Search result for sequence:
TACGTATGGAGCAAGCGTTATCCGGATTTACTGGGTGTAAAGGGAGCGTAGACGGCAGGGCAAGTCTGATGTGAAAACCCGGGGCTCAACCCCGGGACTGCATTGGAAACTGTCCGGCTGGAGTGCAGGAGAGGTAAGTGGAATTCCTAG
common ontology terms
term enrichment score
TermScore
western australia0.240000
low bmi0.188679
age 1 year0.176471
LOWER IN high bmi0.175439
macaca mulatta0.153846
feces0.134459
homo sapiens0.120680
abomasum0.120000
sheep0.115385
city0.113208
ovis aries0.103448
monkey0.092308
adult0.090271
LOWER IN crohn's disease0.088889
nanning city prefecture0.083333
sixth decade human stage0.083333
cron diet0.083333
cobb broiler chicken0.083333
small village0.083333
rhesus macaque0.083333
age 8 months0.083333
LOWER IN republic of congo0.083333
LOWER IN nouabale-ndoki national park0.083333
united states of america0.080325
age < 3 years0.080000
age 35 days0.080000
65-79 year-old human stage0.080000
LOWER IN colon0.080000
hispanic or latin american0.076923
fifth decade human stage0.076923
caloric restriction diet0.074074
jejunum0.074074
LOWER IN body mass index0.072727
body mass index0.072727
rural community0.072727
LOWER IN finland0.068966
fourth decade human stage0.068966
australia0.065934
ileum0.065217
child0.061224
state of new york0.058824
zoological garden0.054054
chicken0.052632
gallus gallus0.051282
china0.050125
captive0.050000
research facility0.049080
LOWER IN rumen0.047619
control0.045113
LOWER IN cuba0.044444
LOWER IN acute pancreatitis0.044444
LOWER IN pancreatitis0.044444
LOWER IN lima0.044444
LOWER IN neonate0.044444
LOWER IN nephrolithiasis0.043478
LOWER IN little physical activity0.043478
low income0.043478
el salvador0.043478
LOWER IN shantytown0.043478
age 10-15 years0.043478
cayo santiago0.043478
puerto rico0.043478
indian rhesus macaque0.043478
myanmar0.043478
karen0.043478
LOWER IN hmong0.043478
LOWER IN age 3-60.043478
LOWER IN age 8-120.043478
LOWER IN abomasum0.043478
bangui0.043478
LOWER IN antananarivo0.043478
age >940.043478
tenth decade human stage0.043478
LOWER IN soldiers0.043478
LOWER IN age 6 months0.043478
gorilla gorilla gorilla0.043478
LOWER IN wild0.043478
physical activity0.042553
estonia0.042553
nanchang city prefecture0.042553
LOWER IN age &lt; 1 year0.042553
wild boar0.042553
asian0.042553
LOWER IN american diet0.042553
LOWER IN venezuela0.042553
LOWER IN amerindian0.042553
central african republic0.042553
LOWER IN madagascar0.042553
ninth decade human stage0.042553
LOWER IN pan troglodytes troglodytes0.042553
infant0.041667
LOWER IN vancomycin0.041667
LOWER IN neomycin0.041667
LOWER IN caucasian0.041667
LOWER IN european0.041667
LOWER IN hunter gatherer0.041667
chimpanzee0.041667
LOWER IN age 1 week0.041667
state of washington0.041667
LOWER IN wastewater treatment plant0.040816
Fraction of dbbact annotations with this term covered by the query
TermScore
LOWER IN crohn&#39;s disease2.000000
western australia1.000000
LOWER IN cuba1.000000
LOWER IN acute pancreatitis1.000000
LOWER IN pancreatitis1.000000
LOWER IN lima1.000000
LOWER IN neonate1.000000
low bmi0.555556
abomasum0.500000
LOWER IN nephrolithiasis0.500000
nanning city prefecture0.500000
sixth decade human stage0.500000
cron diet0.500000
LOWER IN little physical activity0.500000
low income0.500000
cobb broiler chicken0.500000
small village0.500000
macaca mulatta0.500000
rhesus macaque0.500000
age 8 months0.500000
el salvador0.500000
LOWER IN shantytown0.500000
age 10-15 years0.500000
cayo santiago0.500000
puerto rico0.500000
indian rhesus macaque0.500000
myanmar0.500000
karen0.500000
LOWER IN hmong0.500000
LOWER IN age 3-60.500000
LOWER IN age 8-120.500000
LOWER IN abomasum0.500000
bangui0.500000
LOWER IN antananarivo0.500000
age >940.500000
tenth decade human stage0.500000
LOWER IN soldiers0.500000
LOWER IN age 6 months0.500000
LOWER IN republic of congo0.500000
