Search result for sequence:
TACGTAGGTGGCAAGCGTTGTCCGGATTTATTGGGCGTAAAGCGAGCGCAGGCGGAAAAATAAGTCTAATGTGAAAGCCCTCGGCTTAACCGAGGAACTGCATCGGAAACTGTTTTTCTTGAGTGCAGAAGAGGAGAGTGGAACTCCATG
common ontology terms
term enrichment score
TermScore
sus scrofa0.524655
pig0.524655
farm0.250000
zoological garden0.213740
tonsil0.180180
state of michigan0.173913
age 30 days0.172414
dairy0.172414
caecum0.144330
river0.132450
ovis aries0.128205
duodenum0.125000
state of tennessee0.117647
fish feed0.114286
papio anubis0.111111
depth 0.5m0.111111
jiulong river0.111111
fujian province0.111111
italy0.107527
united kingdom0.107527
jejunum0.105263
obsolete_juvenile stage0.102041
sweden0.100000
china0.093750
city0.093750
monkey0.086957
ileum0.086957
rectum0.080000
olive baboon0.076923
jinhua city prefecture0.076923
jinhua pig0.076923
macaca mulatta0.076923
macaque0.076923
gut content0.076923
cold temperature habitat0.076923
age 1-3 weeks0.076923
cecal content0.076923
province of quebec0.074074
belgium0.074074
tibet autonomous region0.074074
rainbow trout0.071429
oncorhynchus mykiss0.071429
pregnancy0.068966
rumen0.068966
biofilm0.068966
adult0.062630
fresh water0.062500
united states of america0.061792
colon0.060606
kingdom of spain0.060606
feces0.057534
fish0.057143
skin0.056338
canada0.055556
mustela putorius furo0.040000
ferret0.040000
12c0.040000
temp 12c0.040000
LOWER IN warm temperature habitat0.040000
LOWER IN temp 18c0.040000
waste water0.040000
xinxiang city prefecture0.040000
intestinal contents0.040000
age 6-10 weeks0.040000
27cds diet0.040000
55cs diet0.040000
LOWER IN corn diet0.040000
LOWER IN 40mdgs diet0.040000
age 12-19 weeks0.040000
LOWER IN tibetan pig0.040000
LOWER IN tibetan swine0.040000
crioceris duodecimpunctata0.040000
herbivorous beetle0.040000
nida basin0.040000
cloud0.040000
populated place0.040000
zambia0.040000
baboon0.040000
papio0.040000
LOWER IN papio kindae0.040000
LOWER IN papio ursinus0.040000
ivy0.040000
hedera ibernica0.040000
age 30-500.040000
age 60-790.040000
LOWER IN age 3-60.040000
LOWER IN age 8-120.040000
LOWER IN mouth mucosa0.040000
forearm0.040000
chuquisaca department0.040000
age 5-13 years0.040000
epilithic0.040000
digestive system0.039216
nipple0.039216
LOWER IN rumen0.039216
LOWER IN mucosa0.039216
state of nebraska0.039216
beetle0.039216
poland0.039216
LOWER IN age 4 weeks0.039216
Fraction of dbbact annotations with this term covered by the query
TermScore
sus scrofa0.777778
pig0.777778
fish feed0.666667
tonsil0.666667
age 30 days0.500000
dairy0.500000
papio anubis0.500000
olive baboon0.500000
jinhua city prefecture0.500000
jinhua pig0.500000
mustela putorius furo0.500000
ferret0.500000
macaca mulatta0.500000
macaque0.500000
gut content0.500000
cold temperature habitat0.500000
12c0.500000
temp 12c0.500000
LOWER IN warm temperature habitat0.500000
LOWER IN temp 18c0.500000
age 1-3 weeks0.500000
waste water0.500000
xinxiang city prefecture0.500000
intestinal contents0.500000
age 6-10 weeks0.500000
27cds diet0.500000
55cs diet0.500000
LOWER IN corn diet0.500000
LOWER IN 40mdgs diet0.500000
age 12-19 weeks0.500000
cecal content0.500000
LOWER IN tibetan pig0.500000
LOWER IN tibetan swine0.500000
crioceris duodecimpunctata0.500000
herbivorous beetle0.500000
nida basin0.500000
cloud0.500000
depth 0.5m0.500000
jiulong river0.500000
fujian province0.500000
populated place0.500000
zambia0.500000
baboon0.500000
papio0.500000
LOWER IN papio kindae0.500000
LOWER IN papio ursinus0.500000
ivy0.500000
hedera ibernica0.500000
age 30-500.500000
age 60-790.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN mouth mucosa0.500000
forearm0.500000
chuquisaca department0.500000
age 5-13 years0.500000
epilithic0.500000
zoological garden0.400000
jejunum0.333333
province of quebec0.333333
belgium0.333333
nipple0.333333
LOWER IN rumen0.333333
LOWER IN mucosa0.333333
state of nebraska0.333333
tibet autonomous region0.333333
beetle0.333333
poland0.333333
LOWER IN age 4 weeks0.333333
ruminant reticulum0.333333
omasum0.333333
dense settlement biome0.333333
LOWER IN fall0.333333
arm0.333333
state of michigan0.285714
duodenum0.250000
farm0.250000
rainbow trout0.250000
oncorhynchus mykiss0.250000
LOWER IN ruminant reticulum0.250000
LOWER IN omasum0.250000
whole body0.250000
