Search result for sequence:
TACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCCGGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG

Taxonomy: d__Bacteria;p__Firmicutes;c__Clostridia;o__Clostridiales;f__Lachnospiraceae

species # matches SILVA IDs
common ontology terms
term enrichment score
TermScore
western australia0.179104
low bmi0.172414
LOWER IN high bmi0.158730
age 1 year0.151899
feces0.138271
macaca mulatta0.137143
homo sapiens0.119462
monkey0.115942
edo state0.115385
sheep0.104348
abomasum0.103448
city0.102128
ovis aries0.094488
nigeria0.093750
adult0.092325
zoological garden0.083916
united states of america0.082774
small village0.075472
sixth decade human stage0.075472
nanning city prefecture0.075472
cron diet0.075472
LOWER IN nouabale-ndoki national park0.075472
LOWER IN republic of congo0.075472
age 8 months0.075472
rhesus macaque0.075472
cobb broiler chicken0.075472
infant0.073394
age < 3 years0.072727
65-79 year-old human stage0.072727
age 35 days0.072727
fifth decade human stage0.070175
hispanic or latin american0.070175
caloric restriction diet0.067797
body mass index0.066667
LOWER IN body mass index0.066667
rural community0.064516
LOWER IN finland0.063492
LOWER IN crohn&#39;s disease0.063492
jejunum0.063492
fourth decade human stage0.061538
ileum0.058252
australia0.056872
child0.055814
state of new york0.053333
LOWER IN infant0.050633
chicken0.047059
china0.046377
gallus gallus0.045977
research facility0.044489
captive0.043956
control0.043321
LOWER IN colon0.042105
LOWER IN rumen0.042105
9-month-old human stage0.040000
LOWER IN 9-month-old human stage0.040000
orangutan0.040000
pongo sp.0.040000
columbus0.040000
LOWER IN wild0.039604
el salvador0.039216
LOWER IN lima0.039216
LOWER IN shantytown0.039216
low income0.039216
LOWER IN little physical activity0.039216
LOWER IN nephrolithiasis0.039216
karen0.039216
myanmar0.039216
LOWER IN hmong0.039216
bangui0.039216
LOWER IN antananarivo0.039216
LOWER IN pancreatitis0.039216
LOWER IN acute pancreatitis0.039216
tenth decade human stage0.039216
age >940.039216
LOWER IN soldiers0.039216
LOWER IN age 3-60.039216
LOWER IN age 8-120.039216
gorilla gorilla gorilla0.039216
LOWER IN age 6 months0.039216
age 10-15 years0.039216
indian rhesus macaque0.039216
cayo santiago0.039216
age 20 months0.039216
LOWER IN neonate0.039216
18-month-old human stage0.039216
LOWER IN 18-month-old human stage0.039216
estonia0.038462
physical activity0.038462
LOWER IN american diet0.038462
LOWER IN amerindian0.038462
LOWER IN venezuela0.038462
central african republic0.038462
LOWER IN madagascar0.038462
nanchang city prefecture0.038462
ninth decade human stage0.038462
LOWER IN pan troglodytes troglodytes0.038462
LOWER IN cuba0.038462
asian0.038462
LOWER IN age &lt; 1 year0.038462
wild boar0.038462
Fraction of dbbact annotations with this term covered by the query
TermScore
9-month-old human stage1.000000
edo state1.000000
LOWER IN 9-month-old human stage1.000000
orangutan1.000000
pongo sp.1.000000
columbus1.000000
low bmi0.555556
el salvador0.500000
small village0.500000
LOWER IN lima0.500000
LOWER IN shantytown0.500000
low income0.500000
LOWER IN little physical activity0.500000
sixth decade human stage0.500000
nanning city prefecture0.500000
LOWER IN nephrolithiasis0.500000
cron diet0.500000
karen0.500000
myanmar0.500000
LOWER IN hmong0.500000
bangui0.500000
LOWER IN antananarivo0.500000
LOWER IN pancreatitis0.500000
LOWER IN acute pancreatitis0.500000
tenth decade human stage0.500000
age >940.500000
LOWER IN soldiers0.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN nouabale-ndoki national park0.500000
LOWER IN republic of congo0.500000
gorilla gorilla gorilla0.500000
age 8 months0.500000
rhesus macaque0.500000
LOWER IN age 6 months0.500000
age 10-15 years0.500000
indian rhesus macaque0.500000
cayo santiago0.500000
age 20 months0.500000
LOWER IN neonate0.500000
18-month-old human stage0.500000
LOWER IN 18-month-old human stage0.500000
cobb broiler chicken0.500000
macaca mulatta0.428571
LOWER IN high bmi0.357143
age < 3 years0.333333
estonia0.333333
physical activity0.333333
LOWER IN american diet0.333333
LOWER IN amerindian0.333333
LOWER IN venezuela0.333333
central african republic0.333333
LOWER IN madagascar0.333333
nanchang city prefecture0.333333
ninth decade human stage0.333333
65-79 year-old human stage0.333333
LOWER IN pan troglodytes troglodytes0.333333
LOWER IN cuba0.333333
asian0.333333
LOWER IN age &lt; 1 year0.333333
wild boar0.333333
age 35 days0.333333
abomasum0.333333
western australia0.333333
LOWER IN abomasum0.333333
fifth decade human stage0.250000
chimpanzee0.250000
hispanic or latin american0.250000
LOWER IN caucasian0.250000
LOWER IN european0.250000
LOWER IN neomycin0.250000
puerto rico0.250000
tibet autonomous region0.250000
yak0.250000
LOWER IN sewer0.200000
caloric restriction diet0.200000
LOWER IN hunter gatherer0.200000
LOWER IN young adult stage0.200000
pan troglodytes0.200000
monkey0.200000
LOWER IN vancomycin0.200000