LOWER IN nouabale-ndoki national park0.500000
gorilla gorilla gorilla0.500000
LOWER IN high bmi0.384615
physical activity0.333333
estonia0.333333
age < 3 years0.333333
age 35 days0.333333
nanchang city prefecture0.333333
LOWER IN age &lt; 1 year0.333333
wild boar0.333333
asian0.333333
LOWER IN american diet0.333333
LOWER IN venezuela0.333333
LOWER IN amerindian0.333333
65-79 year-old human stage0.333333
central african republic0.333333
LOWER IN madagascar0.333333
ninth decade human stage0.333333
LOWER IN pan troglodytes troglodytes0.333333
LOWER IN colon0.333333
hispanic or latin american0.250000
age 1 year0.250000
LOWER IN vancomycin0.250000
LOWER IN neomycin0.250000
LOWER IN caucasian0.250000
LOWER IN european0.250000
LOWER IN hunter gatherer0.250000
fifth decade human stage0.250000
chimpanzee0.250000
LOWER IN age 1 week0.250000
state of washington0.250000
caloric restriction diet0.200000
LOWER IN wastewater treatment plant0.200000
LOWER IN sewer0.200000
rectal swab0.200000
LOWER IN 6-12 year-old child stage0.200000
jejunum0.200000
LOWER IN young adult stage0.200000
pan troglodytes0.200000
LOWER IN body mass index0.181818
body mass index0.181818
rural community0.181818
state of oregon0.166667
thailand0.166667
juvenile organism0.166667
city0.150000
LOWER IN finland0.142857
monkey0.142857
LOWER IN metronidazole0.142857
fourth decade human stage0.142857
LOWER IN 3-month-old human stage0.142857
mexico0.125000
LOWER IN ulcerative colitis0.125000
adult organism0.125000
LOWER IN cloaca0.111111
sheep0.100000
russia0.100000
obsolete_juvenile stage0.100000
LOWER IN duodenum0.090909
LOWER IN 2-5 year-old child stage0.090909
state of new york0.083333
Fraction of annotations for the query sequences containing the term
TermScore
feces0.818182
homo sapiens0.659091
united states of america0.409091
adult0.340909
research facility0.250000
china0.181818
ovis aries0.136364
australia0.136364
age 1 year0.136364
sheep0.136364
western australia0.136364
control0.136364
low bmi0.113636
LOWER IN high bmi0.113636
city0.090909
macaca mulatta0.090909
abomasum0.068182
ileum0.068182
monkey0.068182
child0.068182
LOWER IN body mass index0.045455
hispanic or latin american0.045455
state of new york0.045455
LOWER IN rumen0.045455
nanning city prefecture0.045455
sixth decade human stage0.045455
cron diet0.045455
caloric restriction diet0.045455
body mass index0.045455
LOWER IN finland0.045455
infant0.045455
age < 3 years0.045455
LOWER IN crohn&#39;s disease0.045455
caecum0.045455
gallus gallus0.045455
male0.045455
chicken0.045455
cobb broiler chicken0.045455
age 35 days0.045455
small village0.045455
rural community0.045455
captive0.045455
rhesus macaque0.045455
age 8 months0.045455
africa0.045455
65-79 year-old human stage0.045455
fourth decade human stage0.045455
fifth decade human stage0.045455
jejunum0.045455
zoological garden0.045455
LOWER IN wild0.045455
LOWER IN republic of congo0.045455
LOWER IN nouabale-ndoki national park0.045455
LOWER IN feces0.045455
LOWER IN caecum0.045455
LOWER IN colon0.045455
LOWER IN nephrolithiasis0.022727
mexico0.022727
LOWER IN cuba0.022727
physical activity0.022727
LOWER IN little physical activity0.022727
estonia0.022727
LOWER IN ulcerative colitis0.022727
LOWER IN wastewater treatment plant0.022727
LOWER IN sewer0.022727
south america0.022727
low income0.022727
LOWER IN cloaca0.022727
state of oregon0.022727
LOWER IN state of california0.022727
LOWER IN ileum0.022727
LOWER IN acute pancreatitis0.022727
LOWER IN pancreatitis0.022727
nanchang city prefecture0.022727
el salvador0.022727
LOWER IN lima0.022727
LOWER IN shantytown0.022727
LOWER IN antibiotic0.022727
LOWER IN vancomycin0.022727
LOWER IN metronidazole0.022727
LOWER IN neomycin0.022727
state of california0.022727
age 10-15 years0.022727
adult organism0.022727