upstream0.250000
LOWER IN downstream0.250000
LOWER IN right colon0.250000
LOWER IN left colon0.250000
right colon0.250000
left colon0.250000
bolivia0.250000
rock0.250000
state of tennessee0.200000
pregnancy0.200000
cow0.200000
rumen0.200000
state of minnesota0.200000
fall0.200000
LOWER IN child0.200000
biofilm0.200000
sand0.200000
city0.187500
Fraction of annotations for the query sequences containing the term
TermScore
sus scrofa0.395833
pig0.395833
united states of america0.312500
feces0.291667
farm0.250000
china0.187500
zoological garden0.145833
caecum0.145833
state of michigan0.125000
ovis aries0.104167
age 30 days0.104167
obsolete_juvenile stage0.104167
italy0.104167
dairy0.104167
united kingdom0.104167
adult0.104167
tonsil0.104167
river0.104167
duodenum0.083333
state of tennessee0.083333
sweden0.083333
monkey0.062500
papio anubis0.062500
jejunum0.062500
ileum0.062500
fish feed0.062500
colon0.062500
rectum0.062500
research facility0.062500
homo sapiens0.062500
city0.062500
water0.062500
fresh water0.062500
depth 0.5m0.062500
jiulong river0.062500
fujian province0.062500
olive baboon0.041667
jinhua city prefecture0.041667
jinhua pig0.041667
canada0.041667
province of quebec0.041667
female0.041667
pregnancy0.041667
macaca mulatta0.041667
macaque0.041667
fish0.041667
rainbow trout0.041667
oncorhynchus mykiss0.041667
digestive system0.041667
gut content0.041667
cold temperature habitat0.041667
belgium0.041667
skin0.041667
age 1-3 weeks0.041667
rumen0.041667
cecal content0.041667
tibet autonomous region0.041667
kingdom of spain0.041667
biofilm0.041667
mustela putorius furo0.020833
ferret0.020833
12c0.020833
temp 12c0.020833
LOWER IN warm temperature habitat0.020833
LOWER IN temp 18c0.020833
crohn's disease0.020833
LOWER IN control0.020833
nipple0.020833
waste water0.020833
hospital0.020833
xinxiang city prefecture0.020833
LOWER IN rumen0.020833
LOWER IN ruminant reticulum0.020833
LOWER IN omasum0.020833
LOWER IN mucosa0.020833
intestinal contents0.020833
age 6-10 weeks0.020833
bos taurus0.020833
cow0.020833
state of nebraska0.020833
diet0.020833
27cds diet0.020833
55cs diet0.020833
LOWER IN corn diet0.020833
LOWER IN 40mdgs diet0.020833
age 12-19 weeks0.020833
LOWER IN tibetan pig0.020833
LOWER IN tibetan swine0.020833
state of minnesota0.020833
crioceris duodecimpunctata0.020833
herbivorous beetle0.020833
nida basin0.020833
plant0.020833
beetle0.020833
whole body0.020833
poland0.020833
LOWER IN age 4 weeks0.020833
cloud0.020833
french republic0.020833
air0.020833
Exp. ID User ID Description Date Sequences
363amnonhighfreq ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, duodenum2018-08-291 / 3
411amnonhighfreq feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-231 / 8
256amnonhighfreq sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-261 / 10
424amnonhighfreq sus scrofa, pig, jinhua city prefecture, china, jinhua pig, feces, farm2018-12-061 / 12
399amnonhighfreq feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-161 / 13
313amnonhigh freq. in fishfeed (highfreq sweden, fish feed)2018-04-101 / 14
470amnonhighfreq sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-141 / 15
363amnonhighfreq ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-291 / 16
399amnoncommon feces, united states of america, mustela putorius furo, ferret2018-11-161 / 20
399amnonhighfreq feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-161 / 21
313amnoncommon in rainbow trout gut content grown in 12C water (common sweden, fish, rainbow trout, oncorhynchus mykiss, research facility, digestive system, gut content, cold temperature habitat, 12c)2018-04-101 / 31
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, adult, tonsil2018-11-041 / 41
313amnonhigher in gut content of fish grown in 12C compared to 18C water ( high in cold temperature habitat temp 12c compared to warm temperature habitat temp 18c in sweden fish rainbow trout oncorhynchus mykiss research facility digestive system gut content )2018-04-101 / 55
398amnon high in crohn's disease compared to control in homo sapiens feces belgium 2018-11-151 / 68
313amnoncommon in fishfeed (common sweden, fish feed)2018-04-101 / 71
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, skin, nipple, adult2018-11-041 / 72