rectal swab0.200000
LOWER IN age 1 week0.200000
state of washington0.200000
nigeria0.200000
state of ohio0.200000
age 1 year0.200000
bos grunniens0.200000
body mass index0.181818
LOWER IN body mass index0.181818
LOWER IN wastewater treatment plant0.166667
LOWER IN 6-12 year-old child stage0.166667
state of oregon0.166667
LOWER IN 1-month-old human stage0.166667
rural community0.153846
LOWER IN finland0.142857
LOWER IN crohn&#39;s disease0.142857
thailand0.142857
LOWER IN 3-month-old human stage0.142857
LOWER IN metronidazole0.142857
Fraction of annotations for the query sequences containing the term
TermScore
feces0.836735
homo sapiens0.653061
united states of america0.387755
adult0.326531
research facility0.224490
china0.163265
control0.122449
age 1 year0.122449
western australia0.122449
australia0.122449
ovis aries0.122449
sheep0.122449
low bmi0.102041
LOWER IN high bmi0.102041
city0.081633
infant0.081633
monkey0.081633
macaca mulatta0.081633
child0.061224
zoological garden0.061224
nigeria0.061224
edo state0.061224
abomasum0.061224
ileum0.061224
small village0.040816
body mass index0.040816
age < 3 years0.040816
LOWER IN finland0.040816
sixth decade human stage0.040816
nanning city prefecture0.040816
rural community0.040816
LOWER IN crohn&#39;s disease0.040816
cron diet0.040816
caloric restriction diet0.040816
africa0.040816
fifth decade human stage0.040816
fourth decade human stage0.040816
65-79 year-old human stage0.040816
LOWER IN nouabale-ndoki national park0.040816
LOWER IN wild0.040816
LOWER IN republic of congo0.040816
LOWER IN body mass index0.040816
hispanic or latin american0.040816
state of new york0.040816
age 8 months0.040816
rhesus macaque0.040816
captive0.040816
LOWER IN infant0.040816
caecum0.040816
age 35 days0.040816
cobb broiler chicken0.040816
male0.040816
gallus gallus0.040816
chicken0.040816
LOWER IN feces0.040816
LOWER IN colon0.040816
LOWER IN caecum0.040816
jejunum0.040816
LOWER IN rumen0.040816
el salvador0.020408
LOWER IN lima0.020408
LOWER IN shantytown0.020408
south america0.020408
low income0.020408
LOWER IN sewer0.020408
LOWER IN wastewater treatment plant0.020408
obsolete_juvenile stage0.020408
united kingdom0.020408
russia0.020408
estonia0.020408
physical activity0.020408
LOWER IN little physical activity0.020408
LOWER IN nephrolithiasis0.020408
LOWER IN ulcerative colitis0.020408
LOWER IN american diet0.020408
diet0.020408
LOWER IN amerindian0.020408
LOWER IN hunter gatherer0.020408
LOWER IN venezuela0.020408
thailand0.020408
karen0.020408
myanmar0.020408
LOWER IN hmong0.020408
LOWER IN china0.020408
central african republic0.020408
LOWER IN madagascar0.020408
bangui0.020408
LOWER IN antananarivo0.020408
LOWER IN duodenum0.020408
nanchang city prefecture0.020408
LOWER IN pancreatitis0.020408
LOWER IN acute pancreatitis0.020408
tenth decade human stage0.020408
ninth decade human stage0.020408
LOWER IN young adult stage0.020408
age >940.020408
LOWER IN soldiers0.020408
LOWER IN 6-12 year-old child stage0.020408
LOWER IN 2-5 year-old child stage0.020408
LOWER IN age 3-60.020408
Exp. ID User ID Description Date Region Flag Sequences
644amnonnegatively correalted with bmi ( high in low bmi compared to body mass index high bmi in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 42
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in state of new york united states of america homo sapiens adult feces )2020-09-09v4No1 / 75
905amnon high in abomasum compared to rumen in western australia sheep age 1 year australia ovis aries research facility 2022-05-19v3No1 / 78
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in sixth decade human stage homo sapiens feces adult nanning city prefecture china )2018-01-27v4No1 / 83
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in united states of america feces adult homo sapiens )2018-02-07v4No1 / 96
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in adult united states of america hispanic or latin american feces homo sapiens )2020-08-31v4No1 / 136
905amnoncommon ileum, western australia, sheep, age 1 year, australia, ovis aries, research facility2022-05-18v3No1 / 137
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in homo sapiens feces united states of america )2017-12-04v4No1 / 140
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens united states of america feces )2017-04-12v4No1 / 141
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in homo sapiens adult feces china 2018-02-05v4No1 / 161
290amnoncommon homo sapiens, feces, adult, city, china2018-02-01v4No1 / 162
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to sewer wastewater treatment plant in south america city low income )2017-01-21v4No1 / 187
744amnon high in caecum compared to cloaca in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 187
290amnoncommon homo sapiens, feces, adult, small village, rural community, china2018-02-01v4No1 / 218
671amnon high in state of oregon compared to state of california in age 8 months united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-27v4No1 / 232