LOWER IN infant0.022727
LOWER IN age &lt; 1 year0.022727
cayo santiago0.022727
puerto rico0.022727
rectal swab0.022727
indian rhesus macaque0.022727
sus scrofa0.022727
italy0.022727
wild boar0.022727
russia0.022727
asian0.022727
LOWER IN caucasian0.022727
LOWER IN european0.022727
myanmar0.022727
karen0.022727
LOWER IN hmong0.022727
Exp. ID User ID Description Date Region Flag Sequences
644amnonnegatively correalted with bmi ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 42
650amnonnegatively correlated with BMI ( high in low bmi compared to body mass index high bmi in feces homo sapiens united states of america adult state of new york )2020-09-09v4No1 / 75
905amnon high in abomasum compared to rumen in research facility ovis aries australia age 1 year sheep western australia 2022-05-19v3No1 / 78
286amnonlower in feces of individuals with kidney stones ( high in control compared to nephrolithiasis in feces homo sapiens adult nanning city prefecture china sixth decade human stage )2018-01-27v4No1 / 83
293amnonhigher in lean participants in human feces ( high in low bmi compared to high bmi in feces homo sapiens united states of america adult )2018-02-07v4No1 / 96
293amnoncommon feces, homo sapiens, united states of america, adult, cron diet, caloric restriction diet2018-02-07v4No1 / 134
644amnonhigher in individuals born in mexico compared to cuba ( high in mexico compared to cuba in feces homo sapiens united states of america adult hispanic or latin american )2020-08-31v4No1 / 136
905amnoncommon research facility, ileum, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 137
63amnonhigher in individuals with high physical activity ( high in physical activity compared to little physical activity in feces homo sapiens united states of america )2017-12-04v4No1 / 140
63amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in feces homo sapiens united states of america )2017-04-12v4No1 / 141
241amnonlower in babies from finland compared to estonia ( high in estonia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 157
292amnon high in control compared to crohn's disease ulcerative colitis in feces homo sapiens adult china 2018-02-05v4No1 / 161
290amnoncommon feces, homo sapiens, city, adult, china2018-02-01v4No1 / 162
53amnonlower in sewer and wastewater treatment plant influent compared to feces in south america ( high in feces homo sapiens compared to wastewater treatment plant sewer in city south america low income )2017-01-21v4No1 / 187
744amnon high in caecum compared to cloaca in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 187
290amnoncommon feces, homo sapiens, adult, small village, rural community, china2018-02-01v4No1 / 218
671amnon high in state of oregon compared to state of california in feces united states of america research facility macaca mulatta monkey captive rhesus macaque age 8 months 2020-09-27v4No1 / 232
286amnoncommon in feces of individuals without kidney stones (common feces, homo sapiens, control, adult, nanning city prefecture, china, sixth decade human stage)2018-01-27v4No1 / 281
744amnon high in caecum compared to ileum in research facility gallus gallus male chicken cobb broiler chicken age 35 days 2021-02-21v3No1 / 286
428amnon high in control compared to acute pancreatitis pancreatitis in feces homo sapiens adult nanchang city prefecture china 2018-12-09v4No1 / 288
53amnon high in el salvador small village compared to lima shantytown in feces homo sapiens city 2017-01-21v4No1 / 296
683amnonlower in antibiotic treatment (combined 3 antibiotics) compared to pre-treatment ( high in control compared to antibiotic vancomycin metronidazole neomycin in feces homo sapiens united states of america adult state of california )2028-03-04v4No1 / 301
