold environment0.071429
age 1-3 weeks0.071429
cecal content0.071429
olive baboon0.068966
capsicum annuum0.068966
province of quebec0.068966
tibet autonomous region0.068966
rainbow trout0.066667
oncorhynchus mykiss0.066667
sichuan province0.062500
pregnancy0.062500
rumen0.062500
biofilm0.062500
food (fermented)0.058824
united states of america0.058027
fresh water0.056604
kingdom of spain0.055556
colon0.055046
fish0.054054
feces0.053503
skin0.051948
research facility0.044118
homo sapiens0.037915
digestive system0.037736
mustela putorius furo0.037037
ferret0.037037
12c0.037037
age 12-23 years0.037037
LOWER IN induced periodontitis0.037037
temp 12c0.037037
LOWER IN warm temperature habitat0.037037
LOWER IN temp 18c0.037037
waste water0.037037
xinxiang city prefecture0.037037
intestinal contents0.037037
age 6-10 weeks0.037037
27cds diet0.037037
55cs diet0.037037
LOWER IN corn diet0.037037
LOWER IN 40mdgs diet0.037037
age 12-19 weeks0.037037
LOWER IN tibetan pig0.037037
LOWER IN tibetan swine0.037037
nida basin0.037037
herbivorous beetle0.037037
crioceris duodecimpunctata0.037037
anterior naris0.037037
cloud0.037037
populated place0.037037
zambia0.037037
baboon0.037037
papio0.037037
LOWER IN papio kindae0.037037
LOWER IN papio ursinus0.037037
ivy0.037037
hedera ibernica0.037037
age 30-500.037037
age 60-790.037037
LOWER IN age 3-60.037037
LOWER IN age 8-120.037037
chuquisaca department0.037037
forearm0.037037
LOWER IN mouth mucosa0.037037
Fraction of dbbact annotations with this term covered by the query
TermScore
sus scrofa0.777778
pig0.777778
fish feed0.666667
macaca mulatta0.666667
tonsil0.666667
age 30 days0.500000
dairy0.500000
red pepper sauce0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
canada0.500000
mustela putorius furo0.500000
ferret0.500000
macaque0.500000
gut content0.500000
12c0.500000
cold environment0.500000
age 12-23 years0.500000
LOWER IN induced periodontitis0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
age 1-3 weeks0.500000
waste water0.500000
xinxiang city prefecture0.500000
intestinal contents0.500000
age 6-10 weeks0.500000
27cds diet0.500000
55cs diet0.500000
LOWER IN corn diet0.500000
LOWER IN 40mdgs diet0.500000
age 12-19 weeks0.500000
cecal content0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
nida basin0.500000
herbivorous beetle0.500000
crioceris duodecimpunctata0.500000
anterior naris0.500000
cloud0.500000
jiulong river0.500000
fujian province0.500000
populated place0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
ivy0.500000
hedera ibernica0.500000
age 30-500.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
chuquisaca department0.500000
forearm0.500000
LOWER IN mouth mucosa0.500000
epilithic0.500000
belgium0.428571
papio anubis0.333333
olive baboon0.333333
jejunum0.333333
capsicum annuum0.333333
province of quebec0.333333
puerto rico0.333333
nipple0.333333
LOWER IN rumen0.333333
LOWER IN mucosa0.333333
state of nebraska0.333333
tibet autonomous region0.333333
poland0.333333
beetle0.333333
LOWER IN nasopharynx0.333333
LOWER IN age 4 weeks0.333333
ruminant reticulum0.333333
omasum0.333333
depth 0.5m0.333333
dense settlement biome0.333333
age 5-13 years0.333333
arm0.333333
state of michigan0.285714
monkey0.250000
zoological garden0.250000
rainbow trout0.250000
oncorhynchus mykiss0.250000
LOWER IN ruminant reticulum0.250000
LOWER IN omasum0.250000
whole body0.250000
upstream0.250000
LOWER IN downstream0.250000
LOWER IN left colon0.250000
left colon0.250000
LOWER IN autumn0.250000
bolivia0.250000
duodenum0.222222
farm0.217391
state of tennessee0.200000
state of minnesota0.200000
LOWER IN right colon0.200000
right colon0.200000
Fraction of annotations for the query sequences containing the term
TermScore
sus scrofa0.365385
pig0.365385
united states of america0.288462
feces0.269231
farm0.230769
china0.211538
zoological garden0.134615
adult0.134615
caecum0.134615
state of michigan0.115385
ovis aries0.096154
age 30 days0.096154
obsolete_juvenile stage0.096154
italy0.096154
dairy0.096154
united kingdom0.096154
tonsil0.096154
river0.096154
duodenum0.076923
monkey0.076923
state of tennessee0.076923
sweden0.076923
research facility0.076923
homo sapiens0.076923
papio anubis0.057692
jejunum0.057692
ileum0.057692
fish feed0.057692
colon0.057692
rectum0.057692
macaca mulatta0.057692
belgium0.057692
city0.057692
water0.057692
fresh water0.057692
depth 0.5m0.057692
jiulong river0.057692
fujian province0.057692
olive baboon0.038462
red pepper sauce0.038462
capsicum annuum0.038462
sichuan province0.038462
food (fermented)0.038462
jinhua city prefecture0.038462
jinhua pig0.038462
canada0.038462
province of quebec0.038462
female0.038462
pregnancy0.038462
macaque0.038462
fish0.038462
rainbow trout0.038462
oncorhynchus mykiss0.038462
digestive system0.038462
gut content0.038462
cold environment0.038462
skin0.038462
age 1-3 weeks0.038462
rumen0.038462
cecal content0.038462
tibet autonomous region0.038462
kingdom of spain0.038462
biofilm0.038462
mustela putorius furo0.019231
ferret0.019231
12c0.019231
subgingival plaque0.019231
dentition0.019231
puerto rico0.019231
age 12-23 years0.019231
control0.019231
LOWER IN induced periodontitis0.019231
LOWER IN periodontitis0.019231
temp 12c0.019231
LOWER IN warm temperature habitat0.019231
LOWER IN temp 18c0.019231
LOWER IN control0.019231
crohn's disease0.019231
nipple0.019231
waste water0.019231
hospital0.019231
xinxiang city prefecture0.019231