960amnon high in 9-month-old human stage compared to 1-month-old human stage in homo sapiens nigeria edo state infant feces 2022-12-20v4No1 / 244
286amnoncommon in feces of individuals without kidney stones (common sixth decade human stage, homo sapiens, feces, adult, nanning city prefecture, control, china)2018-01-27v4No1 / 281
744amnon high in caecum compared to ileum in research facility age 35 days cobb broiler chicken male gallus gallus chicken 2021-02-21v3No1 / 286
428amnon high in control compared to pancreatitis acute pancreatitis in homo sapiens adult feces nanchang city prefecture china 2018-12-09v4No1 / 288
53amnon high in el salvador small village compared to lima shantytown in homo sapiens feces city 2017-01-21v4No1 / 296
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to metronidazole neomycin vancomycin antibiotic in state of california united states of america adult feces homo sapiens )2028-03-04v4No1 / 301
770amnon high in age 10-15 years adult organism compared to age < 1 year infant in rectal swab feces indian rhesus macaque macaca mulatta cayo santiago puerto rico 2021-04-19v4No1 / 304
666amnoncommon wild boar, sus scrofa, italy, feces2020-09-25v3No1 / 305
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in homo sapiens feces infant age < 3 years )2017-11-13v4No1 / 306
650amnon high in asian compared to caucasian european in feces adult homo sapiens united states of america state of new york 2020-09-12v4No1 / 317
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in karen myanmar compared to hmong china in homo sapiens feces thailand rural community )2018-11-18v4No1 / 329
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in homo sapiens feces united kingdom )2017-04-13v4No1 / 345
62amnoncommon homo sapiens, feces, united states of america, obsolete_juvenile stage, child2017-02-13v4No1 / 373
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in cron diet caloric restriction diet diet compared to american diet in homo sapiens adult feces united states of america )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces united states of america homo sapiens 2018-11-16v4No1 / 390
960amnon high in 18-month-old human stage compared to 9-month-old human stage in homo sapiens nigeria edo state infant feces 2022-12-20v4No1 / 407
425amnon high in feces compared to duodenum in homo sapiens africa child 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to amerindian hunter gatherer venezuela in feces homo sapiens )2018-09-06v4No1 / 417
905amnoncommon abomasum, age 1 year, western australia, research facility, australia, ovis aries, sheep2022-05-18v3No1 / 460
438amnon high in fifth decade human stage fourth decade human stage 65-79 year-old human stage adult compared to 6-12 year-old child stage 2-5 year-old child stage age 3-6 age 8-12 child in homo sapiens feces china 2018-12-30v4No1 / 486
905amnon high in jejunum ileum compared to abomasum rumen in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 563
425amnon high in central african republic bangui compared to madagascar antananarivo in homo sapiens feces africa child 2018-12-08v4No1 / 564
914amnoncommon tibet autonomous region, qinghai province, bos grunniens, yak, feces2022-06-26v3No1 / 575
995amnoncommon orangutan, pongo sp., columbus, state of ohio, united states of america, feces, monkey, zoological garden2022-12-27v4No1 / 613
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in tenth decade human stage ninth decade human stage fifth decade human stage fourth decade human stage 65-79 year-old human stage age >94 compared to young adult stage soldiers in homo sapiens feces china )2018-12-30v4No1 / 617
671amnon high in age 8 months compared to 3-month-old human stage age 6 months in united states of america monkey rhesus macaque macaca mulatta research facility captive feces 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to nouabale-ndoki national park republic of congo wild pan troglodytes troglodytes in chimpanzee feces 2020-05-06v4No1 / 964
620amnon high in united states of america zoological garden compared to nouabale-ndoki national park wild republic of congo in gorilla gorilla gorilla feces 2020-05-06v4No1 / 1019
876amnon high in age 20 months juvenile organism compared to age 1 week neonate in monkey state of washington macaca mulatta research facility united states of america feces 2022-03-06v4No1 / 1065
905amnon high in ileum jejunum compared to feces colon caecum in western australia sheep age 1 year australia ovis aries research facility 2022-05-18v3No1 / 1092
960amnon high in female adult compared to 18-month-old human stage infant in feces edo state nigeria homo sapiens 2022-12-20v4No1 / 1392
905amnon high in abomasum rumen compared to feces colon caecum in western australia sheep age 1 year australia ovis aries research facility 2022-05-19v3No1 / 2737

Problems / suggestions? Please email info AT dbbact DOT org