770amnon high in age 10-15 years adult organism compared to infant age < 1 year in feces macaca mulatta cayo santiago puerto rico rectal swab indian rhesus macaque 2021-04-19v4No1 / 304
666amnoncommon feces, sus scrofa, italy, wild boar2020-09-25v3No1 / 305
241amnonhigher in babies from russia compared to finland ( high in russia compared to finland in feces homo sapiens infant age < 3 years )2017-11-13v4No1 / 306
650amnon high in asian compared to caucasian european in feces homo sapiens united states of america adult state of new york 2020-09-12v4No1 / 317
400amnonlower in hmong ethnic group (from china) compared to karen ethnic group (from burma) ( high in myanmar karen compared to hmong china in feces homo sapiens thailand rural community )2018-11-18v4No1 / 329
122amnonnegatively correlated with bmi ( high in body mass index low bmi compared to high bmi in feces homo sapiens united kingdom )2017-04-13v4No1 / 345
62amnoncommon feces, homo sapiens, united states of america, child, obsolete_juvenile stage2017-02-13v4No1 / 373
293amnonhigher in caloric restriction (CRON) diet compared to american diet ( high in diet cron diet caloric restriction diet compared to american diet in feces homo sapiens united states of america adult )2018-02-07v4No1 / 381
399amnon high in control compared to crohn's disease in feces homo sapiens united states of america 2018-11-16v4No1 / 390
425amnon high in feces compared to duodenum in homo sapiens child africa 2018-12-08v4No1 / 416
371amnonlower in amerindians compared to western visitors ( high in united states of america city compared to venezuela amerindian hunter gatherer in feces homo sapiens )2018-09-06v4No1 / 417
905amnoncommon research facility, abomasum, ovis aries, australia, age 1 year, sheep, western australia2022-05-18v3No1 / 460
438amnon high in adult 65-79 year-old human stage fourth decade human stage fifth decade human stage compared to child age 3-6 age 8-12 2-5 year-old child stage 6-12 year-old child stage in feces homo sapiens china 2018-12-30v4No1 / 486
905amnon high in jejunum ileum compared to abomasum rumen in research facility ovis aries australia age 1 year sheep western australia 2022-05-18v3No1 / 563
425amnon high in central african republic bangui compared to madagascar antananarivo in feces homo sapiens child africa 2018-12-08v4No1 / 564
438amnonlower in students and soldiers age 19-24 compared to older adults ( high in age >94 65-79 year-old human stage fourth decade human stage fifth decade human stage ninth decade human stage tenth decade human stage compared to soldiers young adult stage in feces homo sapiens china )2018-12-30v4No1 / 617
671amnon high in age 8 months compared to age 6 months 3-month-old human stage in feces united states of america research facility macaca mulatta monkey captive rhesus macaque 2020-09-28v4No1 / 955
620amnon high in united states of america zoological garden pan troglodytes compared to wild pan troglodytes troglodytes republic of congo nouabale-ndoki national park in feces chimpanzee 2020-05-06v4No1 / 964
620amnon high in united states of america zoological garden compared to wild republic of congo nouabale-ndoki national park in feces gorilla gorilla gorilla 2020-05-06v4No1 / 1019
876amnon high in juvenile organism age 20 months compared to age 1 week neonate in feces united states of america research facility macaca mulatta state of washington monkey 2022-03-06v4No1 / 1065
905amnon high in jejunum ileum compared to feces caecum colon in research facility ovis aries australia age 1 year sheep western australia 2022-05-18v3No1 / 1092
905amnon high in abomasum rumen compared to feces caecum colon in research facility ovis aries australia age 1 year sheep western australia 2022-05-19v3No1 / 2737

Problems / suggestions? Please email info AT dbbact DOT org