LOWER IN rumen0.019231
LOWER IN ruminant reticulum0.019231
LOWER IN omasum0.019231
LOWER IN mucosa0.019231
intestinal contents0.019231
age 6-10 weeks0.019231
bos taurus0.019231
cow0.019231
state of nebraska0.019231
diet0.019231
27cds diet0.019231
55cs diet0.019231
LOWER IN corn diet0.019231
LOWER IN 40mdgs diet0.019231
age 12-19 weeks0.019231
LOWER IN tibetan pig0.019231
LOWER IN tibetan swine0.019231
state of minnesota0.019231
Exp. ID User ID Description Date Region Flag Sequences
363amnonhighfreq ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, duodenum2018-08-29v4No1 / 3
411amnonhighfreq feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 8
256amnonhighfreq sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 10
547amnonhighfreq red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 11
424amnonhighfreq sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 12
399amnonhighfreq feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 13
313amnonhigh freq. in fishfeed (highfreq sweden, fish feed)2018-04-10v4No1 / 14
470amnonhighfreq sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 15
363amnonhighfreq ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 16
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-16v4No1 / 20
399amnonhighfreq feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 21
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, 12c, cold environment)2018-04-10v4No1 / 31
542amnonlower in ligature induced periodontitis compared to control timepoints ( high in control compared to induced periodontitis periodontitis in subgingival plaque dentition monkey macaca mulatta research facility puerto rico adult age 12-23 years )2019-08-01v4No1 / 33
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-04v4No1 / 41
547amnoncommon red pepper sauce, capsicum annuum, sichuan province, china, food (fermented)2019-08-15v4No1 / 49
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in temp 12c cold environment compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-10v4No1 / 55
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-15v4No1 / 68
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-10v4No1 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-04v4No1 / 72
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-04v4No1 / 80
513amnoncommon waste water, hospital, city, xinxiang city prefecture, china2019-03-25v4No1 / 86
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-29v4No1 / 94
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-29v4No1 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig caecum united kingdom )2017-11-26v4No1 / 103
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-03v4No1 / 112
261amnondiet dependent in cow rumen ( high in diet 27cds diet 55cs diet compared to corn diet 40mdgs diet in bos taurus cow rumen united states of america state of nebraska )2017-12-10v4No1 / 113
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-03v4No1 / 114
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content tibet autonomous region farm china 2018-04-10v4No1 / 136
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-24v4No1 / 141
515amnoncommon poland, whole body, beetle, plant, nida basin, herbivorous beetle, crioceris duodecimpunctata2019-04-18v4No1 / 157
567amnon high in pair of nares anterior naris compared to nasopharynx in belgium adult homo sapiens 2019-12-05v4No1 / 186
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-04v4No1 / 189
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, autumn)2017-11-22v4No1 / 267
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-23v4No1 / 292
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, rumen, ruminant reticulum, omasum2018-08-29v4No1 / 302
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-16v4No1 / 319
254amnoncommon river, water, fresh water, depth 0.5m, jiulong river, fujian province, china2017-11-23v4No1 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river water fresh water depth 0.5m jiulong river fujian province china )2017-11-23v4No1 / 356
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-23v4No1 / 364
256amnoncommon sus scrofa, pig, duodenum, jejunum, ileum, united kingdom2017-11-26v4No1 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-26v4No1 / 387
314amnoncommon caecum, cecal content, tibet autonomous region, farm, sus scrofa, pig, china2018-04-10v4No1 / 402
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-16v4No1 / 404
424amnoncommon sus scrofa, pig, jinhua city prefecture, jinhua pig, feces, farm, china2018-12-06v4No1 / 452
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-14v4No1 / 457
128amnoncommon belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-14v4No1 / 461
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
256amnoncommon sus scrofa, pig, caecum, right colon, left colon, united kingdom2017-11-26v4No1 / 490
254amnon high in summer wet season compared to winter dry season autumn in river water fresh water depth 0.5m jiulong river fujian province china 2017-11-23v4No1 / 581
517amnon high in skin arm forearm compared to mouth mucosa mouth in homo sapiens child age 5-13 years bolivia rural community chuquisaca department 2019-05-29v4No1 / 1014
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-22v4No1 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-22v4No1 / 1181

Problems / suggestions? Please email info AT dbbact DOT org