389amnoncommon pig, sus scrofa, united states of america, state of michigan, farm, tonsil, age 1-3 weeks2018-11-041 / 80
513amnoncommon china, waste water, hospital, city, xinxiang city prefecture2019-03-251 / 86
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, caecum, colon, rectum2018-08-291 / 94
363amnon high in caecum colon rectum compared to rumen ruminant reticulum omasum in ovis aries age 30 days obsolete_juvenile stage italy dairy 2018-08-291 / 101
256amnonhigher in intestinal contents compared to mucosal scraping in pig caecum ( high in intestinal contents compared to mucosa in sus scrofa pig united kingdom caecum )2017-11-261 / 103
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 6-10 weeks2018-11-031 / 112
261amnondiet dependent in cow rumen ( high in diet 27cds diet 55cs diet compared to corn diet 40mdgs diet in bos taurus cow rumen united states of america state of nebraska )2017-12-101 / 113
388amnoncommon pig, sus scrofa, tonsil, farm, united states of america, state of michigan, age 12-19 weeks2018-11-031 / 114
314amnon high in sus scrofa pig compared to tibetan pig tibetan swine in caecum cecal content china tibet autonomous region farm 2018-04-101 / 136
255amnoncommon in fish feed (common united states of america, state of minnesota, research facility, fish feed)2017-11-241 / 141
515amnoncommon crioceris duodecimpunctata, herbivorous beetle, nida basin, plant, beetle, whole body, poland2019-04-181 / 157
389amnon high in age 1-3 weeks compared to age 4 weeks in pig sus scrofa united states of america state of michigan farm tonsil 2018-11-041 / 189
253amnoncommon in clouds in puy de dome mountain in france (common cloud, french republic, air, fall)2017-11-221 / 267
411amnoncommon feces, monkey, united states of america, zoological garden, papio anubis, olive baboon2018-11-231 / 292
363amnoncommon ovis aries, age 30 days, obsolete_juvenile stage, italy, dairy, rumen, ruminant reticulum, omasum2018-08-291 / 302
399amnoncommon feces, united states of america, zoological garden, state of tennessee, sus scrofa, pig2018-11-161 / 319
254amnoncommon river, china, water, fresh water, depth 0.5m, jiulong river, fujian province2017-11-231 / 347
254amnonhigher in river when close to populated region compared to downstream ( high in city populated place upstream compared to downstream in river china water fresh water depth 0.5m jiulong river fujian province )2017-11-231 / 356
411amnon high in zoological garden papio anubis compared to wild papio kindae papio ursinus in zambia feces monkey baboon papio 2018-11-231 / 364
256amnoncommon sus scrofa, pig, united kingdom, duodenum, jejunum, ileum2017-11-261 / 380
256amnonhigher in small intestine compared to colon in pigs ( high in duodenum jejunum ileum compared to caecum right colon left colon in sus scrofa pig united kingdom )2017-11-261 / 387
314amnoncommon caecum, cecal content, china, tibet autonomous region, farm, sus scrofa, pig2018-04-101 / 402
399amnoncommon feces, united states of america, zoological garden, state of tennessee, macaca mulatta, macaque2018-11-161 / 404
424amnoncommon sus scrofa, pig, jinhua city prefecture, china, jinhua pig, feces, farm2018-12-061 / 452
470amnoncommon sus scrofa, pig, canada, farm, province of quebec, feces, female, adult, pregnancy2019-01-141 / 457
128amnoncommon belgium, ivy, hedera ibernica, leaf, city, dense settlement biome2017-04-141 / 461
438amnon high in age 30-50 age 60-79 adult compared to age 3-6 age 8-12 child in homo sapiens feces china 2018-12-301 / 486
256amnoncommon sus scrofa, pig, united kingdom, caecum, right colon, left colon2017-11-261 / 490
254amnon high in summer wet season compared to fall winter dry season in river china water fresh water depth 0.5m jiulong river fujian province 2017-11-231 / 581
517amnon high in forearm arm skin compared to mouth mucosa mouth in chuquisaca department rural community bolivia age 5-13 years child homo sapiens 2019-05-291 / 1014
252amnoncommon in river rock biofilm (common kingdom of spain, biofilm, river, rock, epilithic)2017-11-221 / 1081
252amnoncommon in river sand biofilm (common river, biofilm, kingdom of spain, sand)2017-11-221 / 1181

Problems / suggestions? Please email info AT dbbact DOT org